Search Results

Search found 8700 results on 348 pages for 'startup programs'.

Page 301/348 | < Previous Page | 297 298 299 300 301 302 303 304 305 306 307 308  | Next Page >

  • Need advice on OOP philosophy

    - by David Jenings
    I'm trying to get the wheels turning on a large project in C#. My previous experience is in Delphi, where by default every form was created at applicaton startup and form references where held in (gasp) global variables. So I'm trying to adapt my thinking to a 100% object oriented environment, and my head is spinning just a little. My app will have a large collection of classes Most of these classes will only really need one instance. So I was thinking: static classes. I'm not really sure why, but much of what I've read here says that if my class is going to hold a state, which I take to mean any property values at all, I should use a singleton structure instead. Okay. But there are people out there who for reasons that escape me, think that singletons are evil too. None of these classes is in danger of being used anywhere except in this program. So they could certainly work fine as regular objects (vs singletons or static classes) Then there's the issue of interaction between objects. I'm tempted to create a Global class full of public static properties referencing the single instances of many of these classes. I've also considered just making them properties (static or instance, not sure which) of the MainForm. Then I'd have each of my classes be aware of the MainForm as Owner. Then the various objects could refer to each other as Owner.Object1, Owner.Object2, etc. I fear I'm running out of electronic ink, or at least taxing the patience of anyone kind enough to have stuck with me this long. I hope I have clearly explained my state of utter confusion. I'm just looking for some advice on best practices in my situation. All input is welcome and appreciated. Thanks in advance, David Jennings

    Read the article

  • Boost.MultiIndex: Are there way to share object between two processes?

    - by Arman
    Hello, I have a Boost.MultiIndex big array about 10Gb. In order to reduce the reading I thought there should be a way to keep the data in the memory and another client programs will be able to read and analyse it. What is the proper way to organize it? The array looks like: struct particleID { int ID;// real ID for particle from Gadget2 file "ID" block unsigned int IDf;// postition in the file particleID(int id,const unsigned int idf):ID(id),IDf(idf){} bool operator<(const particleID& p)const { return ID<p.ID;} unsigned int getByGID()const {return (ID&0x0FFF);}; }; struct ID{}; struct IDf{}; struct IDg{}; typedef multi_index_container< particleID, indexed_by< ordered_unique< tag<IDf>, BOOST_MULTI_INDEX_MEMBER(particleID,unsigned int,IDf)>, ordered_non_unique< tag<ID>,BOOST_MULTI_INDEX_MEMBER(particleID,int,ID)>, ordered_non_unique< tag<IDg>,BOOST_MULTI_INDEX_CONST_MEM_FUN(particleID,unsigned int,getByGID)> > > particlesID_set; Any ideas are welcome. kind regards Arman.

    Read the article

  • Subview Doesnt AutoSize When Added to Root View Controller

    - by Per
    Hello, I have a root view controller that will have up to 10 or so subviews. I am implementing autorotation/autosize accross the entire app. My problem is this: - When I allocate all the view controllers and add each as a subview to the root controller during startup, everything works as it should. The only problem is that each view controller needs time to initialize. This causes my application to load very slowly. Instead I am trying to allocate the view controllers as they are required. Now I find that if the application goes into Landscape, and I allocate a view controller that is designed in portrait, it will autorotate but the autosize doesnt happen. In other words as soon as the subview is added to the root controller in portrait mode it rotates and sizes correctly (and stays that way). If the subview is added when the root controller is in landscape it rotates but doesnt autosize (and view sizes remain messed up rotating back to portrait) I have tried to force an autosize by calling SetNeedsLayout, SetNeedsDisplay, and LayoutIfNeeded but nothing works. I know i could probably do this manually by determining the root controllers orientation and resizing the subviews appropriately, but this is a lot of work for something that should work automatically. Am I missing something? Any help would be appreciated. My project is an iPad port from an iPhone app, the iPhone app doesnt rotate so Im not sure if this may be something wrong with the 3.2 beta.

    Read the article

  • VB.NET - Object reference not set to an instance of an object

    - by Daniel
    I need some help with my program. I get this error when I run my VB.NET program with a custom DayView control. ***** Exception Text ******* System.NullReferenceException: Object reference not set to an instance of an object. at SeaCow.Main.DayView1_ResolveAppointments(Object sender, ResolveAppointmentsEventArgs args) in C:\Users\Daniel\My Programs\Visual Basic\SeaCow\SeaCow\SeaCow\Main.vb:line 120 at Calendar.DayView.OnResolveAppointments(ResolveAppointmentsEventArgs args) at Calendar.DayView.OnPaint(PaintEventArgs e) at System.Windows.Forms.Control.PaintWithErrorHandling(PaintEventArgs e, Int16 layer) at System.Windows.Forms.Control.WmPaint(Message& m) at System.Windows.Forms.Control.WndProc(Message& m) at System.Windows.Forms.NativeWindow.Callback(IntPtr hWnd, Int32 msg, IntPtr wparam, IntPtr lparam) According to the error code, the 'for each' loop below is causing the NullReferenceException error. At default, the 'appointments' list is assigned to nothing and I can't find where the ResolveAppointments function is being called at. Private Sub DayView1_ResolveAppointments(ByVal sender As Object, ByVal args As Calendar.ResolveAppointmentsEventArgs) Handles DayView1.ResolveAppointments Dim m_Apps As New List(Of Calendar.Appointment) For Each m_App As Calendar.Appointment In appointments If (m_App.StartDate >= args.StartDate) AndAlso (m_App.StartDate <= args.EndDate) Then m_Apps.Add(m_App) End If Next args.Appointments = m_Apps End Sub Anyone have any suggestions?

    Read the article

  • Does anyone else get worn out using Scrum, finishing sprint after sprint?

    - by Simucal
    I'm with a pretty small startup and we started using a form of a Scrum/Agile development cycle. In many ways I enjoy Scrum. We have relatively short sprints (2 weeks) and I like the Burndown Chart to track the teams progress. I also like the Feature Board so I always know what I should be doing next. It feels good taking down a feature's card from the board, completing it and then putting it in the burn down pile. However, we are now entering in our 18th Sprint release cycle and I'm starting to feel a little burnt out. It isn't that I don't like job or my co-workers, it is just that these sprints are... well, sprints. From start to finish I literally feel like I'm racing against the clock to maintain our development velocity. When we are done with the sprint we spend one day planning the next sprints feature set and estimates and then off we go again. For people who work in a mature Agile/Scrum development process, is this normal? Or are we missing something? Is there normally time in a Scrum enviornment that is unassigned/untracked to get done some minor things and to clear your head?

    Read the article

  • Create a VPN with Python

    - by user213060
    I want to make a device "tunnel box" that you plug an input ethernet line, and an output ethernet line, and all the traffic that goes through it gets modified in a special way. This is similar to how a firewall, IDS, VPN, or similar boxes are connected inline in a network. I think you can just assume that I am writing a custom VPN in Python for the purpose of this question: LAN computer <--\ LAN computer <---> [LAN switch] <--> ["tunnel box"] <--> [internet modem] <--> LAN computer <--/ My question is, what is a good way to program this "tunnel box" from python? My application needs to see TCP flows at the network layer, not as individual ethernet frames. Non-TCP/IP traffic such as ICPM and other types should just be passed through. Example Twisted-like Code for my "tunnel box" tunnel appliance: from my_code import special_data_conversion_function class StreamInterceptor(twisted.Protocol): def dataReceived(self,data): data=special_data_conversion_function(data) self.outbound_connection.send(data) My initial guesses: TUN/TAP with twisted.pair.tuntap.py - Problem: This seems to only work at the ethernet frame level, not like my example? Socks proxy - Problem: Not transparent as in my diagram. Programs have to be specifically setup for it. Thanks!

    Read the article

  • Publishing my Website to my Local Disk Causes Exceptions to show Paths including my Local Disk

    - by coffeeaddict
    I've published my website many times. But didn't think about this though until I came across this issue. So I decided to publish my WAP project to a local folder on my C drive first. Then used FTP to upload it to my shared host on discountasp.net. I noticed during runtime that the stack trace was referencing that local folder still and erroring out. Anyone know what config settings are affected when publishing? Obviously something is still pointing to my local C drive and I've searched my entire solution and don't see why. Here's the runtime error I get when my code tries to run in discountasp.net's web server Cannot write into the public directory - check permissions Description: An unhandled exception occurred during the execution of the current web request. Please review the stack trace for more information about the error and where it originated in the code. Exception Details: ScrewTurn.Wiki.PluginFramework.InvalidConfigurationException: Cannot write into the public directory - check permissions Source Error: An unhandled exception was generated during the execution of the current web request. Information regarding the origin and location of the exception can be identified using the exception stack trace below. Stack Trace: [InvalidConfigurationException: Cannot write into the public directory - check permissions] ScrewTurn.Wiki.SettingsStorageProvider.Init(IHostV30 host, String config) in C:\www\Wiki\Screwturn3_0_2_509\Core\SettingsStorageProvider.cs:90 ScrewTurn.Wiki.StartupTools.Startup() in C:\www\Wiki\Screwturn3_0_2_509\Core\StartupTools.cs:69 ScrewTurn.Wiki.Global.Application_BeginRequest(Object sender, EventArgs e) in C:\www\Wiki\Screwturn3_0_2_509\WebApplication\Global.asax.cs:29 System.Web.SyncEventExecutionStep.System.Web.HttpApplication.IExecutionStep.Execute() +68 System.Web.HttpApplication.ExecuteStep(IExecutionStep step, Boolean& completedSynchronously) +75 Discountasp says it's not a permission issue but obviously it is. I think /Wiki should work...but it's not. Here's my site viewed in FTP on discountasp.net's server:

    Read the article

  • How to launch multiple Internet Explorer windows/tabs from batch file?

    - by TheZenker
    I would like a batch file to launch two separate programs then have the command line window close. Actually, to clarify, I am launching Internet Explorer with two different URLs. So far I have something like this: start "~\iexplore.exe" "url1" start "~\iexplore.exe" "url2" What I get is one instance of Internet Explorer with only the second URL loaded. Seems the second is replacing the second. I seem to remember a syntax where I would load a new command line window and pass the command to execute on load, but can't find the reference. As a second part of the question: what is a good reference URL to keep for the times you need to write a quick batch file? Edit: I have marked an answer, because it does work. I now have two windows open, one for each URL. (thanks!) The funny thing is that without the /d approach using my original syntax I get different results based on whether I have a pre-existing Internet Explorer instance open. If I do I get two new tabs added for my two URLs (sweet!) If not I get only one final tab for the second URL I passed in.

    Read the article

  • Creative ways to punish (or just curb) laziness in coworkers

    - by FerretallicA
    Like the subject suggests, what are some creative ways to curb laziness in co-workers? By laziness I'm talking about things like using variable names like "inttheemplrcd" instead of "intEmployerCode" or not keeping their projects synced with SVN, not just people who use the last of the sugar in the coffee room and don't refill the jar. So far the two most effective things I've done both involve the core library my company uses. Since most of our programs are in VB.net the lack of case sensitivity is abused a lot. I've got certain features of the library using Reflection to access data in the client apps, which has a negligible performance hit and introduces case sensitivity in a lot places where it is used. In instances where we have an agreed standard which is compromised by blatant laziness I take it a step further, like the DatabaseController class which will blatantly reject any DataTable passed to it which isn't named dtSomething (ie- must begin with dt and third letter must be capitalised). It's frustrating to have to resort to things like this but it has also gradually helped drill more attention to detail into their heads. Another is adding some code to the library's initialisation function to display a big and potentially embarrassing (only if seen by a client) message advising that the program is running in debug mode. We have had many instances where projects are sent to clients built in debug mode which has a lot of implications for us (especially with regard to error recovery) and doing that has made sure they always build to release before distributing. Any other creative (ie- not StyleCop etc) approaches like this?

    Read the article

  • What is the relationship between Turing Machine & Modern Computer ? [closed]

    - by smwikipedia
    I heard a lot that modern computers are based on Turing machine. I just cannot build a bridge between a conceptual Turing Machine and a modern computer. Could someone help me build this bridge? Below is my current understanding. I think the computer is a big general-purpose Turing machine. Each program we write is a small specific-purpose Turing machine. The classical Turing machine do its job based on the input and its current state inside and so do our programs. Let's take a running program (a process) as an example. We know that in the process's address space, there's areas for stack, heap, and code. A classical Turing machine doesn't have the ability to remember many things, so we borrow the concept of stack from the push-down automaton. The heap and stack areas contains the state of our specific-purpose Turing machine (our program). The code area represents the logic of this small Turing machine. And various I/O devices supply input to this Turing machine.

    Read the article

  • Running multiple instances of tomcat in eclipse WTP

    - by lisak
    Hey, SCENARIO: 10 CATALINA_BASEs with own configuration (always the same port numbers 8080, but 10 different IP/hostnames on one host via virtual IPs). created a server in WTP and pick "Use the custom location" option in the server configuration in eclipse. New configuration files are created in workspace/Server/server-name-config/ Set up the server path and deploy path for my catalina base (not the internal .metadata one) After I started it, the new configuration files overwrote the original catalina-base/conf files I had there - I was glad, it should be like this but after I made changes in the eclipse config files workspace/Server/server-name-config/ and restarted the server, the changes didn't appeared in the original files in CATALINA_BASE/conf What the hell is that ? So I set the CATALINA_BASE/conf/server.xml to fault configuration and restarted tomcat from eclipse and it worked ! it took the configuration from /Server/server-name-config/server.xml Then I deleted CATALINA_BASE/conf/server.xml and it said that there is no server.xml in catalina base ! How is it possible ? I don't understand why eclipse WTP developers made so tight integration. There should by just symbolic links in /Server/server-name-config/ pointing to CATALINA_BASE/conf/ ... now there is a weird system which is totally unpredictable. The changes in /Server/server-name-config/ are not reflected in CATALINA_BASE/conf ... from where the standard bootstrap.jar or other catalina classloaders and classes build server, engine and other objects with particular setting. Moreover the CATALINA_BASEs could be used outside eclipse then. The second problem, I'm setting up various things in CATALINA_BASE/bin/startup.sh and setenv.sh which is easy cause I can use bash for it. Is then modifying VM parameters in the "Open launch configuration" settings the only way how to do it in eclipse ? Sorry for such a huge pile of questions, but I'm annoyed by the fact that it is much better to not use eclipse WTP for this because it is very poorly designed and it's a shame because this would spare me a lot of time. And using the internal .metadata/ instances it's even more terrifying way that the one I described.

    Read the article

  • call/cc in Lua - Possible?

    - by Pessimist
    The Wikipedia article on Continuation says: "In any language which supports closures, it is possible to write programs in continuation passing style and manually implement call/cc." Either that is true and I need to know how to do it or it is not true and that statement needs to be corrected. If this is true, please show me how to implement call/cc in Lua because I can't see how. I think I'd be able to implement call/cc manually if Lua had the coroutine.clone function as explained here. If closures are not enough to implement call/cc then what else is needed? The text below is optional reading. P.S.: Lua has one-shot continuations with its coroutine table. A coroutine.clone function would allow me to clone it to call it multiple times, thus effectively making call/cc possible (unless I misunderstand call/cc). However that cloning function doesn't exist in Lua. Someone on the Lua IRC channel suggested that I use the Pluto library (it implements serialization) to marshal a coroutine, copy it and then unmarshal it and use it again. While that would probably work, I am more interested in the theoretical implementation of call/cc and in finding what is the actual minimum set of features that a language needs to have in order to allow for its manual implementation.

    Read the article

  • Problem with copying local data onto HDFS on a Hadoop cluster using Amazon EC2/ S3.

    - by Deepak Konidena
    Hi, I have setup a Hadoop cluster containing 5 nodes on Amazon EC2. Now, when i login into the Master node and submit the following command bin/hadoop jar <program>.jar <arg1> <arg2> <path/to/input/file/on/S3> It throws the following errors (not at the same time.) The first error is thrown when i don't replace the slashes with '%2F' and the second is thrown when i replace them with '%2F': 1) Java.lang.IllegalArgumentException: Invalid hostname in URI S3://<ID>:<SECRETKEY>@<BUCKET>/<path-to-inputfile> 2) org.apache.hadoop.fs.S3.S3Exception: org.jets3t.service.S3ServiceException: S3 PUT failed for '/' XML Error Message: The request signature we calculated does not match the signature you provided. check your key and signing method. Note: 1)when i submitted jps to see what tasks were running on the Master, it just showed 1116 NameNode 1699 Jps 1180 JobTracker leaving DataNode and TaskTracker. 2)My Secret key contains two '/' (forward slashes). And i replace them with '%2F' in the S3 URI. PS: The program runs fine on EC2 when run on a single node. Its only when i launch a cluster, i run into issues related to copying data to/from S3 from/to HDFS. And, what does distcp do? Do i need to distribute the data even after i copy the data from S3 to HDFS?(I thought, HDFS took care of that internally) IF you could direct me to a link that explains running Map/reduce programs on a hadoop cluster using Amazon EC2/S3. That would be great. Regards, Deepak.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • What programming languages do the top tier Universities teach?

    - by Simucal
    I'm constantly being inundated with articles and people talking about how most of today's Universities are nothing more than Java vocational schools churning out mediocre programmer after mediocre programmer. Our very own Joel Spolsky has his famous article, "The Perils of Java Schools." Similarly, Alan Kay, a famous Computer Scientist (and SO member) has said this in the past: "I fear — as far as I can tell — that most undergraduate degrees in computer science these days are basically Java vocational training." - Alan Kay (link) If the languages being taught by the schools are considered such a contributing factor to the quality of the school's program then I'm curious what languages do the "top-tier" computer science schools teach (MIT, Carnegie Mellon, Stanford, etc)? If the average school is performing so poorly due in large part the languages (or lack of) that they teach then what languages do the supposed "good" cs programs teach that differentiate them? If you can, provide the name of the school you attended, followed by a list of the languages they use throughout their coursework. Edit: Shog-9 asks why I don't get this information directly from the schools websites themselves. I would, but many schools websites don't discuss the languages they use in their class descriptions. Quite a few will say, "using high-level languages we will...", without elaborating on which languages they use. So, we should be able to get a pretty accurate list of languages taught at various well known institutions from the various SO members who have attended at them.

    Read the article

  • Is there any way to access files in your source tree in Android?

    - by Chris Thompson
    Hi all, This is a bit unorthodox but I'm trying to figure out if there's a way to access files stored in the src tree of my applications apk in Android. I'm trying to use i-Jetty (Jetty implementation for Android) and rather than use it as a separate application and manually download my war file, I'd rather just bake i-jetty in. However, in order to use (easily) standard html/jsp I need to be able to give it a document root, preferably within my application's apk file. I know Android specifically works to prevent you from accessing (freely) the stuff on the actual system so this may not be possible, but I'm thinking it might be possible to access something within the apk. One option to work around this would be to have all of the files stored in the res directory and then copy them to the sdcard on startup but this wouldn't allow me to automatically remove the files on uninstall. To give you an idea of what I've tried, currently, the html files are stored in org.webtext.android Context rootContext = new Context(server_, "/", Context.SESSIONS); rootContext.setResourceBase("org/webtext/webapp"); Returns a 404 error. final URL url = this.getClassLoader().getResource("org/webtext/webapp"); Context html = new WebAppContext(url.toExternalForm(), "/"); Blows up with a NullPointerException because no URL is returned from the getResource call. Any thoughts would be greatly appreciated! Thanks, Chris

    Read the article

  • when does factory girl create objects in db?

    - by Pavel K.
    i am trying to simulate a session using factory girl/shoulda (it worked with fixtures but i am having problems with using factories). i have following factories (user login and email both have 'unique' validations): Factory.define :user do |u| u.login 'quentin' u.email '[email protected]' end Factory.define :session_user, :class => Session do |u| u.association :user, :factory => :user u.session_id 'session_user' end and here's the test class MessagesControllerTest < ActionController::TestCase context "normal user" do setup do @request.session[:user_id]=Factory(:user).id @request.session[:session_id]=Factory(:session_user).session_id end should "be able to access new message creation" do get :new assert_response :success end end end but when i run "rake test:functionals", i get this test result 1) Error: test: normal user should be able to access new message creation. (MessagesControllerTest): ActiveRecord::RecordInvalid: Validation failed: Account name already exists!, Email already exists! which means that record already exists in db when i am referring to it in test setup. is there something i don't understand here? does factory girl create all factories in db on startup? rails 2.3.5/shoulda/factory girl

    Read the article

  • Free solution for automatic updates with a .NET/C# app?

    - by a2h
    Yes, from searching I can see this has been asked time and time again. Here's a backstory. I'm an individual hobbyist developer with zero budget. A program I've been developing has been in need of constant bugfixes, and me and users are getting tired of having to manually update. Me, because my current solution of Manually FTP to my website Update a file "newest.txt" with the newest version Update index.html with a link to the newest version Hope for people to see the "there's an update" message Have them manually download the update sucks, and whenever I screw up an update, I get pitchforks. Users, because, well, "Are you ever going to implement auto-update?" "Will there ever be an auto-update feature?" Over the past I have looked into: WinSparkle - No in-app updates, and the DLL is 500 KB. My current solution is a few KBs in the executable and has no in-app updates. http://windowsclient.net/articles/appupdater.aspx - I can't comprehend the documentation http://www.codeproject.com/KB/vb/Auto_Update_Revisited.aspx - Doesn't appear to support anything other than working with files that aren't in use wyUpdate - wyBuild isn't free, and the file specification is simply too complex. Maybe if I was under a company paying me I could spend the time, but then I may as well pay for wyBuild. http://www.kineticjump.com/update/default.aspx - Ditto the last sentence. ClickOnce - Workarounds for implementing launching on startup are massive, horrendous and not worth it for such a simple feature. Publishing is a pain; manual FTP and replace of all files is required for servers without FrontPage Extensions. I'm pretty much ready to throw in the towel right now and strangle myself. And then I think about Sparkle... EDIT: I came across SparkleDotNET just then. Looks good, though the DLL is 200 KB. Don't know if that's really that big of an issue, though.

    Read the article

  • Asymptotic complexity of a compiler

    - by Meinersbur
    What is the maximal acceptable asymptotic runtime of a general-purpose compiler? For clarification: The complexity of compilation process itself, not of the compiled program. Depending on the program size, for instance, the number of source code characters, statements, variables, procedures, basic blocks, intermediate language instructions, assembler instructions, or whatever. This is highly depending on your point of view, so this is a community wiki. See this from the view of someone who writes a compiler. Will the optimisation level -O4 ever be used for larger programs when one of its optimisations takes O(n^6)? Related questions: When is superoptimisation (exponential complexity or even incomputable) acceptable? What is acceptable for JITs? Does it have to be linear? What is the complexity of established compilers? GCC? VC? Intel? Java? C#? Turbo Pascal? LCC? LLVM? (Reference?) If you do not know what asymptotic complexity is: How long are you willing to wait until the compiler compiled your project? (scripting languages excluded)

    Read the article

  • Why do people have to use multiple versions of jQuery in the same page?

    - by reprogrammer
    I have noticed that sometimes people have to use multiple versions of jQuery in the same page (See question 1 and question 2). I assume people have to carry old versions of jQuery because some pieces of their code is based on an older version of jQuery. Obviously, this approach causes inefficiency. The ideal solution is to refactor the old code to use the newer jQuery API. I wonder if there are tools that automate the process of upgrading a piece of code to use a newer version of jQuery. I've never written programs in in either Javascript or jQuery. So, I'd like to hear from programmers experienced in these language about their opinion on this issue. In particular, I'd like to know the following. How much of problem it is to have to load multiple versions of jQuery? Have you ever had to load multiple versions of any other library in the same page? Do you know of any refactoring tools that helps you migrate your code to use the updated API? Do you think such a refactoring tool is useful? Are you willing to use it?

    Read the article

  • looking for a license key algorithm.

    - by giulio
    There are a lot of questions relating to license keys asked on stackoverflow. But they don't answer this question. Can anyone provide a simple license key algorithm that is technology independent and doesn't required a diploma in mathematics to understand ? The license key algorithm is similar to public key encryption. I just need something simple that can be implemented in any platform .Net/Java and uses simple data like characters. Preferably no byte translations required. So if a person presents a string, a complementary string can be generated that is the authorisation code. Below is a common scenario that it would be used for. Customer downloads s/w which generates a unique key upon initial startup/installation. S/w runs during trial period. At end of trial period an authorisation key is required. Customer goes to designated web-site, enters their code and get authorisation code to enable s/w, after paying :) Don't be afraid to describe your answer as though you're talking to a 5 yr old as I am not a mathemtician. Just need a decent basic algorithm, we're not launching nukes... NB: Please no philosophy on encryption nor who is Diffie-Hellman. I just need a basic solution.

    Read the article

  • How can I build something like Amazon S3 in Perl?

    - by Joel G
    I am looking to code a file storage application in perl similar to amazon s3. I already have a amazon s3 clone that I found online called parkplace but its in ruby and is old also isn't built for high loads. I am not really sure what modules and programs I should use so id like some help picking them out. My requirements are listed below (yes I know there are lots but I could start simple then add more once I get it going): Easy API implementation for client side apps. (maybe REST (?) Centralized database server for the USERDB (maybe PostgreSQL (?). Logging of all connections, bandwidth used, well pretty much everything to a centralized server (maybe PostgreSQL again (?). Easy server side configuration (config file(s) stored on the servers). Web based control panel for admin(s) and user(s) to show logs. (could work just running queries from the databases) Fast High Uptime Low memory usage Some sort of load distribution/load balancer (maybe a dns based or pound or perlbal or something else (?). Maybe a cache of some sort (memcached or parlbal or something else (?). Thanks in advance

    Read the article

  • Change NSTimer interval for repeating timer.

    - by user300713
    Hi, I am running a mainLoop in Cocoa using an NSTimer set up like this: mainLoopTimer = [NSTimer scheduledTimerWithTimeInterval:1.0/fps target:self selector:@selector(mainloop) userInfo:nil repeats:YES]; [[NSRunLoop currentRunLoop] addTimer:mainLoopTimer forMode:NSEventTrackingRunLoopMode]; At Program startup I set the timeInterval to 0.0 so that the mainloop runs as fast as possible. Anyways, I would like to provide a function to set the framerate(and thus the time interval of the timer) to a specific value at runtime. Unfortunately as far as I know that means that I have to reinitialize the timer since Cocoa does not provide a function like "setTimerInterval" This is what I tried: - (void)setFrameRate:(float)aFps { NSLog(@"setFrameRate"); [mainLoopTimer invalidate]; mainLoopTimer = nil; mainLoopTimer = [NSTimer scheduledTimerWithTimeInterval:1.0/aFps target:self selector:@selector(mainloop) userInfo:nil repeats:YES]; [[NSRunLoop currentRunLoop] addTimer:mainLoopTimer forMode:NSEventTrackingRunLoopMode]; } but this throws the following error and stops the mainloop: 2010-06-09 11:14:15.868 myTarget[7313:a0f] setFrameRate 2010-06-09 11:14:15.868 myTarget[7313:a0f] * __NSAutoreleaseNoPool(): Object 0x40cd80 of class __NSCFDate autoreleased with no pool in place - just leaking 2010-06-09 11:14:15.869 myTarget[7313:a0f] * __NSAutoreleaseNoPool(): Object 0x40e700 of class NSCFTimer autoreleased with no pool in place - just leaking 0.614628 I also tried to recreate the timer using the "retain" keyword, but that didn't change anything. Any ideas about how to dynamically change the interval of an NSTimer at runtime? Thanks!

    Read the article

  • Turning off hibernate logging console output

    - by Jared
    I'm using hibernate 3 and want to stop it from dumping all the startup messages to the console. I tried commenting out the stdout lines in log4j.properties but no luck. I've pasted my log file below. Also I'm using eclipse with the standard project structure and have a copy of log4j.properties in both the root of the project folder and the bin folder. ### direct log messages to stdout ### #log4j.appender.stdout=org.apache.log4j.ConsoleAppender #log4j.appender.stdout.Target=System.out #log4j.appender.stdout.layout=org.apache.log4j.PatternLayout #log4j.appender.stdout.layout.ConversionPattern=%d{ABSOLUTE} %5p %c{1}:%L - %m%n ### direct messages to file hibernate.log ### log4j.appender.file=org.apache.log4j.FileAppender log4j.appender.file.File=hibernate.log log4j.appender.file.layout=org.apache.log4j.PatternLayout log4j.appender.file.layout.ConversionPattern=%d{ABSOLUTE} %5p %c{1}:%L - %m%n ### set log levels - for more verbose logging change 'info' to 'debug' ### log4j.rootLogger=warn, stdout #log4j.logger.org.hibernate=info log4j.logger.org.hibernate=debug ### log HQL query parser activity #log4j.logger.org.hibernate.hql.ast.AST=debug ### log just the SQL #log4j.logger.org.hibernate.SQL=debug ### log JDBC bind parameters ### log4j.logger.org.hibernate.type=info #log4j.logger.org.hibernate.type=debug ### log schema export/update ### log4j.logger.org.hibernate.tool.hbm2ddl=debug ### log HQL parse trees #log4j.logger.org.hibernate.hql=debug ### log cache activity ### #log4j.logger.org.hibernate.cache=debug ### log transaction activity #log4j.logger.org.hibernate.transaction=debug ### log JDBC resource acquisition #log4j.logger.org.hibernate.jdbc=debug ### enable the following line if you want to track down connection ### ### leakages when using DriverManagerConnectionProvider ### #log4j.logger.org.hibernate.connection.DriverManagerConnectionProvider=trac5

    Read the article

  • What file format can represent an uncompressed raster image at 48 or 64 bits per pixel?

    - by finnw
    I am creating screenshots under Windows and using the LockBits function from GDI+ to extract the pixel data, which will then be written to a file. To maximise performance I am also: Using the same PixelFormat as the source bitmap, to avoid format conversion Using the ImageLockModeUserInputBuf flag to extract the pixel data into a pre-allocated buffer This pre-allocated buffer (pointed to by BitmapData::Scan0) is part of a memory-mapped file (to avoid copying the pixel data again.) I will also be writing the code that reads the file, so I can use (or invent) any format I wish. However I would prefer to use a well-known format that existing programs (ideally web browsers) are able to read, because that means I can visually confirm that the images are correct before writing the code for the other program (that reads the image.) I have implemented this successfully for the PixelFormat32bppRGB format, which matches the format of a 32bpp BMP file, so if I extract the pixel data directly into the memory-mapped BMP file and prefix it with a BMP header I get a valid BMP image file that can be opened in Paint and most browsers. Unfortunately one of the machines I am testing on returns pixels in PixelFormat64bppPARGB format (presumably this is influenced by the video adapter driver) and there is no corresponding BMP pixel format for this. Converting to a 16, 24 or 32bpp BMP format slows the program down considerably (as well as being lossy) so I am looking for a file format that can use this pixel format without conversion, so I can extract directly into the memory-mapped file as I have done with the 32bpp format. What raster image file formats support 48bpp and/or 64bpp?

    Read the article

< Previous Page | 297 298 299 300 301 302 303 304 305 306 307 308  | Next Page >