Search Results

Search found 8344 results on 334 pages for 'count'.

Page 281/334 | < Previous Page | 277 278 279 280 281 282 283 284 285 286 287 288  | Next Page >

  • Activetopics - Get max 5 topics per category

    - by Arjen
    Hey, I want to get the 5 latest active topics within several category's. Each topic has a subcatid and this subcatid relates to a catid. What I want is to get the 5 active topics within each catid. I'm trying to use the query below, but this isn't working at all: set @num := 0, @catid := 0; SELECT forum_posts.topicid, forum_topics.titel, forum_topics.sticky, forum_topics.gesloten, MAX(forum_cats.id) AS catid, MAX(forum_cats.titel) AS cattitel, MAX(forum_subcats.id) AS subcatid, MAX(forum_posts.id) AS maxid, DATE_FORMAT(MAX(forum_posts.datum), '%d-%m-%Y om %H:%i uur') AS datum, UNIX_TIMESTAMP(MAX(forum_posts.datum)) AS laatstereactieunix, (COUNT(forum_posts.id) - 1) AS reactieaantal, @num := IF(@catid = MAX(forum_cats.id), @num + 1, 1) AS row_number, @catid := MAX(forum_cats.id) AS dummy FROM forum_posts INNER JOIN forum_topics ON forum_topics.id = forum_posts.topicid INNER JOIN forum_subcats ON forum_subcats.id = forum_topics.subcat INNER JOIN forum_cats ON forum_cats.id = forum_subcats.cat WHERE forum_cats.id IN (1) AND forum_topics.gesloten != '1' GROUP BY forum_posts.topicid, forum_topics.titel, forum_topics.sticky, forum_topics.gesloten HAVING row_number <= 5 ORDER BY forum_cats.id ASC, MAX(forum_posts.datum) DESC When executing this code I get always the same number (1) for row_number, so this is not the result I want. Does anyone know how I can get this work? Thanks!

    Read the article

  • Constructor initializer list: code from the C++ Primer, chapter 16

    - by Alexandros Gezerlis
    Toward the end of Chapter 16 of the "C++ Primer" I encountered the following code (I've removed a bunch of lines): class Sales_item { public: // default constructor: unbound handle Sales_item(): h() { } private: Handle<Item_base> h; // use-counted handle }; My problem is with the Sales_item(): h() { } line. For the sake of completeness, let me also quote the parts of the Handle class template that I think are relevant to my question (I think I don't need to show the Item_base class): template <class T> class Handle { public: // unbound handle Handle(T *p = 0): ptr(p), use(new size_t(1)) { } private: T* ptr; // shared object size_t *use; // count of how many Handles point to *ptr }; I would have expected something like either: a) Sales_item(): h(0) { } which is a convention the authors have used repeatedly in earlier chapters, or b) Handle<Item_base>() if the intention was to invoke the default constructor of the Handle class. Instead, what the book has is Sales_item(): h() { }. My gut reaction is that this is a typo, since h() looks suspiciously similar to a function declaration. On the other hand, I just tried compiling under g++ and running the example code that uses this class and it seems to be working correctly. Any thoughts?

    Read the article

  • Can't add/remove items from a collection while foreach is iterating over it

    - by flockofcode
    If I make my own implementation of IEnumerator interface, then I am able ( inside foreach statement )to add or remove items from a albumsList without generating an exception.But if foreach statement uses IEnumerator supplied by albumsList, then trying to add/delete ( inside the foreach )items from albumsList will result in exception: class Program { static void Main(string[] args) { string[] rockAlbums = { "rock", "roll", "rain dogs" }; ArrayList albumsList = new ArrayList(rockAlbums); AlbumsCollection ac = new AlbumsCollection(albumsList); foreach (string item in ac) { Console.WriteLine(item); albumsList.Remove(item); //works } foreach (string item in albumsList) { albumsList.Remove(item); //exception } } class MyEnumerator : IEnumerator { ArrayList table; int _current = -1; public Object Current { get { return table[_current]; } } public bool MoveNext() { if (_current + 1 < table.Count) { _current++; return true; } else return false; } public void Reset() { _current = -1; } public MyEnumerator(ArrayList albums) { this.table = albums; } } class AlbumsCollection : IEnumerable { public ArrayList albums; public IEnumerator GetEnumerator() { return new MyEnumerator(this.albums); } public AlbumsCollection(ArrayList albums) { this.albums = albums; } } } a) I assume code that throws exception ( when using IEnumerator implementation A supplied by albumsList ) is located inside A? b) If I want to be able to add/remove items from a collection ( while foreach is iterating over it), will I always need to provide my own implementation of IEnumerator interface, or can albumsList be set to allow adding/removing items? thank you

    Read the article

  • How to find whole graph coverage path in dynamic state-flow diagram?

    - by joseph
    Hello, As I've been researching algorithms for path finding in graph, I found interesting problem. Definition of situation: 1)State diagram can have p states, and s Boolean Fields, and z Int Fields 2)Every state can have q ingoing and r outgoing transitions, and h Int fields (h belongs to z - see above) 3)Every transition can have only 1 event, and only 1 action 4)every action can change n Boolean Fields, and x Int Fields 5)every event can have one trigger from combination of any count of Boolean Fields in diagram 6)Transition can be in OPEN/CLOSED form. If the transition is open/closed depends on trigger2 compounded from 0..c Boolean fields. 7) I KNOW algorithm for finding shortest paths from state A to state B. 8) I KNOW algorithm for finding path that covers all states and transitions of whole state diagram, if all transitions are OPEN. Now, what is the goal: I need to find shortest path that covers all states and transitions in dynamically changing state diagram described above. When an action changes some int field, the algorithm should go through all states that have changed int field. The algorithm should also be able to open and close transition (by going through transitions that open and close another transitions by action) in the way that the founded path will be shortest and covers all transitions and states. Any idea how to solve it? I will be really pleased for ANY idea. Thanks for answers.

    Read the article

  • PHP Recursive Function

    - by Tempname
    In my database I have a hierarchical flat table that returns data ordered by ParentID, ObjectID asc I am having a bit of an issue getting this recursive function to work properly. I get the first ParentChildChild but after that I get nothing else. Any help with this is greatly appreciated. Here is my testing code: $objectArr = array(); $objectData = DAOFactory::getTemplateObjectsDAO()->queryByTemplateID(1); for($i = 0; $i < count($objectData); $i++) { if(empty($objectData[$i]->parentID)) { echo $objectData[$i]->objectID; $objectArr[$i] = $objectData[$i]; $objectArr[$i]->children = array(); $objectArr[$i]->children = getChildren($objectData[$i]->objectID, $objectData); } } function getChildren($objectID, $data) { $childArr = array(); foreach($data as $object) { if($object->parentID == $objectID) { $childArr = $object; $childArr->children = array(); $childArr->children = getChildren($object->objectID, $data); } } return $childArr; } new dBug($objectData); This is the output that I am getting: Fullsize Link

    Read the article

  • Hundreds of custom UserControls create thousands of USER Objects

    - by Andy Blackman
    I'm creating a dashboard application that shows hundreds of "items" on a FlowLayoutPanel. Each "item" is a UserControl that is made up of 12 or labels. My app queries a database and then creates an "item" instance for each record, populating ethe labels and textboxes with data before adding it to the FlowLayoutPanel. After adding about 560 items to the panel, I noticed that the USER Objects count in my Task Manager had gone up to about 7300, which was much much larger than any other app on my machine. I did a quick spot of mental arithmetic (OK, I might have used calc.exe) and figured that 560 * 13 (12 labels plus the UserControl itself) is 7280. So that suddenly gave away where all the objects were coming from... Knowing that there is a 10,000 USER object limit before windows throws in the towel, I'm trying to figure better ways of drawing these items onto the FlowLayoutPanel. My ideas so far are as follows: 1) User-draw the "item", using graphics.DrawText and DrawImage in place of many of the labels. I'm hoping that this will mean 1 item = 1 USER Object, not 13. 2) Have 1 instance of the "item", then for each record, populate the instance and use the Control.DrawToBitmap() method to grab an image and then use that in the FlowLayoutPanel (or similar) So... Does anyone have any other suggestions ??? P.S. It's a zoomable interface, so I have already ruled out "Paging" as there is a requirement to see all items at once :( Thanks everyone.

    Read the article

  • NSOutlineView not redrawing

    - by Septih
    Hello, I have an NSOutlineView with checkboxes. I have the checkbox state bound to a node item with the key shouldBeCopied. In the node item I have the getters and setters like so: -(BOOL)shouldBeCopied { if([[self parent] shouldBeCopied]) return YES; return shouldBeCopied; } -(void)setShouldBeCopied:(BOOL)value { shouldBeCopied = value; if(value && [[self children] count] > 0) [[self delegate] reloadData]; } The idea here is that if the parent is checked, so should the children. The problem I'm having is that when I check the parent, it does not update that view of the children if they are already expanded. I can understand that it should not be updated by the bindings because i'm not actually changing the value. But should reloadData not cause the bindings to re-get the value, thus calling -shouldBeCopied for the children? I have tried a few other things such as -setNeedsDisplay and -reloadItem:nil reloadChildren:YES but none work. I've noticed that the display gets refreshed when I swap to xcode and then back again and that's all I want, so how do I get it to behave that way?

    Read the article

  • Is there a way to detect Layout or Display changes in WPF?

    Hello! I am trying to check how fast the Frame control can display a FixedPage object when it is assigned to Frame.Content property. I plan to check the tick count before and after the assignment to the Content property. Example: int starttime = Environment.TickCount; frame1.Content = fixedpage; int endtime = Environment.TickCount; The problem is that the assignment to the Content property might be asynchronous and returns immediately therefore i get a zero amount of time. The rendering of the FixedPage however visually has a lag time from assignment of the Content property up to the point where the FixedPage appears on screen. The Frame.ContentChanged() event is no good either because it gets triggered even before the FixedPage appears on screen so it's not accurate. I'm thinking of detecting the change on the window or control's display instead in order to get the time when the FixedPage is actually displayed on screen. Is there a way to do this in WPF? Thanks!

    Read the article

  • jQuery preventing RedirectToAction from working?

    - by DaveDev
    I'm trying to redirect the user if they login successfully but the code I have on my page seems to be preventing the redirection from working. If I remove the jQuery below the redirection works. Can somebody tell me tell me if there's something I'm doing wrong? Thanks I have the following Action: [AcceptVerbs(HttpVerbs.Post)] public ActionResult Login(User user) { var myErrors = new Dictionary<string, string>(); try { if (ModelState.IsValid) { if (userRepository.ValidUser(user)) { return RedirectToAction("Index", "Group", new {page = (int?)null}); } else { return Json("Username or password seems to be incorrect"); } } else { foreach (KeyValuePair<string, ModelState> keyValuePair in ViewData.ModelState) { if (keyValuePair.Value.Errors.Count > 0) { List<string> errors = new List<string>(); myErrors.Add(keyValuePair.Key, keyValuePair.Value.Errors[0].ErrorMessage); } } return Json(myErrors); } } catch (Exception) { return Json("Invalid"); } } and the following code on my page: <script language="javascript" type="text/javascript"> $(document).ready(function() { $("#SaveSuccess").hide(); $("#btnLogin").click(function() { $("form").submit(function(event) { var formData = $(this).serialize(); $.post($(this).attr("action"), formData, function(res) { ShowErrors(res); if (res == true) { $("#SaveSuccess").text("Saved"); } else { $("#divError").html(res); } $("#SaveSuccess").fadeIn(100); }, "json"); return false; }); }); }); </script>

    Read the article

  • MACRO compilation PROBLEM

    - by wildfly
    i was given a primitive task to find out (and to put in cl) how many nums in an array are bigger than the following ones, (meaning if (arr[i] arr[i+1]) count++;) but i've problems as it has to be a macro. i am getting errors from TASM. can someone give me a pointer? SortA macro a, l LOCAL noes irp reg, <si,di,bx> push reg endm xor bx,bx xor si,si rept l-1 ;;also tried rept 3 : wont' compile mov bl,a[si] inc si cmp bl,arr[si] jb noes inc di noes: add di,0 endm mov cx,di irp reg2, <bx,di,si> pop reg2 endm endm dseg segment arr db 10,9,8,7 len = 4 dseg ends sseg segment stack dw 100 dup (?) sseg ends cseg segment assume ds:dseg, ss:sseg, cs:cseg start: mov ax, dseg mov ds,ax sortA arr,len cseg ends end start errors: Assembling file: sorta.asm **Error** sorta.asm(51) REPT(4) Expecting pointer type **Error** sorta.asm(51) REPT(6) Symbol already different kind: NOES **Error** sorta.asm(51) REPT(10) Expecting pointer type **Error** sorta.asm(51) REPT(12) Symbol already different kind: NOES **Error** sorta.asm(51) REPT(16) Expecting pointer type **Error** sorta.asm(51) REPT(18) Symbol already different kind: NOES Error messages: 6

    Read the article

  • itearation through gridview

    - by user1405508
    I want to get cell value from gridview,but empty string is returned .I am implemented code in selectedindexchanged event of radiobuttonlist .I iterate through gridview and access cell by code .but problem is stll remaining.I used three itemtemplate ,each has one elemnt so that each element get its own coulmn .aspx <asp:GridView ID="GridView2" runat="server" AutoGenerateColumns="false" > <Columns> <asp:Label ID="Label2" runat="server" Text='<%# Eval("qno") %>'> </asp:Label> </ItemTemplate> </asp:TemplateField> <asp:TemplateField> <ItemTemplate> <asp:Label ID="Label3" runat="server" Text='<%# Eval("description") %>'> </ItemTemplate> </asp:TemplateField> <asp:RadioButtonList ID="RadioButtonList1" RepeatDirection="Horizontal" runat="server" OnSelectedIndexChanged="changed" AutoPostBack="true" > <asp:ListItem Value="agree" Selected="True" > </asp:ListItem> <asp:ListItem Value="disagree"> </asp:ListItem> <asp:ListItem Value="strongagree"> </asp:ListItem> <asp:ListItem Value="strondisagree"> </asp:ListItem> </asp:RadioButtonList> </Columns> </asp:GridView> <asp:Label ID="Labe11" runat="server" ></asp:Label> Code behind: public void changed(object sender, EventArgs e) { for(int i=0;i<GridView2.Rows.Count;i++) { string labtext; RadioButtonList list = GridView2.Rows[i].Cells[2].FindControl("RadioButtonList1") as RadioButtonList; labtext= GridView2.Rows[i].Cells[0].Text; Label1.Text = labtext; } }

    Read the article

  • Cant access NString after callback in [NSURLConnection sendSynchronousRequest]

    - by John ClearZ
    Hi I am trying to get a cookie from a site which I can do no problem. The problem arises when I try and save the cookie to a NSString in a holder class or anywhere else for that matter and try and access it outside the delegate method where it is first created. - (void)connection:(NSURLConnection *)connection didReceiveResponse:(NSURLResponse *)response { int i; NSString* c; NSArray* all = [NSHTTPCookie cookiesWithResponseHeaderFields:[response allHeaderFields] forURL:[NSURL URLWithString:@"http://johncleary.net"]]; //NSLog(@"RESPONSE HEADERS: \n%@", [response allHeaderFields]); for (i=0;i<[all count];i++) { NSHTTPCookie* cc = [all objectAtIndex: i]; c = [NSString stringWithFormat: @"%@=%@", [cc name], [cc value]]; [Cookie setCookie: c]; NSLog([Cookie cookie]) // Prints the cookie fine. } [receivedData setLength:0]; } I can see and print the cookie when I am in the method but I cant when trying to access it form anywhere else even though it gets stored in the holder class @interface Cookie : NSObject { NSString* cookie; } + (NSString*) cookie; + (void) setCookie: (NSString*) cookieValue; @end int main (void) { NSAutoreleasePool * pool = [[NSAutoreleasePool alloc] init]; JCLogin* login; login = [JCLogin new]; [login DoLogin]; NSLog([Cookie cookie]); // Crashes the program [pool drain]; return 0; }

    Read the article

  • auto refresh of div in mvc3 ASP.Net not working

    - by user1493249
    ViewData.cshtml(Partial View) Date Bill Amount PayNow </tr> </thead> <tbody> @{ for (int i = @Model.bill.Count - 1; i >= 0; i--) { <tr> <td width="30%" align="center">@Model.billdate[i]</td> <td width="30%" align="center">@Model.bill[i]</td> <td width="30%" align="center"> <a class="isDone" href="#" data-tododb-itemid="@Model.bill[i]">Paynow</a> </td> </tr> } } </tbody> Index.cshtml(View) $(document).ready(function () { window.setInterval(function () { var url = '@Url.Action("SomeScreen", "Home")'; $('#dynamictabs').load(url) }, 9000); $.ajaxSetup({ cache: false }); }); @Html.Partial("ViewData") HomeController.cs(Controller) public ActionResult Index() { fieldProcessor fp= new fieldProcessor(); return View(fp); } public ActionResult ShowScreen() { return View("ViewData",fp); } Still the same is not working..

    Read the article

  • Python coin-toss

    - by Andy
    i am new to Python, and i can't wrap my head around this. I have following function defined: def FlipCoins(num_flips): heads_rounds_won = 0 for i in range(10000): heads = 0 tails = 0 for j in range(num_flips): dice = random.randint(0,1) if dice==1: heads += 1 else: tails += 1 if heads > tails: heads_rounds_won += 1 return heads_rounds_won Here is what it should do (but apparently doesn't): flip a coin num_flip times, count heads and tails, and see if there are more heads than tails. If yes, increment head_rounds_won by 1. Repeat 10000 times. I would assume that head_rounds_won will approximate 5000 (50%). And it does that for odd numbers as input. For example, 3, 5 or 7 will produce about 50%. However, even numbers will produce much lower results, more like 34%. Small numbers especially, with higher even numbers, like for example 800, the difference to 50% is much narrower. Why is this the case? Shouldn't any input produce about 50% heads/tails?

    Read the article

  • A little confused about MVC and where to put a database query

    - by jax
    OK, so my Joomla app is in MVC format. I am still a little confused about where to put certain operations, in the Controller or in the Model. This function below is in the controller, it gets called when &task=remove. Should the database stuff be in the Model? It does not seem to fit there because I have two models editapp (display a single application) and allapps (display all the applications), now which one would I put the delete operation in? /** * Delete an application */ function remove() { global $mainframe; $cid = JRequest::getVar( 'cid', array(), '', 'array' ); $db =& JFactory::getDBO(); //if there are items to delete if(count($cid)){ $cids = implode( ',', $cid ); $query = "DELETE FROM #__myapp_apps WHERE id IN ( $cids )"; $db->setQuery( $query ); if (!$db->query()){ echo "<script> alert('".$db->getErrorMsg()."');window.history.go(-1); </script>\n"; } } $mainframe->redirect( 'index.php?option=' . $option . '&c=apps'); } I am also confused about how the flow works. For example, there is a display() function in the controller that gets called by default. If I pass a task, does the display() function still run or does it go directly to the function name passed by $task?

    Read the article

  • C# XNA: What can cause SpriteBatch.End() to throw a NRE?

    - by Rosarch
    I don't understand what I'm doing wrong here: public void Draw(GameTime gameTime) // in ScreenManager { SpriteBatch.Begin(SpriteBlendMode.AlphaBlend); for (int i = 0; i < Screens.Count; i++) { if (Screens[i].State == Screen.ScreenState.HIDDEN) continue; Screens[i].Draw(gameTime); } SpriteBatch.End(); // null ref exception } SpriteBatch itself is not null. Some more context: public class MasterEngine : Microsoft.Xna.Framework.Game { public MasterEngine() { graphicsDeviceManager = new GraphicsDeviceManager(this); Components.Add(new GamerServicesComponent(this)); // ... spriteBatch = new SpriteBatch(graphicsDeviceManager.GraphicsDevice); screenManager = new ScreenManager(assets, gameEngine, graphicsDeviceManager.GraphicsDevice, spriteBatch); } //... protected override void Draw(GameTime gameTime) { screenManager.Draw(gameTime); // calls the problematic method base.Draw(gameTime); } } Am I failing to initialize something properly? UPDATE: As an experiment, I tried this to the constructor of MasterEngine: spriteBatch = new SpriteBatch(graphicsDeviceManager.GraphicsDevice); spriteBatch.Begin(); spriteBatch.DrawString(assets.GetAsset<SpriteFont>("calibri"), "ftw", new Vector2(), Color.White); spriteBatch.End(); This does not cause a NRE. hmm.... UPDATE 2: This does cause an NRE: protected override void Draw(GameTime gameTime) { spriteBatch.Begin(); spriteBatch.End(); // boned here //screenManager.Draw(gameTime); base.Draw(gameTime); }

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Listview not being populated

    - by Luke
    I have put some console.writeline code in to test, but they arent appearing in the output box? public static ArrayList myDeliveries = new ArrayList(); public mainForm() { InitializeComponent(); } private void mainForm_Load(object sender, EventArgs e) { if (!File.Exists("../../MealDeliveries.txt")) { MessageBox.Show("File not found!"); return; } using (StreamReader sr = new StreamReader("../../MealDeliveries.txt")) { //first line is delivery name string strDeliveryName = sr.ReadLine(); Console.WriteLine("some tetttttttttt23423423423423423ttttttttttttttttttttttt"); while (strDeliveryName != null) { //other lines Delivery d = new Delivery(strDeliveryName, sr.ReadLine(), sr.ReadLine(), sr.ReadLine(), sr.ReadLine(), sr.ReadLine(), sr.ReadLine()); mainForm.myDeliveries.Add(d); //check for further values strDeliveryName = sr.ReadLine(); } } displayDeliveries(); } private void displayDeliveries() { lstDeliveryDetails.Items.Clear(); Console.WriteLine("some tettttttttttttttttttttttttttttttttt"); Console.WriteLine(mainForm.myDeliveries.Count); foreach (Delivery d in mainForm.myDeliveries) { lstDeliveryDetails.Items.Add(d.DeliveryName); } } Can anyone help??

    Read the article

  • Why am I getting a EXC_BAD_ACCESS in a NSTimer selector?

    - by AngeDeLaMort
    I've got quite a weird problem. To make it short, i'll write some pseudo-code: init: create a dictionary and insert n elements. create a "repeat timer" and add it to the currentRunLoop using the timerRefresh selector. timerRefresh: using a list of keys, find the items in the dictionary if the item exists -> call a function So, for an unknown reason, I get an EXC_BAD_ACCESS when I do: [item function]; But I traced the address I got from the dictionary items and it's ok. The ref count of the items in the dictionary is still 1. The {release, dealloc} of the items in the dictionary aren't called. Everything seems fine. Also, to make it worst, it works for some items. So, I'm wondering if there is a threading problem? or something else obscure? The callstack is quite simple: #0 0x93e0604b in objc_msgSend_fpret #1 0x00f3e6b0 in ?? #2 0x0001cfca in -[myObject functionm:] at myObject.m:000 #3 0x305355cd in __NSFireTimer #4 0x302454a0 in CFRunLoopRunSpecific #5 0x30244628 in CFRunLoopRunInMode #6 0x32044c31 in GSEventRunModal #7 0x32044cf6 in GSEventRun #8 0x309021ee in UIApplicationMain #9 0x000027e0 in main at main.m:14 So, any suggestion where to look would be appreciated.

    Read the article

  • MySQL left outer join is slow

    - by Ryan Doherty
    Hi, hoping to get some help with this query, I've worked at it for a while now and can't get it any faster: SELECT date, count(id) as 'visits' FROM dates LEFT OUTER JOIN visits ON (dates.date = DATE(visits.start) and account_id = 40 ) WHERE date >= '2010-12-13' AND date <= '2011-1-13' GROUP BY date ORDER BY date ASC That query takes about 8 seconds to run. I've added indexes on dates.date, visits.start, visits.account_id and visits.start+visits.account_id and can't get it to run any faster. Table structure (only showing relevant columns in visit table): create table visits ( `id` int(11) NOT NULL AUTO_INCREMENT, `account_id` int(11) NOT NULL, `start` DATETIME NOT NULL, `end` DATETIME NULL, PRIMARY KEY (`id`) ) ENGINE=MyISAM DEFAULT CHARSET=utf8; CREATE TABLE `dates` ( `date` date NOT NULL, PRIMARY KEY (`date`) ) ENGINE=MyISAM DEFAULT CHARSET=latin1; dates table contains all days from 2010-1-1 to 2020-1-1 (~3k rows). visits table contains about 400k rows dating from 2010-6-1 to yesterday. I'm using the date table so the join will return 0 visits for days there were no visits. Results I want for reference: +------------+--------+ | date | visits | +------------+--------+ | 2010-12-13 | 301 | | 2010-12-14 | 356 | | 2010-12-15 | 423 | | 2010-12-16 | 332 | | 2010-12-17 | 346 | | 2010-12-18 | 226 | | 2010-12-19 | 213 | | 2010-12-20 | 311 | | 2010-12-21 | 273 | | 2010-12-22 | 286 | | 2010-12-23 | 241 | | 2010-12-24 | 149 | | 2010-12-25 | 102 | | 2010-12-26 | 174 | | 2010-12-27 | 258 | | 2010-12-28 | 348 | | 2010-12-29 | 392 | | 2010-12-30 | 395 | | 2010-12-31 | 278 | | 2011-01-01 | 241 | | 2011-01-02 | 295 | | 2011-01-03 | 369 | | 2011-01-04 | 438 | | 2011-01-05 | 393 | | 2011-01-06 | 368 | | 2011-01-07 | 435 | | 2011-01-08 | 313 | | 2011-01-09 | 250 | | 2011-01-10 | 345 | | 2011-01-11 | 387 | | 2011-01-12 | 0 | | 2011-01-13 | 0 | +------------+--------+ Thanks in advance for any help!

    Read the article

  • Should I use early returns in C#?

    - by Bobby
    I've learned Visual Basic and was always taught to keep the flow of the program without interruptions, like Goto, Exit and Return. Using nested ifs instead of one return statement seems very natural to me. Now that I'm partly migrating towards C#, I wonder what the best practice is for C-like languages. I've been working on a C# project for some time, and of course discover more code of ExampleB and it's hurting my mind somehow. But what is the best practice for this, what is more often used and are there any reasons against one of the styles? public void ExampleA() { if (a != b) { if (a != c) { bool foundIt; for (int i = 0; i < d.Count && !foundIt; i++) { if (element == f) foundIt = true; } } } } public void ExampleB() { if (a == b) return; if (a == c) return; foreach (object element in d) { if (element == f) break; } }

    Read the article

  • Include php code within echo from a random text

    - by lisa
    I want to display a php code at random and so for I have <?php // load the file that contain thecode $adfile = "code.txt"; $ads = array(); // one line per code $fh = fopen($adfile, "r"); while(!feof($fh)) { $line = fgets($fh, 10240); $line = trim($line); if($line != "") { $ads[] = $line; } } // randomly pick an code $num = count($ads); $idx = rand(0, $num-1); echo $ads[$idx]; ?> The code.txt has lines like <?php print insert_proplayer( array( "width" => "600", "height" => "400" ), "http://www.youtube.com/watch?v=xnPCpCVepCg"); ?> Proplayer is a wordpress plugin that displays a video. The codes in code.txt work well, but not when I use the pick line from code.txt. Instead of the full php line I get: "width" => "600", "height" => "400" ), "http://www.youtube.com/watch?v=xnPCpCVepCg"); ?> How can I make the echo show the php code, rather than a txt version of the php code?

    Read the article

  • LINQ to SQL Converter

    - by user609511
    How can I convert My LINQ to SQL ? i have this LINQ statement: int LimCol = Convert.ToInt32(LimitColis); result = oListTUP .GroupBy(x => new { x.Item1, x.Item2, x.Item3, x.Item4, x.Item5 }) .Select(g => new { Key = g.Key, Sum = g.Sum(x => x.Item6), Poids = g.Sum(x => x.Item7), }) .Select(p => new { Key = p.Key, Items = Enumerable.Repeat(LimCol, p.Sum / LimCol).Concat(Enumerable.Repeat(p.Sum % LimCol, p.Sum % LimCol > 0 ? 1 : 0)), CalculPoids = p.Poids / Enumerable.Repeat(LimCol, p.Sum / LimCol).Concat(Enumerable.Repeat(p.Sum % LimCol, p.Sum % LimCol > 0 ? 1 : 0)).Count() }) .SelectMany(p => p.Items.Select(i => Tuple.Create(p.Key.Item1, p.Key.Item2, p.Key.Item3, p.Key.Item4, p.Key.Item5, i, p.CalculPoids))) .ToList(); } It works well, but somehow want to push it and it become too complicated, so I want to convert it into Pure SQL. I have tried SQL Profiler and LinqPad, but neither shows me the SQL. How can I see the SQL code from My LINQ ? Thank you in advance.

    Read the article

  • Application Code Redesign to reduce no. of Database Hits from Performance Perspective

    - by Rachel
    Scenario I want to parse a large CSV file and inserts data into the database, csv file has approximately 100K rows of data. Currently I am using fgetcsv to parse through the file row by row and insert data into Database and so right now I am hitting database for each line of data present in csv file so currently database hit count is 100K which is not good from performance point of view. Current Code: public function initiateInserts() { //Open Large CSV File(min 100K rows) for parsing. $this->fin = fopen($file,'r') or die('Cannot open file'); //Parsing Large CSV file to get data and initiate insertion into schema. while (($data=fgetcsv($this->fin,5000,";"))!==FALSE) { $query = "INSERT INTO dt_table (id, code, connectid, connectcode) VALUES (:id, :code, :connectid, :connectcode)"; $stmt = $this->prepare($query); // Then, for each line : bind the parameters $stmt->bindValue(':id', $data[0], PDO::PARAM_INT); $stmt->bindValue(':code', $data[1], PDO::PARAM_INT); $stmt->bindValue(':connectid', $data[2], PDO::PARAM_INT); $stmt->bindValue(':connectcode', $data[3], PDO::PARAM_INT); // Execute the statement $stmt->execute(); $this->checkForErrors($stmt); } } I am looking for a way wherein instead of hitting Database for every row of data, I can prepare the query and than hit it once and populate Database with the inserts. Any Suggestions !!! Note: This is the exact sample code that I am using but CSV file has more no. of field and not only id, code, connectid and connectcode but I wanted to make sure that I am able to explain the logic and so have used this sample code here. Thanks !!!

    Read the article

  • twitter streaming api instead of search api

    - by user1711576
    I am using twitters search API to view all the tweets that use a particular hashtag I want to view. However, I want to use the stream function, so, I only get recent ones, and so, I can then store them. <?php global $total, $hashtag; $hashtag = $_POST['hash']; $total = 0; function getTweets($hash_tag, $page) { global $total, $hashtag; $url = 'http://search.twitter.com/search.json?q='.urlencode($hash_tag).'&'; $url .= 'page='.$page; $ch = curl_init($url); curl_setopt ($ch, CURLOPT_RETURNTRANSFER, TRUE); $json = curl_exec ($ch); curl_close ($ch); echo "<pre>"; $json_decode = json_decode($json); print_r($json_decode->results); $json_decode = json_decode($json); $total += count($json_decode->results); if($json_decode->next_page){ $temp = explode("&",$json_decode->next_page); $p = explode("=",$temp[0]); getTweets($hashtag,$p[1]); } } getTweets($hashtag,1); echo $total; ?> The above code is what I have been using to search for the tweets I want. What do I need to do to change it so I can stream the tweets instead? I know I would have to use the stream url https://api.twitter.com/1.1/search/tweets.json , but what do I need to change after that is where I don't know what to do. Obviously, I know I'll need to write the database sql but I want to just capture the stream first and view it. How would I do this? Is the code I have been using not any good for just capturing the stream?

    Read the article

< Previous Page | 277 278 279 280 281 282 283 284 285 286 287 288  | Next Page >