Search Results

Search found 12857 results on 515 pages for 'spatial index'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 293/515 | < Previous Page | 289 290 291 292 293 294 295 296 297 298 299 300  | Next Page >

  • error with redirect using listener JSF 2.0

    - by Ray
    I have a index.xhtml page <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml" xmlns:h="http://java.sun.com/jsf/html" xmlns:f="http://java.sun.com/jsf/core" xmlns:ui="http://java.sun.com/jsf/facelets"> <f:view> <ui:insert name="metadata" /> <f:event type="preRenderView" listener="#{item.show}" /> <h:body></h:body> </f:view> </html> And in bean class with scope session this method public void show() throws IOException, DAOException { ExternalContext externalContext = FacesContext.getCurrentInstance() .getExternalContext(); //smth String rootPath = externalContext.getRealPath("/"); String realPath = rootPath + "pages\\template\\body\\list.xhtml"; externalContext.redirect(realPath); } i think that I should redirect to next page but I have "browser can't show page" and list.xhtml (if I do this page as welcome-page I haven't error, it means that error connected with redirect) <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml" xmlns:h="http://java.sun.com/jsf/html" xmlns:f="http://java.sun.com/jsf/core" xmlns:ui="http://java.sun.com/jsf/facelets"> <h:body> <ui:composition template="/pages/layouts/mainLayout.xhtml"> <ui:define name="content"> <h:form></h:form></ui:define></ui:composition> </h:body> </html> in consol i didn't have any error. in web.xml <welcome-file-list> <welcome-file>index.xhtml</welcome-file> </welcome-file-list> <servlet> <servlet-name>Faces Servlet</servlet-name> <servlet-class>javax.faces.webapp.FacesServlet</servlet-class> <load-on-startup>1</load-on-startup> </servlet> <servlet-mapping> <servlet-name>Faces Servlet</servlet-name> <url-pattern>*.xhtml</url-pattern> </servlet-mapping> What can be the reason this problem?

    Read the article

  • c# eventhandling error

    - by bragin.www
    i have method private void getValues(object sender, EventArgs e) { int id = int.Parse(dgvTable.Rows[dgvTable.CurrentRow.Index].Cells[0].Value.ToString()); var values = from c in v.db.TotalDoc where c.TotalID == id select c.TotalAmount; dgvValues.DataSource = values; } and datagridview "dgvTable" error at this line dgvTable.CellClick += new EventHadler(getValues); error text is: No overload for 'getValues' matches delegate 'System.EventHandler' please help!

    Read the article

  • Android Soft Keyboard value using array

    - by Shubh
    Hi friends, Yet I use Soft Keyboard sample from http://developer.android.com/resources/samples/SoftKeyboard/index.html Here we uses ASCII value from XML ,now at the place of XML I want to generate these value using array. How can I do this Thanks in Advance

    Read the article

  • Wordpress: How to be redirected to the page when inserting it's page ID into numeric form input with

    - by Daniel
    I would like to know if there's exists some simple code to get to the page i know its ID , I would like to create small input (no matter where in templates)from where the people can easily get to the page if they know it's page ID (4numeric ID is better to remember - permalink name you can mistake . I have the girls portfolio in wordpress - portfolio=pages x jobs in clubs offers=posts , I would like the girls portfolios to be easily findable by ID(s) , if possible the same for the posts=jobs in clubs The best solution little 4-5numeric input and send=go button in sidebar.php - index.php etc

    Read the article

  • can't use appcfg.py update gae

    - by user353998
    hello, recently i want to upload GAppProxy to GAE. but when i use the appcfg.py to update the files,there comes an error,it was: urllib2.URLError: urlopen error [Errno 8] _ssl.c:480: EOF occurred in violation of protocol i don't know why PS:i live in china,and may be because of the GFW. and when i use the type :appengine.google.com and then input the password,i can't redict to the index page,there is an error too,which says:ssl error

    Read the article

  • Avoiding 'Buffer Overrun' C6386 warning

    - by bdhar
    In my code, I am using an array xyz of 10 objects. When I am trying to access an element of the array using an unsigned int index like this: xyz[level], I get 'Buffer overrun' warning. Logically, I am pretty sure that level won't exceed 10. How to avoid this warning?

    Read the article

  • Invalid syntax in this simple Python application.

    - by Sergio Boombastic
    Getting an invalid syntax when creating the template_value variable: class MainPage(webapp.RequestHandler): def get(self): blogPosts_query = BlogPost.all().order('-postDate') blogPosts = blogPosts_query.fetch(10) if users.get_current_user(): url = users.create_logout_url(self.request.uri) url_linktext = 'Logout' else: url = url = users.create_login_url(self.request.uri) url_linktext = 'Login' template_value = ( 'blogPosts': blogPosts, 'url': url, 'url_linktext': url_linktext, ) path = os.path.join(os.path.dirname(__file__), 'index.html') self.response.out.write(template.render(path, template_values)) The error fires specifically on the 'blogPosts': blogPosts line. What am I doing wrong? Thanks!

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Mysql select - improve performances

    - by realshadow
    Hey, I am working on an e-shop which sells products only via loans. I display 10 products per page in any category, each product has 3 different price tags - 3 different loan types. Everything went pretty well during testing time, query execution time was perfect, but today when transfered the changes to the production server, the site "collapsed" in about 2 minutes. The query that is used to select loan types sometimes hangs for ~10 seconds and it happens frequently and thus it cant keep up and its hella slow. The table that is used to store the data has approximately 2 milion records and each select looks like this: SELECT * FROM products_loans WHERE KOD IN("X17/Q30-10", "X17/12", "X17/5-24") AND 369.27 BETWEEN CENA_OD AND CENA_DO; 3 loan types and the price that needs to be in range between CENA_OD and CENA_DO, thus 3 rows are returned. But since I need to display 10 products per page, I need to run it trough a modified select using OR, since I didnt find any other solution to this. I have asked about it here, but got no answer. As mentioned in the referencing post, this has to be done separately since there is no column that could be used in a join (except of course price and code, but that ended very, very badly). Here is the show create table, kod and CENA_OD/CENA_DO very indexed via INDEX. CREATE TABLE `products_loans` ( `KOEF_ID` bigint(20) NOT NULL, `KOD` varchar(30) NOT NULL, `AKONTACIA` int(11) NOT NULL, `POCET_SPLATOK` int(11) NOT NULL, `koeficient` decimal(10,2) NOT NULL default '0.00', `CENA_OD` decimal(10,2) default NULL, `CENA_DO` decimal(10,2) default NULL, `PREDAJNA_CENA` decimal(10,2) default NULL, `AKONTACIA_SUMA` decimal(10,2) default NULL, `TYP_VYHODY` varchar(4) default NULL, `stage` smallint(6) NOT NULL default '1', PRIMARY KEY (`KOEF_ID`), KEY `CENA_OD` (`CENA_OD`), KEY `CENA_DO` (`CENA_DO`), KEY `KOD` (`KOD`), KEY `stage` (`stage`) ) ENGINE=InnoDB DEFAULT CHARSET=utf8 And also selecting all loan types and later filtering them trough php doesnt work good, since each type has over 50k records and the select takes too much time as well... Any ides about improving the speed are appreciated. Edit: Here is the explain +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | id | select_type | table | type | possible_keys | key | key_len | ref | rows | Extra | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | 1 | SIMPLE | products_loans | range | CENA_OD,CENA_DO,KOD | KOD | 92 | NULL | 190158 | Using where | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ I have tried the combined index and it improved the performance on the test server from 0.44 sec to 0.06 sec, I cant access the production server from home though, so I will have to try it tomorrow.

    Read the article

  • Unable to Redirecting to a subdomain after logIn from another subdomain in MVC4

    - by Nash
    Expect behaviour :: User has to login from aut.mycompany.local and after login he must be redirected to my.mycompany.local. Redirecting Code after validating the user credentials return RedirectToAction("Index", @"plportal/account", new { subdomain = "my" }); Actual Subdomain URL http://my.mycompany.local/plportal/account But I'm getting belwo error: System.DirectoryServices.DirectoryServicesCOMException: There is no such object on the server. PLease help me and thanks in advance

    Read the article

  • TCP sequence number question

    - by Meta
    This is more of a theoretical question than an actual problem I have. If I understand correctly, the sequence number in the TCP header of a packet is the index of the first byte in the packet in the whole stream, correct? If that is the case, since the sequence number is an unsigned 32-bit integer, then what happens after more than FFFFFFFF = 4294967295 bytes are transferred? Will the sequence number wrap around, or will the sender send a SYN packet to restart at 0?

    Read the article

  • Php function available on other php page

    - by Vafello
    I have a function that I use on index.php page and I would like to call it from other php page (other.php). How to make this function available without redeclaration? I think it's achievable using sessions, but I am not sure how to do it exactly.

    Read the article

  • Live search results as you type... am I going about this the right way? jQuery + PHP

    - by dallen
    This is my first time building a tool like this, so please bare with me. I'm doing this to learn more about jQuery and AJAX. Basically, I have a search input and a hidden div. When you start typing in the search input, the hidden div becomes visible and results are brought in. In this case, I'm searching for client names. It all works fine, however I think my code could be better but I'm not sure exactly where to begin. Each keyup requests a PHP script which accesses a table in a database to find a like string. But in my PHP script, I'm echo'ing some JS/jQuery which I'm not sure is good practice. Below is my code. Am I going about this the right way or am I totally off base? Any suggestions for improvement? Javascript $("#search").keyup(function() { $("#search_results").show("fast"); $.ajax ({ type: "POST", url: "http://localhost:8888/index.php/welcome/search/" + $("#search").val(), success: function(html) { $("#search_results").html(html); } }); }); PHP function search($search_string = false) { if ($search_string) { $this->db->like('name', $search_string); $query = $this->db->get('clients'); if ($query->num_rows() == 0) { echo "No client exists."; } else { foreach ($query->result() as $row) { echo '<script>'; echo ' $("#client_results_'.$row->id.'").hide(); $("#'.$row->id.'").toggle(function() { $.ajax ({ type: "POST", url: "http://localhost:8888/index.php/welcome/search_client_ads/" + '.$row->id.', success: function(html) { $("#client_results_'.$row->id.'").html(html).show("fast"); } }); }, function() { $("#client_results_'.$row->id.'").hide("fast").html(""); });'; echo '</script>'; echo '<p><span id="'.$row->id.'">'.$row->name.'</span></p>'; echo '<div id="client_results_'.$row->id.'"></div>'; } } } else { echo ''; } } function search_client_ads($client_id) { $query = $this->db->get_where('online_ads', array('client' => $client_id)); if ($query->num_rows() == 0) { echo "No ads exist."; } else { foreach ($query->result() as $row) { echo $row->id; } } }

    Read the article

  • Restricting Edit and Delete in Ruby on Rails

    - by phleet
    I want to be able to edit and delete resources myself, but not allow users of the application to do so. Is there an easy way of doing this in Rails? An incomplete solution would be just to remove the "delete" and "edit" buttons from the index view, but that doesn't disable their ability to do so via direct HTTP requests. Running Rails 2.2.2 and ruby 1.8.7

    Read the article

  • define mysql indexing

    - by Bharanikumar
    Hi Am not sure, This is the right place to post this question , But in our stack overflow only am getting clear vision solutions , What is indexing and what is fulltext , for the above both questions i know the ans, but i cant expose that ans in the exact way to the interviewer , (indexing means somthing like index in book) (fulltext means for search string), Can please give me very simple defination for this questions , Advance thanks

    Read the article

  • Rails: Easiest way to provide file downloads?

    - by Schroedinger
    G'day guys, currently have almost finished writing a rails application that allows a CSV download of the database. This is generated when the index is first viewed. Is there an easy way to insert a link to a helper that returns a CSV document? That is to say is it easy to insert links to helpers? This would make a lot of problems I've been having much easier

    Read the article

  • Deploy .net MVC 2 appication on IIS6

    - by munish
    I want to deploy my .net MVC 2 appication on IIS6.0. Will it require to change route path in global.asax file. In my application i have used html link, ajax request and Html.ActionLink. The code lines in the Global.asax file are: routes.MapRoute( "LogOn", "{controller}/{action}/{id}", new { controller = "Account", action = "Index", id = UrlParameter.Optional } ); Please suggest me. Thanks and Regards Munish

    Read the article

  • Position of object in database

    - by fl00r
    Hi! I have got model Team and I've got (i.e.) team = Team.first :offset => 20. Now I need to get number of position of my team in db table. I can do it in ruby: Team.all.index team #=> 20 But I am sure that I can write it on SQL and it will be less expensive for me with big tables.

    Read the article

  • google maps marker draggable doesn't work

    - by ArmenGrigoryan
    I try all methods but in my google map on the marker doesn't work events, I try enable events and write (clickable: true), but it did not help, in test server working good, but on phpfox marker not clickable, help me please correct it go to it http://iguansystems.com/phpfoxdev/index.php?do=/pages/24/quickstart/step2/ link login - [email protected], and pass- tryuser in center frontend right at "Primary Venue" have "Can't find venue? Add New" click on "Add New" and window with a map open

    Read the article

  • Pretty automatically updating lighttpd server status

    - by Marko
    I am trying to use your modified lighttpd server-status. server-status mod is enabled and running, I am geting lighttpd status but I can not use yours becouse I can not use port 80 again ($SERVER["socket"] == "192.168......:80" { status.status-url = "/server-status" server.document-root = "/var/www/status" mimetype.assign = ( ".html" = "text/html" ) index-file.names = ( "pretty-status.html" ) } this gives me an error on lighty restart saying port (= already in use. Any help?

    Read the article

  • How can we extract substring of the string by position and sepretor.

    - by Harikrishna
    How can we divide the substring from the string Like I have string String mainString="///Trade Time///Trade Number///Amount Rs.///"; Now I have other string String subString="Amount" Then I want to extract the substring Amount Rs. with the help of second string named subString not by any other method But it should be extracted through two parameters like first is I have index no of Amount string and second is until the next string ///.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 289 290 291 292 293 294 295 296 297 298 299 300  | Next Page >