Search Results

Search found 44910 results on 1797 pages for 'breadth first traversal'.

Page 297/1797 | < Previous Page | 293 294 295 296 297 298 299 300 301 302 303 304  | Next Page >

  • Find the period of over speed ?

    - by Vimvq1987
    Just something interesting come in my mind. Assume that we have a table (in SQL Server) like this: Location Velocity Time What is the best way to determine over speed periods (speed barrier is defined) ? My first idea was loading the table into an array, and then iterate over array to find these periods: (Pseudo C# code) bool isOverSpeed = false; for (int i =0;i<arr.Length;i++) { if (!isOverSpeed) if (arr[i].Velocity > speedBarrier) { #insert the first record into another array. isOverSpeed = true; } if(isOverSpeed) if (arr[i].Velocity < speedBarrier) { #insert the record into that array isOverSpeed = false; } } It works, but somewhat "not very effectively". Is there a "smarter" way, such as a T-SQL query or another algorithm to do this?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • How does linq decide between inner & outer joins

    - by user287795
    Hi Usually linq is using an left outer join for its queries but on some cases it decides to use inner join instead. I have a situation where that decision results in wrong results since the second table doesn't always have suitable records and that removes the records from the first table. I'm using a linqdatasource over a dbml where the relevant tables are identical but one holds historical records removed from the first. both have the same primary key. and I'm using a dataloadoption to load both tables at once with out round trips. Would you explain why linq decided to use an inner join here? Thanks

    Read the article

  • Passing data from one viewcontroller to another

    - by user1392515
    I subclassed two view controllers. The first one is supposed to pass data, a NSUrl object to the second one. .m of the first one: NSURL *temp = [NSURL URLWithString:@"http://example.com"]; UIViewController *presentationsFullScreen_ViewController = [self.storyboard instantiateViewControllerWithIdentifier:@"PresentationsFullScreen_ViewController"]; presentationsFullScreen_ViewController.urlToUse = temp; .h of the second one: #import <UIKit/UIKit.h> @interface PresentationsFullScreen_ViewController : UIViewController { NSURL *urlToUse; } @property (nonatomic,retain) NSURL *urlToUse; It is obviously not working and not compiling,telling me essentially that I didn't subclass it and that the property urlToUse is not found on UIViewController. How do I subclass correctly? Thanks!

    Read the article

  • How do I link (dependency) properties in my ViewModel?

    - by mos
    Simplified example: I have an object that models a user. Users have a first name and a last name. The UserViewModel has a dependency property for my Models.User object. In the declaration of the UserView's xaml, I want to bind a couple of TextBlocks to the first and last name properties. What is the correct way to do this? Should I have readonly DependencyProperties for the name fields, and when the dependency property User is set, update them? Can the name fields be regular C# properties instead? Or, should I bind like this: <TextBlock Text="{Binding User.FirstName}" />

    Read the article

  • How to convert string to integer?

    - by user1260584
    So I'm having a hard time with my situation and need some advice. I'm trying to convert my two Strings that I have into integers, so that I can use them in math equations. Here is what I tried, however it brings me an error in the app. ' equals.setOnClickListener(new View.OnClickListener() { public void onClick(View arg0) { // TODO Auto-generated method stub num1 = edit.getText().toString(); num2 = edit.getText().toString(); int first = Integer.parseInt(num1); int second = Integer.parseInt(num2); edit.setText(first + second); } }); Is there something that I am doing wrong? Thank you for any help. EDIT: Yes this is Java. num1 and num2 are strings that I have previously named. What do you mean by trim?

    Read the article

  • it's not possible to loop .click function (To create multipple buttons)

    - by user1542680
    Im Trying to create multiple buttons that each one of them doing something else. It working great outside of the "each" loop, But in the moment I'm inserting the .click function in the .each function it doesn't work... Here is the Code: $.each(data.arr, function(i, s){ html += '<div id="mybtn'+s.id+'"><button class="first">Btn1</button><button class="second">Btn2</button></div>'; var btnclass="#mybtn"+s.id+" .first"; $(btnclass).click(function(){ //do something }); }); Please Let me know what is wrong... Thank you very much!!! Eran.

    Read the article

  • How to hang up (disconnect, terminate,..) incomings call???

    - by Cesar Valiente
    "How do you hang up incoming calls (in Android of course)?" First, I know this question has been asked and answered several times, and the response is always "you can't". But if we look in the market we get a few applications (all private software, no access to the source code... :-( ) that do this action, such as CallFilter, Panda firewall and others... So... does somebody know how these apps do the hang up action, (or terminate, or disconnect or whatever you call it..)? And other question, if the first don't get a response.. does somebody know how send an incoming call to the voice mail? Of course, all questions are about how to do it programmatically. So with the voicemail question I know there's a flag in contacts that is used for that, but like I said, I'd like to know the programmatical way. Thanks all!

    Read the article

  • Why is it when I set "closeOnEscape" to false and then "closeOnEscape" to true jquery dialog escape

    - by chobo2
    Hi I am using jquery ui 1.8 and I have a model dialog that popups up and if a user clicks on a checkbox another one comes up. This requires them to say "yes" or "no" so I removed the "X" on the dialog and put closeOnEscape to false. However I noticed when I did that the model dialog underneath it would close when they hit escape. So now when the one that pops up when the checkbox is checked I disable closeOnEscape on the first dialog box. When they close it I enable again yet it does not work. I am not sure why $("#Dialog").dialog( "option", "closeOnEscape", true); I even do this in firebug. I just open my first dialog up Do this in firebugs console $("#Dialog").dialog( "option", "closeOnEscape", false); Then verify that escape is now disabled. I then try to enable it again $("#Dialog").dialog( "option", "closeOnEscape", true); Yet it never enables.

    Read the article

  • Delegate Example From C# In Depth Confusion

    - by ChloeRadshaw
    I am looking at this example: List<Product> products = Product. GetSampleProducts() ; products.Sort( (first, second) => first.Name.CompareTo(second. Name) ) ; foreach (Product product in products) { Console. WriteLine(product) ; } What function is actually called in the API when you do that? Does the compiler create a class which implemnents the IComparer interface? I thought delegates were anonymous methods - Here it seems to be an anonymous interface implementation which is casuing confusion

    Read the article

  • css of pagination links

    - by fusion
    i'd like a basic idea of how to go about formatting the following paging of the search result. this is the paging code: //Create and print the Navigation bar $nav=""; $next = $page+1; $prev = $page-1; if($page > 1) { $nav .= "<div class=\"search_mainpg\"><div class=\"searchpage\" style=\"width:5%;\"><a onclick=\"showPage('','$prev'); return false;\" href=\"$self?page=" . $prev . "&q=" .urlencode($search_result) . "\">< Prev</a></div>"; $first = "<div class=\"searchpage\" style=\"width:2%;\"><a onclick=\"showPage('','1'); return false;\" href=\"$self?page=1&q=" .urlencode($search_result) . "\"> << </a></div>" ; } else { $nav .= "&nbsp;"; $first = "&nbsp;"; } for($i = 1 ; $i <= $numpages ; $i++) { if($i == $page) { $nav .= "<b>$i</b>"; }else{ $nav .= "<div class=\"searchpage\" style=\"width:2%;\"><a onclick=\"showPage('',$i); return false;\" href=\"$self?page=" . $i . "&q=" .urlencode($search_result) . "\">$i</a></div>"; } } if($page < $numpages) { $nav .= "<div class=\"searchpage\" style=\"width:5%;\"><a onclick=\"showPage('','$next'); return false;\" href=\"$self?page=" . $next . "&q=" .urlencode($search_result) . "\">Next ></a></div>"; $last = "<div class=\"searchpage\" style=\"width:2%;\"><a onclick=\"showPage('','$numpages'); return false;\" href=\"$self?page=$numpages&q=" .urlencode($search_result) . "\"> >> </a></div></div>"; } else { $nav .= "&nbsp;"; $last = "&nbsp;"; } echo $first . $nav . $last; currently, it displays like this:

    Read the article

  • Why doesn't list.get(0).equals(null) work?

    - by Jessy
    The first index is set to null (empty), but it doesn't print the right output, why? //set the first index as null and the rest as "High" String a []= {null,"High","High","High","High","High"}; //add array to arraylist ArrayList<Object> choice = new ArrayList<Object>(Arrays.asList(a)); for(int i=0; i<choice.size(); i++){ if(i==0){ if(choice.get(0).equals(null)) System.out.println("I am empty"); //it doesn't print this output } }

    Read the article

  • Qt hide QLayout (switch between two layouts)

    - by Lodhart
    I didn't find solution for my problem with two QLayouts. I need app with QHBoxLayout with possible expandind when I will add new widgets, push buttons, .... So what I have: One QDialog and two layouts. Now I know that I can't hide the layout. So I tray just : layout()->removeItem(firstlayout); layout()->addLayout(secondLayout); But when I did this, I saw all items in first layout on possition [0,0]. So next step I try: for (all items in first layout) if (widget) widget->hide(); But this is working only with QWidget and I have many different items in layouts. Simply way is use the widget, because there is possibole to use hide/show, but I need auto expanding window when I add new items.

    Read the article

  • SSIS - user variable used in derived column transform is not available - in some cases

    - by soo
    Unfortunately I don't have a repro for my issue, but I thought I would try to describe it in case it sounds familiar to someone... I am using SSIS 2005, SP2. My package has a package-scope user variable - let's call it user_var first step in the control flow is an Execute SQL task which runs a stored procedure. All that SP does is insert a record in a SQL table (with an identity column) and then go back and get the max ID value. The Execute SQL task saves this output into user_var the control flow then has a Data Flow Task - it goes and gets some source data, has a derived column which sets a column called run_id to user_var - and saves the data to a SQL destination In most cases (this template is used for many packages, running every day) this all works great. All of the destination records created get set with a correct run_id. However, in some cases, there is a set of the destination data that does not get run_id equal to user_var, but instead gets a value of 0 (0 is the default value for user_var). I have 2 instances where this has happened, but I can't make it happen. In both cases, it was just less that 10,000 records that have run_id = 0. Since SSIS writes data out in 10,000 record blocks, this really makes me think that, for the first set of data written out, user_var was not yet set. Then, after that first block, for the rest of the data, run_id is set to a correct value. But control passed on to my data flow from the Execute SQL task - it would have seemed reasonable to me that it wouldn't go on until the SP has completed and user_var is set. Maybe it just runs the SP, but doesn't wait for it to complete? In both cases where this has happened there seemed to be a few packages hitting the table to get a new user_var at about the same time. And in both cases lots of data was written (40 million rows, 60 million rows) - my thinking is that that means the writes were happening for a while. Sorry to be both long-winded AND vague. A winning combination! Does this sound familiar to anyone? Thanks.

    Read the article

  • Is using a DataSet's column Expression works in background same as manual calculation?

    - by Harikrishna
    I have one datatable which is not bindided and records are coming from the file by parsing it in the datatable dynamically every time. Now there is three columns in the datatable Marks1,Marks2 and FinalMarks. And their types is decimal. Now for making addition of columns Marks1 and Marks2 's records and store it into FinalMarks column,For that what I do is : datatableResult.Columns["FinalMarks"].Expression="Marks1+Marks2"; It's works properly. It can be done in other way also is foreach (DataRow r in datatableResult.Rows) { r["FinalMarks"]=Convert.ToDecimal(r["Marks1"])+Convert.ToDecimal(r["Marks2"]); } Is first approach same as second approach in background means is both approach same or what? EDIT: I want to know that first approach works in background as second approach.

    Read the article

  • ontouch - Switching positions of two views(images) in Android

    - by idish
    I've been looking for that 2 days long and haven't found anything related to it. I'll give an example for my goal. Let's say I have 2 images positioned side by side horizontally. I want the user to be able to switch their positions onlongtouch listener. so let's say that the first image was on the left and the second was on the right side, after switching positions between them, the first image would be in the right and the second would be on the left side. Basically, it is just like in the launcher where you can switch apps positions. Please, if anything is not clear for you, I would like to know, and I'll try to explain it better, thank you.

    Read the article

  • null pointer exception in textview of setcontent

    - by kitokid
    I am getting the java.lang.NullPointerException on createTabContent for the following code. There are two tabspecs. When I called and set the tab , changed the tabs for the first time it is ok. But when i called again while I am on the second tab, its hit the null pointer exception for line : NoStudentText.setVisibility(View.VISIBLE); I will show No Student Text if there is no data for the student list. It shows the text for the first time call. But If I do second time call to that tab, got the error. tspecStudent.setContent(new TabContentFactory() { public View createTabContent(String arg0) { if(listStudent != null && listStudent .size() > 0) { //show the student list } else { TextView noStudentText = (TextView)findViewById(R.id.NoStudentText); noStudentText.setVisibility(View.VISIBLE); return noStudentText; } } });

    Read the article

  • How to move to another view without using a button

    - by Will
    My first view displays an image and action indicator while web-servers and database function are run in that background. I want the application to go to my tab view when the functions have been completed. How do I do this? Here is what the views look like. What I have tried: TabBarViewController *tab = [[TabBarViewController alloc]init]; [self presentViewController:tab animated:NO completion:nil]; and [self performSegueWithIdentifier:@"first" sender:self]; Please can you help my to understand how to do this. I have spent many hours googling this problem and couldn't work out how to do it. Thanks EDIT: Added Code

    Read the article

  • HandsOnTable - using date functions with methods

    - by briansol
    I have a function used on the datepicker to limit dates selected to the first of the month... I invoke it by setting a class and listener, such as: $( ".datepickfom" ).datepicker( { beforeShowDay: fom, showOn: "both", buttonImage: "/images/calendar.png", buttonImageOnly: true, changeMonth: true, changeYear: true, dateFormat: "m/d/yy", yearRange: "-25:+100", constrainInput: true } ); the fom call: function fom(date){ if (date.getDate() != 1) { return [false, "", "Specify 1st of Month"]; } return [true, ""]; } This works great for regular forms. I'm looking to extend this functionality to the HandsOnTable 'date' cell data types. var $container_1 = $("#datatable_1"); var handsontable_1 = $container_1.data('handsontable'); $("#datatable_1").handsontable( { columns: [ {}, {}, { type: 'date', dateFormat: 'm/d/yy' }, {}, { type: 'dropdown', source: ["","Y","N"] }, {}, {} ] }); This also works as it should, but the date lets me pick other dates besides the first. Is there a way to attach the beforeShowDay option to the HOT cell call as well?

    Read the article

  • Perform tasks with delay, without delaying web response (ASP.NET)

    - by Tomas Lycken
    I'm working on a feature that needs to send two text messages with a 30 second delay, and it is crucial that both text messages are sent. Currently, this feature is built with ajax requests, that are sent with a 30 second javascript delay, but since this requires the user to have his browser open and left on the same page for at least 30 seconds, it is not a method I like. Instead, I have tried to solve this with threading. This is what I've done: Public Shared Sub Larma() Dim thread As New System.Threading.Thread(AddressOf Larma_Thread) thread.Start() End Sub Private Shared Sub Larma_Thread() StartaLarm() Thread.Sleep(1000 * 30) StoppaLarm() End Sub A web handler calls Larma(), and StartaLarm() and StoppaLarm() are the methods that send the first and second text messages respectively. However, I only get the first text message delivered - the second is never sent. Am I doing something wrong here? I have no deep understanding of how threading works in ASP.NET, so please let me know how to accomplish this.

    Read the article

  • How to extract certain columns from a big Notepad text file?

    - by user560464
    I have a big text file and the data in it are in 5 columns, but I need just the first and the last column of that. It will take many days and probably with mistake if I want to enter the data of this two column one-by-one from here to another file. Is there a fast way to do this? For example: 1 1.0000000000000000 0.0000000000 S {0} 2 1.5000000000000000 0.3010299957 C {2} 3 1.7500000000000000 0.6020599913 S {0,2} 4 2.0000000000000000 0.7781512504 C {3} 5 2.3333333333333333 1.0791812460 C {3,2} 6 2.5000000000000000 1.3802112417 S {3,0,2} 7 2.5277777777777778 1.5563025008 S {0,3} 8 2.5833333333333333 1.6812412374 S {3,0,0,2} 9 2.8000000000000000 1.7781512504 C {5,2} 10 3.0000000000000000 2.0791812460 C {5,0,2} I need the first column (numbering) and the last inside { }.

    Read the article

  • Mootools accordion inside another...

    - by jimbo
    Hi all, This is a funny one... I have created a mootools accordion with tabs, each section appears when clicked. This works fine. Now within the first accordion that shows, I have another accordion that displays more data. This was to keep the area small with the mass of information that is needed on the page. All works fine, the problem come when the information hidden is larger than the area that is worked our for the first tabs accordion, and it wont display. does any-one either understand what i'm trying to say, or have an idea of a fix or workaround? Hope this makes sense!

    Read the article

  • AudioOutputUnitStart takes time

    - by tokentoken
    Hello, I'm making an iPhone game application using Core Audio, Extended Audio File Services. It works OK, but when I first call AudioOutputUnitStart, it takes about 1-2 seconds. After the second call, no problem. For a game application, 1-2 seconds is very noticeable. (I tested this on iPhone simulator, and iPhone 3GS) Also, if I leave the game for about 10 seconds, first call of AudioOutputUnitStart also takes time. Maybe I have to call AudioOutputUnitStart beginning of the application to prevent the start-up time?

    Read the article

< Previous Page | 293 294 295 296 297 298 299 300 301 302 303 304  | Next Page >