Search Results

Search found 44747 results on 1790 pages for 'breadth first'.

Page 290/1790 | < Previous Page | 286 287 288 289 290 291 292 293 294 295 296 297  | Next Page >

  • Why doesn't list.get(0).equals(null) work?

    - by Jessy
    The first index is set to null (empty), but it doesn't print the right output, why? //set the first index as null and the rest as "High" String a []= {null,"High","High","High","High","High"}; //add array to arraylist ArrayList<Object> choice = new ArrayList<Object>(Arrays.asList(a)); for(int i=0; i<choice.size(); i++){ if(i==0){ if(choice.get(0).equals(null)) System.out.println("I am empty"); //it doesn't print this output } }

    Read the article

  • How do I link (dependency) properties in my ViewModel?

    - by mos
    Simplified example: I have an object that models a user. Users have a first name and a last name. The UserViewModel has a dependency property for my Models.User object. In the declaration of the UserView's xaml, I want to bind a couple of TextBlocks to the first and last name properties. What is the correct way to do this? Should I have readonly DependencyProperties for the name fields, and when the dependency property User is set, update them? Can the name fields be regular C# properties instead? Or, should I bind like this: <TextBlock Text="{Binding User.FirstName}" />

    Read the article

  • Portrait vs Landscape Launch Images

    - by andrewx
    An iPad app can support inclusion of launch images in both orientations; presumably, if your app supports auto-rotation, then this would suggest to me that if the user launches an app while the device is in Landscape mode, then the Landscape launch image is used. But in all the apps I've built and released, this has never been the case. Never once has the Landscape launch image appeared, only the Portrait. After loading, the app will auto-rotate to whatever orientation the device is in, but at launch, it assumes you are in Portrait. Always. Why? I have seen many other apps in the store that behave this way, but then there are some seem to always automatically know immediately at first launch, from that first launch image, that you are in Landscape, if that's the case. How is this done?

    Read the article

  • Mercurial: Recommended way of sending a whole repository to someone

    - by Svish
    I have done some programming and I have used Mercurial for source control. I now need to send all of my code to someone else (because they are going to take over). Since all copies of a mercurial repository is a full and real repository my first thought is to first do a clone of my repository without an update and then zipping and emailing that clone. Is this a good way, or is there a better way? For example when using the TortoiseHg Repository Explorer I can right-click on a changeset and under Export there are various options that looks like they could be doing something interesting, but I don't quite understand them or know which one to use.

    Read the article

  • Delegate Example From C# In Depth Confusion

    - by ChloeRadshaw
    I am looking at this example: List<Product> products = Product. GetSampleProducts() ; products.Sort( (first, second) => first.Name.CompareTo(second. Name) ) ; foreach (Product product in products) { Console. WriteLine(product) ; } What function is actually called in the API when you do that? Does the compiler create a class which implemnents the IComparer interface? I thought delegates were anonymous methods - Here it seems to be an anonymous interface implementation which is casuing confusion

    Read the article

  • Perform tasks with delay, without delaying web response (ASP.NET)

    - by Tomas Lycken
    I'm working on a feature that needs to send two text messages with a 30 second delay, and it is crucial that both text messages are sent. Currently, this feature is built with ajax requests, that are sent with a 30 second javascript delay, but since this requires the user to have his browser open and left on the same page for at least 30 seconds, it is not a method I like. Instead, I have tried to solve this with threading. This is what I've done: Public Shared Sub Larma() Dim thread As New System.Threading.Thread(AddressOf Larma_Thread) thread.Start() End Sub Private Shared Sub Larma_Thread() StartaLarm() Thread.Sleep(1000 * 30) StoppaLarm() End Sub A web handler calls Larma(), and StartaLarm() and StoppaLarm() are the methods that send the first and second text messages respectively. However, I only get the first text message delivered - the second is never sent. Am I doing something wrong here? I have no deep understanding of how threading works in ASP.NET, so please let me know how to accomplish this.

    Read the article

  • How does linq decide between inner & outer joins

    - by user287795
    Hi Usually linq is using an left outer join for its queries but on some cases it decides to use inner join instead. I have a situation where that decision results in wrong results since the second table doesn't always have suitable records and that removes the records from the first table. I'm using a linqdatasource over a dbml where the relevant tables are identical but one holds historical records removed from the first. both have the same primary key. and I'm using a dataloadoption to load both tables at once with out round trips. Would you explain why linq decided to use an inner join here? Thanks

    Read the article

  • Calculating color shades

    - by matejv
    I have the next problem. I have a base color with couple of different shades of that color. Example: Base color: #4085c5 Shade: #005cb1 Now, I have a different color (let's say #d60620), but no shades of it. From the color I would like to calculate shades, that have similar difference as colors mentioned in first paragraph. First I tried calculating difference of RGB elements and applying them to second color, but the result was not like I expected to be. Than I tried with converting color to HSV, reading saturation value and applying the difference to second color, but again the resulting color was still weird. The formula was something like: (HSV(BaseColor)[S] - HSV(Shade)[S]) + HSV(SecondColor)[H] Does anyone know how this problem could be solved? I know I am doing something wrong, but I don't know what. :)

    Read the article

  • C# Same DataSource + Multiple DataGridViews = Data Binding Issues?

    - by C. Griffin
    Here's what I'm doing: I have (2) DataGridView controls DGV #1 is bound to the DataSet, DGV #2 is bound to a DataView of the SAME DataSet Now, what I'm needing to accomplish here is this: When a user checks a boolean column on the original DGV, the second DGV should now display the newly checked row also. The context is that the first DGV is a master list, and the second one is a "favorite" view of the first. When I check the rows, the favorite column does NOT update. Do I need to use a DataAdapter to actually update the database, or can I operate directly on the DataSet (DataTable) -- or even with the Rows in the original DataGridView?

    Read the article

  • How to hang up (disconnect, terminate,..) incomings call???

    - by Cesar Valiente
    "How do you hang up incoming calls (in Android of course)?" First, I know this question has been asked and answered several times, and the response is always "you can't". But if we look in the market we get a few applications (all private software, no access to the source code... :-( ) that do this action, such as CallFilter, Panda firewall and others... So... does somebody know how these apps do the hang up action, (or terminate, or disconnect or whatever you call it..)? And other question, if the first don't get a response.. does somebody know how send an incoming call to the voice mail? Of course, all questions are about how to do it programmatically. So with the voicemail question I know there's a flag in contacts that is used for that, but like I said, I'd like to know the programmatical way. Thanks all!

    Read the article

  • Shared memory of same DLL in different 32 bit processes is sometimes different in a terminal session

    - by KBrusing
    We have an 32 bit application consisting of some processes. They communicate with shared memory of a DLL used by every process. Shared memory is build with global variables in C++ by "#pragma data_seg ("Shared")". When running this application sometime during starting a new process in addition to an existing (first) process we observe that the shared memory of both processes is not the same. All new started processes cannot communicate with the first process. After stopping all of our processes and restarting the application (with some processes) everything works fine. But sometime or other after successfully starting and finishing new processes the problem occurs again. Running on all other Windows versions or terminal sessions on Windows server 2003 our application never got this problem. Is there any new "feature" on Windows server 2008 that might disturb the hamony of our application?

    Read the article

  • JDBC Pagination

    - by Zeeshan
    Hi, I want to implement pagination using JDBC. The actual thing I want to know is "How can i get first 50 and then next 50 records from database for page 1 and 2 respectively" My Query is Select * from data [data table contains 20,000 rows] For page #1 I get 50 records and for page #2 I want to get next 50 records. How can I implement it efficiently in JDBC? I have searched and found that rs.absolute(row) is the way to skip first page records but it takes some amount of time on large result sets and I don't want to bear this amount of time. Also, I don't want to use rownum and limit + offset in query because these are not good to use in query, I dont know why, still I don't want to use it in query. Can anyone help me how to get limited ResultSet for pagination or is there any way JDBC is giving us?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • SSIS - user variable used in derived column transform is not available - in some cases

    - by soo
    Unfortunately I don't have a repro for my issue, but I thought I would try to describe it in case it sounds familiar to someone... I am using SSIS 2005, SP2. My package has a package-scope user variable - let's call it user_var first step in the control flow is an Execute SQL task which runs a stored procedure. All that SP does is insert a record in a SQL table (with an identity column) and then go back and get the max ID value. The Execute SQL task saves this output into user_var the control flow then has a Data Flow Task - it goes and gets some source data, has a derived column which sets a column called run_id to user_var - and saves the data to a SQL destination In most cases (this template is used for many packages, running every day) this all works great. All of the destination records created get set with a correct run_id. However, in some cases, there is a set of the destination data that does not get run_id equal to user_var, but instead gets a value of 0 (0 is the default value for user_var). I have 2 instances where this has happened, but I can't make it happen. In both cases, it was just less that 10,000 records that have run_id = 0. Since SSIS writes data out in 10,000 record blocks, this really makes me think that, for the first set of data written out, user_var was not yet set. Then, after that first block, for the rest of the data, run_id is set to a correct value. But control passed on to my data flow from the Execute SQL task - it would have seemed reasonable to me that it wouldn't go on until the SP has completed and user_var is set. Maybe it just runs the SP, but doesn't wait for it to complete? In both cases where this has happened there seemed to be a few packages hitting the table to get a new user_var at about the same time. And in both cases lots of data was written (40 million rows, 60 million rows) - my thinking is that that means the writes were happening for a while. Sorry to be both long-winded AND vague. A winning combination! Does this sound familiar to anyone? Thanks.

    Read the article

  • Can I have different name and id attributes on a form element?

    - by ewitkows
    Hi all, I have a web form with usual elements (first name, last name, etc). The Postback URL is a different website altogether as the form is intented to post lead information to another website. The site that accepts the lead is expecting First Name to come over as "FName", and Last Name to come over as "LName". Is there any way I can set the ID of a textbox to "txtFName", but submit it over the wire as "FName"? I tried changing the name attribute, but at runtime it sets the name = id.

    Read the article

  • Strange Locking Behaviour in SQL Server 2005

    - by SQL Learner
    Can anyone please tell me why does the following statement inside a given stored procedure returns repeated results even with locks on the rows used by the first SELECT statement? BEGIN TRANSACTION DECLARE @Temp TABLE ( ID INT ) INSERT INTO @Temp SELECT ID FROM SomeTable WITH (ROWLOCK, UPDLOCK, READPAST) WHERE SomeValue <= 10 INSERT INTO @Temp SELECT ID FROM SomeTable WITH (ROWLOCK, UPDLOCK, READPAST) WHERE SomeValue >= 5 SELECT * FROM @Temp COMMIT TRANSACTION Any values in SomeTable for which SomeValue is between 5 and 10 will be returned twice, even though they were locked in the first SELECT. I thought that locks were in place for the whole transaction, and so I wasn't expecting the query to return repeated results. Why is this happening?

    Read the article

  • Finding Most Recent Order for a Particular Item

    - by visitor
    I'm trying to write a SQL Query for DB2 Version 8 which retrieves the most recent order of a specific part for a list of users. The query receives a parameter which contains a list of customerId numbers and the partId number. For example, Order Table OrderID PartID CustomerID OrderTime I initially wanted to try: Select * from Order where OrderId = ( Select orderId from Order where partId = #requestedPartId# and customerId = #customerId# Order by orderTime desc fetch first 1 rows only ); The problem with the above query is that it only works for a single user and my query needs to include multiple users. Does anyone have a suggestion about how I could expand the above query to work for multiple users? If I remove my "fetch first 1 rows only," then it will return all rows instead of the most recent. I also tried using Max(OrderTime), but I couldn't find a way to return the OrderId from the sub-select. Thanks! Note: DB2 Version 8 does not support the SQL "TOP" function.

    Read the article

  • null pointer exception in textview of setcontent

    - by kitokid
    I am getting the java.lang.NullPointerException on createTabContent for the following code. There are two tabspecs. When I called and set the tab , changed the tabs for the first time it is ok. But when i called again while I am on the second tab, its hit the null pointer exception for line : NoStudentText.setVisibility(View.VISIBLE); I will show No Student Text if there is no data for the student list. It shows the text for the first time call. But If I do second time call to that tab, got the error. tspecStudent.setContent(new TabContentFactory() { public View createTabContent(String arg0) { if(listStudent != null && listStudent .size() > 0) { //show the student list } else { TextView noStudentText = (TextView)findViewById(R.id.NoStudentText); noStudentText.setVisibility(View.VISIBLE); return noStudentText; } } });

    Read the article

  • How does the #! work?

    - by mocybin
    In a script you must include a #! on the first line followed by the path to the program that will execute the script (e.g.: sh, perl). As far as I know though, the # character denotes the start of a comment and that line is supposed to be ignored by the program executing the script. It would seem though, that this first line is at some point read by something in order for the script to be executed by the proper program. Could somebody please shed more light on the workings of the #! ? Edit: I'm really curious about this, so the more in-depth the answer the better.

    Read the article

  • Shall I optimize or let compiler to do that?

    - by Knowing me knowing you
    What is the preferred method of writing loops according to efficiency: Way a) /*here I'm hoping that compiler will optimize this code and won't be calling size every time it iterates through this loop*/ for (unsigned i = firstString.size(); i < anotherString.size(), ++i) { //do something } or maybe should I do it this way: Way b) unsigned first = firstString.size(); unsigned second = anotherString.size(); and now I can write: for (unsigned i = first; i < second, ++i) { //do something } the second way seems to me like worse option for two reasons: scope polluting and verbosity but it has the advantage of being sure that size() will be invoked once for each object. Looking forward to your answers.

    Read the article

  • Linux File Permissions & Access Control Query

    - by Jason
    Hi, Lets say I am user: bob & group: users. There is this file: -rw----r-- 1 root users 4 May 8 22:34 testfile First question, why can't bob read the file as it's readable by others? Is it simply that if you are denied by group, then you are auto-blacklisted for others? I always assumed that the final 3 bits too precedence over user/group permission bits, guess I was wrong... Second question, how is this implemented? I suppose it's linked to the first query, but how does this work in relation to Access Control, is it related to how ACLs work / are queried? Just trying to understand how these 9 permission bits are actually implemented/used in Linux. Thanks alot.

    Read the article

  • What scripts should not be ported from bash to python?

    - by Jack
    I decided to rewrite all our Bash scripts in Python (there are not so many of them) as my first Python project. The reason for it is that although being quite fluent in Bash I feel it's somewhat archaic language and since our system is in the first stages of its developments I think switching to Python now will be the right thing to do. Are there scripts that should always be written in Bash? For example, we have an init.d daemon script - is it OK to use Python for it? We run CentOS. Thanks.

    Read the article

  • How to deal with delegate method calling back the object who send the message ?

    - by olipion
    I have two object: @protocol ObjectADelegate - (void)objectAfirst:(ObjectA *)obj; - (void)objectAsecond:(ObjectA *)obj; @end @interface ObjectA : NSObject { id<ObjectADelegate> delegate; - (void)callSecond { [self.delegate objectAsecond:self]; } @end @interface ObjectB : NSObject <ObjectADelegate>{ ObjectA *myObjectA; } @implementation ObjectB - (void)objectAfirst:(ObjectA *)obj { // First is finished, do second [obj callSecond]; } - (void)objectASecond:(ObjectA *)obj { // Do my stuff } @end As you can see in the code, when ObjectA send the message objectAfirst to its delegate, objectb use again objectA methods that result in objecta calling back objectb. It means that what first fire objectAfirst is not finished but objectA send the objectAsecond message. Could it be a problem ? Any way to let delay message handling in objectB ? for example, something like using [obj performSelector:@selector(callSecond) afterDelay:0.01]; instead of [obj callSecond]; ?

    Read the article

  • Using the same cookie in two logins

    - by cer9ss
    Hi everyone, I need your help I've a MVC project that uses Jquery, where I've implemented a mechanism of "Remember Me" using cookies to save, clear and retrieve the login and password. I also have two screens where the user does the login. I want that both logins manipulate the same cookie. I've got to implement it, but I've realized that each one has a different behaviour. I mean, the cookie's value I save in the first login is not the same than the value that retrieves the second login (when I open it). In other words, if I mark "remind me" on the first login, it isn't reflected on the second login and viceversa. What can I do to make that both of them manipulate and read the same values from the same cookie? Is it possible? PS: For this situations I'm using the same web navigator: Firefox or IE. Thanks in advance

    Read the article

< Previous Page | 286 287 288 289 290 291 292 293 294 295 296 297  | Next Page >