Search Results

Search found 18464 results on 739 pages for 'virtual functions'.

Page 307/739 | < Previous Page | 303 304 305 306 307 308 309 310 311 312 313 314  | Next Page >

  • Reading XML or objects from a Web service

    - by Shawn
    This is my first time working with webservices and I am a bit lost. I successfully called the functions, but I only can get one value from the service. I read that the easiest way is to read xml or create objects and then call their values. Currently I use functions that return the desired value but I need to call them 3 times to get all the data witch is a waste of time and resources. I tried to call the service with the URL and use it as a website or getting the service to work the same way without importing into the program. The thing is that i cant find a way to pass the values into the url, because of that i get only blank pages. What is the fastest way to get my data from the services? I need city name, temperature and a flag if the city is valid. I need to pass the zip code to the service. Thank you. My current code wetther.Weather wether = new wetther.Weather(); string farenhait = wether.GetCityWeatherByZIP(zip).Temperature; string city = wether.GetCityWeatherByZIP(zip).City; bool correct = wether.GetCityWeatherByZIP(zip).Success; I tried it that way // Retrieve XML document XmlTextReader reader = new XmlTextReader("http://xml.weather.yahoo.com/forecastrss?p=94704"); // Skip non-significant whitespace reader.WhitespaceHandling = WhitespaceHandling.Significant; // Read nodes one at a time while (reader.Read()) { // Print out info on node Console.WriteLine("{0}: {1}", reader.NodeType.ToString(), reader.Name); } This one works for the yahoo page but not for mine. I need to use this webservice - http://wsf.cdyne.com/WeatherWS/Weather.asmx

    Read the article

  • How to pass data to a C++0x lambda function that will run in a different thread?

    - by Dimitri C.
    In our company we've written a library function to call a function asynchronously in a separate thread. It works using a combination of inheritance and template magic. The client code looks as follows: DemoThread thread; std::string stringToPassByValue = "The string to pass by value"; AsyncCall(thread, &DemoThread::SomeFunction, stringToPassByValue); Since the introduction of lambda functions I'd like to use it in combination with lambda functions. I'd like to write the following client code: DemoThread thread; std::string stringToPassByValue = "The string to pass by value"; AsyncCall(thread, [=]() { const std::string someCopy = stringToPassByValue; }); Now, with the Visual C++ 2010 this code doesn't work. What happens is that the stringToPassByValue is not copied. Instead the "capture by value" feature passes the data by reference. The result is that if the function is executed after stringToPassByValue has gone out of scope, the application crashes as its destructor is called already. So I wonder: is it possible to pass data to a lambda function as a copy? Note: One possible solution would be to modify our framework to pass the data in the lambda parameter declaration list, as follows: DemoThread thread; std::string stringToPassByValue = "The string to pass by value"; AsyncCall(thread, [=](const std::string stringPassedByValue) { const std::string someCopy = stringPassedByValue; } , stringToPassByValue); However, this solution is so verbose that our original function pointer solution is both shorter and easier to read. Update: The full implementation of AsyncCall is too big to post here. In short, what happens is that the AsyncCall template function instantiates a template class holding the lambda function. This class is derived from a base class that contains a virtual Execute() function, and upon an AsyncCall() call, the function call class is put on a call queue. A different thread then executes the queued calls by calling the virtual Execute() function, which is polymorphically dispatched to the template class which then executes the lambda function.

    Read the article

  • Asp.net mvc inheritance controllers

    - by Ris90
    Hi, I'm studing asp.net mvc and in my test project I have some problems with inheritance: In my model I use inheritanse in few entities: public class Employee:Entity { /* few public properties */ } It is the base class. And descendants: public class RecruitmentOfficeEmployee: Employee { public virtual RecruitmentOffice AssignedOnRecruitmentOffice { get; set; } } public class ResearchInstituteEmployee: Employee { public virtual ResearchInstitute AssignedOnResearchInstitute { get; set; } } I want to implement a simple CRUD operations to every descedant. What is the better way to inplement controllers and views in descendants: - One controller per every descendant; - Controller inheritance; - Generic controller; - Generic methods in one controller. Or maybe there is an another way? My ORM is NHibernate, I have a generic base repository and every repository is its descedant. Using generic controller, I think, is the best way, but in it I will use only generic base repository and extensibility of the system will be not very good. Please, help the newbie)

    Read the article

  • python list/dict property best practice

    - by jterrace
    I have a class object that stores some properties that are lists of other objects. Each of the items in the list has an identifier that can be accessed with the id property. I'd like to be able to read and write from these lists but also be able to access a dictionary keyed by their identifier. Let me illustrate with an example: class Child(object): def __init__(self, id, name): self.id = id self.name = name class Teacher(object): def __init__(self, id, name): self.id = id self.name = name class Classroom(object): def __init__(self, children, teachers): self.children = children self.teachers = teachers classroom = Classroom([Child('389','pete')], [Teacher('829','bob')]) This is a silly example, but it illustrates what I'm trying to do. I'd like to be able to interact with the classroom object like this: #access like a list print classroom.children[0] #append like it's a list classroom.children.append(Child('2344','joe')) #delete from like it's a list classroom.children.pop(0) But I'd also like to be able to access it like it's a dictionary, and the dictionary should be automatically updated when I modify the list: #access like a dict print classroom.childrenById['389'] I realize I could just make it a dict, but I want to avoid code like this: classroom.childrendict[child.id] = child I also might have several of these properties, so I don't want to add functions like addChild, which feels very un-pythonic anyway. Is there a way to somehow subclass dict and/or list and provide all of these functions easily with my class's properties? I'd also like to avoid as much code as possible.

    Read the article

  • PHP's fopen is terminally failing

    - by Skittles
    Okay, I have GOT to be missing something totally rudimentary here. I have an extremely simple use of PHP's fopen function, but for some reason, it will not open the file no matter what I do. The odd part about this is that I use fopen in another function in the same script and it's working perfectly. I'm using the fclose in both functions. So, I know it's not a matter of a rogue file handle. I have confirmed the file's path and the existence of the target file also. I'm running the script at the command-line as root, so I know it's not apache that's the cause. And since I am running the script as root, I am fairly confident that permissions are not the issue. So, what on earth am I missing here? function get_file_list() { $file = '/home/site/tmp/return_files_list.txt'; $fp = fopen($file, 'r') or die("Could not open file: /home/site/tmp/return_files_list.txt for reading.\n"); $files_list = array(); while($line = fgets($fp)) { $files_list[] = $line; } fclose($fp); return $files_list; } function num_records_in_file($filename) { $fp = fopen( $filename, 'r' ); # or die("Could not open file: $filename\n"); $counter = 0; if ($fp) { while (!feof( $fp )) { $line = fgets( $fp ); $arr = explode( '|', $line ); if (( ( $arr[0] != 'HDR' && $arr[0] != 'TRL' ) && $arr[0] != '' )) { ++$counter; continue; } } } fclose( $fp ); return $counter; } As requested, here's both functions. The second function is passed an absolute path to the file. That is what I used to confirm that the file is there and that the path is correct.

    Read the article

  • How to structure this Symfony web project?

    - by James William
    I am new to Symfony and am not sure how to best structure my web project. The solution must accommodate 3 use cases: Public access to www.mydomain.com for general use Member only access to member.mydomain.com Administrator access to admin.mydomain.com All three virtual hosts point to the Symfony /web directory Questions: Is this 3 separate applications in my Symfony project (e.g. "frontend", "backend" and "admin" or "public", "member", "admin")? Is this a good approach if there is to be some duplicate code (e.g. generating a member list would be common across all 3 applications, but presented differently)? How would I route to the various applications based on the subdomain when a user accesses *.mydomain.com? Where in Symfony should this routing logic be placed? Or, is this one application with modules for each of the above use cases? EDIT: I do not have access to httpd.conf in apache to specify a default page for virtual hosts. I can only specify a directory for each subdomain using the hostin provider's cPanel.

    Read the article

  • Organising UI code in .NET forms

    - by sb3700
    Hi I'm someone who has taught myself programming, and haven't had any formal training in .NET programming. A while back, I started C# in order to develop a GUI program to control sensors, and the project has blossomed. I was just wondering how best to organise the code, particularly UI code, in my forms. My forms currently are a mess, or at least seem a mess to me. I have a constructor which initialises all the parameters and creates events. I have a giant State property, which updates the Enabled state of all my form control as users progress through the application (ie: disconnected, connected, setup, scanning) controlled by a States enum. I have 3-10 private variables accessed through properties, some of which have side-effects in changing the values of form elements. I have a lot of "UpdateXXX" functions to handle UI elements that depend on other UI elements - ie: if a sensor is changed, then change the baud rate drop down list. They are separated into regions I have a lot of events calling these Update functions I have a background worker which does all the scanning and analysis. My problem is this seems like a mess, particularly the State property, and is getting unmaintainable. Also, my application logic code and UI code are in the same file and to some degree, intermingled which seems wrong and means I need to do a lot of scrolling to find what I need. How do you structure your .net forms? Thanks

    Read the article

  • Different programming languages possibilities

    - by b-gen-jack-o-neill
    Hello. This should be very simple question. There are many programming languages out there, compiled into machine code or managed code. I first started with ASM back in high school. Assembler is very nice, since you know what exactly CPU does. Next, (as you can see from my other questions here) I decided to learn C and C++. I choosed C becouse from what I read it is the language with output most close to assembler-written programs. But, what I want to know is, can any other Windows programming language out there call win32 API? To be exact, like C has its special header and functions for win32 api interactions, is this assumed to be some important part of programming language? Or are there any languages that have no support for calling win32 API, or just use console to IO and some functions for basic file IO? Becouse, for Windows programming with graphic output, it is essential to have acess to win32 API. I know this question might seem silly, but still please, help me, I ask for study porposes. Thanks.

    Read the article

  • Inline function v. Macro in C -- What's the Overhead (Memory/Speed)?

    - by Jason R. Mick
    I searched Stack Overflow for the pros/cons of function-like macros v. inline functions. I found the following discussion: Pros and Cons of Different macro function / inline methods in C ...but it didn't answer my primary burning question. Namely, what is the overhead in c of using a macro function (with variables, possibly other function calls) v. an inline function, in terms of memory usage and execution speed? Are there any compiler-dependent differences in overhead? I have both icc and gcc at my disposal. My code snippet I'm modularizing is: double AttractiveTerm = pow(SigmaSquared/RadialDistanceSquared,3); double RepulsiveTerm = AttractiveTerm * AttractiveTerm; EnergyContribution += 4 * Epsilon * (RepulsiveTerm - AttractiveTerm); My reason for turning it into an inline function/macro is so I can drop it into a c file and then conditionally compile other similar, but slightly different functions/macros. e.g.: double AttractiveTerm = pow(SigmaSquared/RadialDistanceSquared,3); double RepulsiveTerm = pow(SigmaSquared/RadialDistanceSquared,9); EnergyContribution += 4 * Epsilon * (RepulsiveTerm - AttractiveTerm); (note the difference in the second line...) This function is a central one to my code and gets called thousands of times per step in my program and my program performs millions of steps. Thus I want to have the LEAST overhead possible, hence why I'm wasting time worrying about the overhead of inlining v. transforming the code into a macro. Based on the prior discussion I already realize other pros/cons (type independence and resulting errors from that) of macros... but what I want to know most, and don't currently know is the PERFORMANCE. I know some of you C veterans will have some great insight for me!!

    Read the article

  • What is the correct high level schema.org microdata itemtype for a retail brand/company homepage?

    - by kpowz
    I'd like to hear which schema.org itemtype others would recommend using or have used in the case of completing a retail brand's company homepage microdata. Take for example TOMS's shoes: Example #1 - Using /Corporation as the high-level itemtype one can include a lot of great /Organization microdata, but nothing about the retail store. <html itemscope='itemscope' itemtype="http://schema.org/Website> <head></head> <body itemscope='itemscope' itemtype="http://schema.org/Corporation> various microdata here probably including Product microdata </body> </html> NOTE: the only schema.org property specific to /Corporation is tickerSymbol & TOMS doesn't have one. Example #2 - This code would work if TOMS started their own channel of physical retail stores & each location had it's own homepage. However, for TOMS's.com, although accurate schematically & more descriptive at the face, this is incorrect microdata markup for TOMS.com, because /ShoeStore derives from /LocalBusiness - which must represent a physical place. <html itemscope='itemscope' itemtype='http://schema.org/Website'> <head></head> <body itemscope='itemscope' itemtype='http://schema.org/ShoeStore'> a whole bunch of jabber here </body> </html> NOTE: Since TOMS is virtual & thus can't be a /Store this means you lose really cool properties like 'currenciesAccepted', 'paymentAccepted' & 'priceRange'. Is this just a 'sit and wait' situation until more schemas are approved for 'virtual places' or is there a validation-passing way to get the best of both worlds?

    Read the article

  • Specifying SOAP Headers for a Zend_Soap Service

    - by Stephen
    I have a generally straight forward web service that I've written (converting code to ZF from a Java implementation of the same service and trying to maintain the same wsdl structure as much as possible). The service loads a PHP class, rather than individual functions. The PHP class contains three different functions within it. Everything seems to be working just fine, except that I can't seem to figure out how to specify that a given function parameter should be passed as a SOAP header. I've not seen any mention of SOAP headers in the Server context, only how to pass header parameters with a client to a server. In addition to the standard parameters for the function that would be sent in the SOAP body and detailed in the docblock, I would like to specify two parameters (a username and password) that would be sent in a SOAP header. I have to assume this is possible, but haven't been able to find anything online, nor have I had any responses to a similar post on Zend's forum. Is there something that can be added in the docblock area to specify a parameter as a header (maybe in a similar fashion to using WebParam?)? Any suggestions/examples on how to get this accomplished would be greatly appreciated!

    Read the article

  • C# array of objects - conditional validation

    - by fishdump
    Sorry about the vague title! I have an class with a number of member variables (system, zone, site, ...) public sealed class Cello { public String Company; public String Zone; public String System; public String Site; public String Facility; public String Process; //... } I have an array of objects of this class. private Cello[] m_cellos = null; // ... I need to know whether the array contains objects with the same site but different systems, zones or companies since such a situation would be illegal. I have various other checks to make but they are all along similar lines. The Array class has a number of functions that look promising but I am not very up on defining 'key selector' functions and things like that. Any suggestions or pointers would be greatly appreciated. --- Alistair.

    Read the article

  • Best way to implement plugin framework - are DLLs the only way (C/C++ project)?

    - by Microkernel
    Introduction: I am currently developing a document classifier software in C/C++ and I will be using Naive-Bayesian model for classification. But I wanted the users to use any algorithm that they want(or I want in the future), hence I went to separate the algorithm part in the architecture as a plugin that will be attached to the main app @ app start-up. Hence any user can write his own algorithm as a plugin and use it with my app. Problem Statement: The way I am intending to develop this is to have each of the algorithms that user wants to use to be made into a DLL file and put into a specific directory. And at the start, my app will search for all the DLLs in that directory and load them. My Questions: (1) What if a malicious code is made as a DLL (and that will have same functions mandated by plugin framework) and put into my plugins directory? In that case, my app will think that its a plugin and picks it and calls its functions, so the malicious code can easily bring down my entire app down (In the worst case could make my app as a malicious code launcher!!!). (2) Is using DLLs the only way available to implement plugin design pattern? (Not only for the fear of malicious plugin, but its a generic question out of curiosity :) ) (3) I think a lot of softwares are written with plugin model for extendability, if so, how do they defend against such attacks? (4) In general what do you think about my decision to use plugin model for extendability (do you think I should look at any other alternatives?) Thank you -MicroKernel :)

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • How much is too much memory allocation in NDK?

    - by Maximus
    The NDK download page notes that, "Typical good candidates for the NDK are self-contained, CPU-intensive operations that don't allocate much memory, such as signal processing, physics simulation, and so on." I came from a C background and was excited to try to use the NDK to operate most of my OpenGL ES functions and any native functions related to physics, animation of vertices, etc... I'm finding that I'm relying quite a bit on Native code and wondering if I may be making some mistakes. I've had no trouble with testing at this point, but I'm curious if I may run into problems in the future. For example, I have game struct defined (somewhat like is seen in the San-Angeles example). I'm loading vertex information for objects dynamically (just what is needed for an active game area) so there's quite a bit of memory allocation happening for vertices, normals, texture coordinates, indices and texture graphic data... just to name the essentials. I'm quite careful about freeing what is allocated between game areas. Would I be safer setting some caps on array sizes or should I charge bravely forward as I'm going now?

    Read the article

  • Link compatibility between C++ and D

    - by Caspin
    D easily interfaces with C. D just as easily interfaces with C++, but (and it's a big but) the C++ needs to be extremely trivial. The code cannot use: namespaces templates multiple inheritance mix virtual with non-virtual methods more? I completely understand the inheritance restriction. The rest however, feel like artificial limitations. Now I don't want to be able to use std::vector<T> directly, but I would really like to be able to link with std::vector<int> as an externed template. The C++ interfacing page has this particularly depressing comment. D templates have little in common with C++ templates, and it is very unlikely that any sort of reasonable method could be found to express C++ templates in a link-compatible way with D. This means that the C++ STL, and C++ Boost, likely will never be accessible from D. Admittedly I'll probably never need std::vector while coding in D, but I'd love to use QT or boost. So what's the deal. Why is it so hard to express non-trivial C++ classes in D? Would it not be worth it to add some special annotations or something to express at least namespaces?

    Read the article

  • How to catch unintentional function interpositioning with GCC?

    - by SiegeX
    Reading through my book Expert C Programming, I came across the chapter on function interpositioning and how it can lead to some serious hard to find bugs if done unintentionally. The example given in the book is the following: my_source.c mktemp() { ... } main() { mktemp(); getwd(); } libc mktemp(){ ... } getwd(){ ...; mktemp(); ... } According to the book, what happens in main() is that mktemp() (a standard C library function) is interposed by the implementation in my_source.c. Although having main() call my implementation of mktemp() is intended behavior, having getwd() (another C library function) also call my implementation of mktemp() is not. Apparently, this example was a real life bug that existed in SunOS 4.0.3's version of lpr. The book goes on to explain the fix was to add the keyword static to the definition of mktemp() in my_source.c; although changing the name altogether should have fixed this problem as well. This chapter leaves me with some unresolved questions that I hope you guys could answer: Should our software group adopt the practice of putting the keyword static in front of all functions that we don't want to be exposed? Does GCC have a way to warn about function interposition? We certainly don't ever intend on this happening and I'd like to know about it if it does. Can interposition happen with functions introduced by static libraries? Thanks for the help.

    Read the article

  • C++ linker unresolved external symbol (again;) from other source file *.obj file. (VC++ express)

    - by bua
    Hi there, I'm back to C/C++ after some break. I've a following problem: I've a solution where I've several projects (compilable and linkable). Now I need to add another project to this solution which depends on some sources from other projects. My new project compiles without any problems (I've added "existing sources" to my project). the error: 1>Linking... 1>LicenceManager.obj : error LNK2019: unresolved external symbol "int __cdecl saveLic(char *,struct Auth *)" (?saveLic@@YAHPADPAUAuth@@@Z) referenced in function "public: void __thiscall LicenceManager::generateLicence(int,char *)" (?generateLicence@LicenceManager@@QAEXHPAD@Z) 1>LicenceManager.obj : error LNK2019: unresolved external symbol "void __cdecl getSysInfo(struct Auth *)" (?getSysInfo@@YAXPAUAuth@@@Z) referenced in function "public: void __thiscall LicenceManager::generateLicence(int,char *)" (?generateLicence@LicenceManager@@QAEXHPAD@Z) Functions saveLic, and getSysInfo are defined in files which I've added to my new project from existing ones. There is object file created during compilation with those functions in target dir, but my LicenceManager class doesn't want to link. I use some extern "C" , and #pragma pack somewhere, but no more fancy stuff. I think every directory, lib and other necessary dependencies are visible in settings for this project. Thanks for any advice.

    Read the article

  • Convert VBA to VBS

    - by dnLL
    I have a little VBA script with some functions that I would like to convert to a single VBS file. Here is an example of what I got: Private Declare Function GetPrivateProfileString Lib "kernel32" Alias "GetPrivateProfileStringA" (ByVal lpApplicationName As String, ByVal lpKeyName As Any, ByVal lpDefault As String, ByVal lpReturnedString As String, ByVal nSize As Long, ByVal lpFileName As String) As Long Private Function ReadIniFileString(ByVal Sect As String, ByVal Keyname As String) As String Dim Worked As Long Dim RetStr As String * 128 Dim StrSize As Long Dim iNoOfCharInIni As Integer Dim sIniString, sProfileString As String iNoOfCharInIni = 0 sIniString = "" If Sect = "" Or Keyname = "" Then MsgBox "Erreur lors de la lecture des paramètres dans " & IniFileName, vbExclamation, "INI" Access.Application.Quit Else sProfileString = "" RetStr = Space(128) StrSize = Len(RetStr) Worked = GetPrivateProfileString(Sect, Keyname, "", RetStr, StrSize, IniFileName) If Worked Then iNoOfCharInIni = Worked sIniString = Left$(RetStr, Worked) End If End If ReadIniFileString = sIniString End Function And then, I need to use this function to put some values in strings. VBS doesn't seem to like any of my var declaration ((Dim) MyVar As MyType). If I'm able to adapt that code to VBS, I should be able to do the rest of my functions too. How can I adapt/convert this to VBS? Thank you.

    Read the article

  • google maps api keys to be set webserver-wide, (as env var? inside apache?)

    - by ~knb
    I have a web site with many virtual hosts and each registered with several domain names (ending in .org, .de), site1.mysite.de, site2.mysite.org Then I have different templating systems based on several programming languages (perl and php) in use on the web server. The Google Maps Api requires a unique Google Maps api key for each vhost. I want to have something like a web-server wide variable $goomapkey that I can call from inside my code. In PHP code, Now I have a kludgy case-analysis solution like $domain = substr($_SERVER['SERVER_NAME'], -3); if (".de" == $domain){ //if ("xxxxxx" eq substr($ENV{SERVER_NAME}, 0, 5)){ // $gookey = "ABQIAAA..."; //} else { //site1.de $gookey = "ABQIAAAA1Js..."; //} } elseif ("dev" == substr($_SERVER['SERVER_NAME'], 0, 3)){ //dev.mysite.org $gookey = "ABQIAAAA1JsSb..."; } else { //www.mysite.org $gookey = "ABQIAAAA1JsS..."; //TODO: Add more keys for each virtual host, for my.machinename.de, IP-address based URL, ... } ... inside my php-based CMS. A non-ideal solution, because it is, php-only, and I still have to set it at several html templates inside the CMS, and there are too many cases. I want the google maps api key to be set by the apache web server who examines the request *early in the request loop before any php page template code is constructed and evaluated. is an environment variable a good solution? which technology should be used to set the $goomapkey variable? I'd prefer mod_perl2 Apache request handler, but the documentation is confusing (many API changes in the past ). Which Apache module could I use? Is there a built-in Apache module that does the same thing?

    Read the article

  • Who needs singletons?

    - by sexyprout
    Imagine you access your MySQL database via PDO. You got some functions, and in these functions, you need to access the database. The first thing I thought of is global, like: $db = new PDO('mysql:host=127.0.0.1;dbname=toto', 'root', 'pwd'); function some_function() { global $db; $db->query('...'); } But it's considered as a bad practice. So, after a little search, I ended up with the Singleton pattern, which "applies to situations in which there needs to be a single instance of a class." According to the example of the manual, we should do this: class Database { private static $instance, $db; private function __construct(){} static function singleton() { if(!isset(self::$instance)) self::$instance = new __CLASS__; return self:$instance; } function get() { if(!isset(self::$db)) self::$db = new PDO('mysql:host=127.0.0.1;dbname=toto', 'user', 'pwd') return self::$db; } } function some_function() { $db = Database::singleton(); $db->get()->query('...'); } some_function(); But I just can't understand why you need that big class when you can do it merely with: class Database { private static $db; private function __construct(){} static function get() { if(!isset(self::$rand)) self::$db = new PDO('mysql:host=127.0.0.1;dbname=toto', 'user', 'pwd'); return self::$db; } } function some_function() { Database::get()->query('...'); } some_function(); This last one works perfectly and I don't need to worry about $db anymore. But maybe I'm forgetting something. So, who's wrong, who's right?

    Read the article

  • Problem with inner classes of the same name in Visual C++

    - by starblue
    I have a problem with Visual C++, where apparently inner classes with the same name but in different outer classes are confused. The problem occurs for two layers, where each layer has a listener interface as an inner class. B is a listener of A, and has its own listener in a third layer above it (not shown). The structure of the code looks like this: A.h class A { class Listener { Listener(); virtual ~Listener() = 0; } [...] } B.h class B : public A::Listener { class Listener { Listener(); virtual ~Listener() = 0; } [...] } B.cpp B::Listener::Listener() {} B::Listener::~Listener() {} I get the error B.cpp(49) : error C2509: '{ctor}' : member function not declared in 'B' The C++ compiler for Renesas sh2a has no problem with this, but then it is more liberal than Visual C++ in some other respects, too. If I rename the listener interfaces to have different names the problem goes away, but I'd like to avoid that (the real class names instead of A or B are rather long). Is what I'm doing correct C++, or is the complaint by Visual C++ justified? Is there a way to work around this problem without renaming the listener interfaces?

    Read the article

  • Freetype2 (error-)return value documentation

    - by Awaki
    In short, I'm looking for documentation that would limit the error situations to check for after a Freetype library function failed, much like the OpenGL and Win32 APIs document the error codes generated by their respective functions. I can't seem to find such documentation though, so I was wondering how to best handle translation of Freetype errors to typed exceptions. Background: I am currently in the process of implementing font-rendering capability (using Freetype) for my GUI framework, which makes strong use of typed exceptions to indicate error situations. However, the Freetype docs seem to completely omit what errors can be expected from what functions. That, if such documentation does indeed not exist, would basically leave me with two options: either guessing which errors make sense for a certain Freetype function (obviously prone to mistakes on my part), or considering every error code for translation into appropriate exceptions (less verbose since I would have to write the translation only once). Performance isn't really critical in the code that calls the Freetype library, so even the latter option would probably be acceptable, but surely there must be some kind of documentation on which library calls may return what Freetype error? Is there any such documentation which I just somehow managed to not find? Should I go the route of generically expecting every error code for translation? Or are there other ways to approach this problem? By the way, I wanted to avoid introducing some kind of generic FreetypeException (containing a description of the Freetype error) since I intended to completely hide what libraries I'm using (not from a legal point-of-view, mind you), but I guess I can be convinced to do this anyway if the consensus is that it would be the best option. I don't think it matters for this question, but I'm writing in C++.

    Read the article

  • Can a custom MFC window/dialog be a class template instantiation?

    - by John
    There's a bunch of special macros that MFC uses when creating dialogs, and in my quick tests I'm getting weird errors trying to compile a template dialog class. Is this likely to be a big pain to achieve? Here's what I tried: MyDlg.h template <class W> class CMyDlg : public CDialog { typedef CDialog super; DECLARE_DYNAMIC(CMyDlg <W>) public: CMyDlg (CWnd* pParent); // standard constructor virtual ~CMyDlg (); // Dialog Data enum { IDD = IDD_MYDLG }; protected: virtual void DoDataExchange(CDataExchange* pDX); // DDX/DDV support DECLARE_MESSAGE_MAP() private: W *m_pWidget; //W will always be a CDialog }; IMPLEMENT_DYNAMIC(CMyDlg<W>, super) <------------------- template <class W> CMyDlg<W>::CMyDlg(CWnd* pParent) : super(CMyDlg::IDD, pParent) { m_pWidget = new W(this); } I get a whole bunch of errors but main one appears to be: error C2955: 'CMyDlg' : use of class template requires template argument list I tried using some specialised template versions of macros but it doesn't help much, other errors change but this one remains. Note my code is all in one file, since C++ templates don't like .h/.cpp like normal. I'm assuming someone must have done this in the past, possibly creating custom versions of macros, but I can't find it by searching, since 'template' has other meanings.

    Read the article

  • Hashing Function for Map C++

    - by Josh
    I am trying to determine a hash function which takes an input (i, k) and determines a unique solution. The possible inputs for (i, k) range from 0 to 100. Consider each (i, k) as a position of a node in a trinomial tree. Ex: (0, 0) can diverge to (1, 1) (1, 0) (1, -1). (1, 1) can diverge to (2, 2) (2, 1) (2, 0). Sample given here: http://www.google.com/imgres?imgurl=http://sfb649.wiwi.hu-berlin.de/fedc_homepage/xplore/tutorials/stfhtmlimg1156.gif&imgrefurl=http://sfb649.wiwi.hu-berlin.de/fedc_homepage/xplore/tutorials/stfhtmlnode41.html&h=413&w=416&sz=4&tbnid=OegDZu-yeVitZM:&tbnh=90&tbnw=91&zoom=1&usg=__9uQWDNYNLV14YioWWbrqPgfa3DQ=&docid=2hhitNyRWjI_DM&hl=en&sa=X&ei=xAfFUIbyG8nzyAHv2YDICg&ved=0CDsQ9QEwAQ I am using a map map <double, double> hash_table I need a key value to be determined from pairs (i, k) to hash to to value for that (i, k) So far I was only able to come up with linear functions such as: double Hash_function(int i, int k) { //double val = pow(i, k) + i; //return (val % 4294967296); return (i*3.1415 + k*i*9.12341); } However, I cannot determine a unique key with a certain (i, k). What kind of functions can I use to help me do so?

    Read the article

< Previous Page | 303 304 305 306 307 308 309 310 311 312 313 314  | Next Page >