Search Results

Search found 18464 results on 739 pages for 'virtual functions'.

Page 307/739 | < Previous Page | 303 304 305 306 307 308 309 310 311 312 313 314  | Next Page >

  • Different programming languages possibilities

    - by b-gen-jack-o-neill
    Hello. This should be very simple question. There are many programming languages out there, compiled into machine code or managed code. I first started with ASM back in high school. Assembler is very nice, since you know what exactly CPU does. Next, (as you can see from my other questions here) I decided to learn C and C++. I choosed C becouse from what I read it is the language with output most close to assembler-written programs. But, what I want to know is, can any other Windows programming language out there call win32 API? To be exact, like C has its special header and functions for win32 api interactions, is this assumed to be some important part of programming language? Or are there any languages that have no support for calling win32 API, or just use console to IO and some functions for basic file IO? Becouse, for Windows programming with graphic output, it is essential to have acess to win32 API. I know this question might seem silly, but still please, help me, I ask for study porposes. Thanks.

    Read the article

  • python list/dict property best practice

    - by jterrace
    I have a class object that stores some properties that are lists of other objects. Each of the items in the list has an identifier that can be accessed with the id property. I'd like to be able to read and write from these lists but also be able to access a dictionary keyed by their identifier. Let me illustrate with an example: class Child(object): def __init__(self, id, name): self.id = id self.name = name class Teacher(object): def __init__(self, id, name): self.id = id self.name = name class Classroom(object): def __init__(self, children, teachers): self.children = children self.teachers = teachers classroom = Classroom([Child('389','pete')], [Teacher('829','bob')]) This is a silly example, but it illustrates what I'm trying to do. I'd like to be able to interact with the classroom object like this: #access like a list print classroom.children[0] #append like it's a list classroom.children.append(Child('2344','joe')) #delete from like it's a list classroom.children.pop(0) But I'd also like to be able to access it like it's a dictionary, and the dictionary should be automatically updated when I modify the list: #access like a dict print classroom.childrenById['389'] I realize I could just make it a dict, but I want to avoid code like this: classroom.childrendict[child.id] = child I also might have several of these properties, so I don't want to add functions like addChild, which feels very un-pythonic anyway. Is there a way to somehow subclass dict and/or list and provide all of these functions easily with my class's properties? I'd also like to avoid as much code as possible.

    Read the article

  • Inline function v. Macro in C -- What's the Overhead (Memory/Speed)?

    - by Jason R. Mick
    I searched Stack Overflow for the pros/cons of function-like macros v. inline functions. I found the following discussion: Pros and Cons of Different macro function / inline methods in C ...but it didn't answer my primary burning question. Namely, what is the overhead in c of using a macro function (with variables, possibly other function calls) v. an inline function, in terms of memory usage and execution speed? Are there any compiler-dependent differences in overhead? I have both icc and gcc at my disposal. My code snippet I'm modularizing is: double AttractiveTerm = pow(SigmaSquared/RadialDistanceSquared,3); double RepulsiveTerm = AttractiveTerm * AttractiveTerm; EnergyContribution += 4 * Epsilon * (RepulsiveTerm - AttractiveTerm); My reason for turning it into an inline function/macro is so I can drop it into a c file and then conditionally compile other similar, but slightly different functions/macros. e.g.: double AttractiveTerm = pow(SigmaSquared/RadialDistanceSquared,3); double RepulsiveTerm = pow(SigmaSquared/RadialDistanceSquared,9); EnergyContribution += 4 * Epsilon * (RepulsiveTerm - AttractiveTerm); (note the difference in the second line...) This function is a central one to my code and gets called thousands of times per step in my program and my program performs millions of steps. Thus I want to have the LEAST overhead possible, hence why I'm wasting time worrying about the overhead of inlining v. transforming the code into a macro. Based on the prior discussion I already realize other pros/cons (type independence and resulting errors from that) of macros... but what I want to know most, and don't currently know is the PERFORMANCE. I know some of you C veterans will have some great insight for me!!

    Read the article

  • Asp.net mvc inheritance controllers

    - by Ris90
    Hi, I'm studing asp.net mvc and in my test project I have some problems with inheritance: In my model I use inheritanse in few entities: public class Employee:Entity { /* few public properties */ } It is the base class. And descendants: public class RecruitmentOfficeEmployee: Employee { public virtual RecruitmentOffice AssignedOnRecruitmentOffice { get; set; } } public class ResearchInstituteEmployee: Employee { public virtual ResearchInstitute AssignedOnResearchInstitute { get; set; } } I want to implement a simple CRUD operations to every descedant. What is the better way to inplement controllers and views in descendants: - One controller per every descendant; - Controller inheritance; - Generic controller; - Generic methods in one controller. Or maybe there is an another way? My ORM is NHibernate, I have a generic base repository and every repository is its descedant. Using generic controller, I think, is the best way, but in it I will use only generic base repository and extensibility of the system will be not very good. Please, help the newbie)

    Read the article

  • Best way to implement plugin framework - are DLLs the only way (C/C++ project)?

    - by Microkernel
    Introduction: I am currently developing a document classifier software in C/C++ and I will be using Naive-Bayesian model for classification. But I wanted the users to use any algorithm that they want(or I want in the future), hence I went to separate the algorithm part in the architecture as a plugin that will be attached to the main app @ app start-up. Hence any user can write his own algorithm as a plugin and use it with my app. Problem Statement: The way I am intending to develop this is to have each of the algorithms that user wants to use to be made into a DLL file and put into a specific directory. And at the start, my app will search for all the DLLs in that directory and load them. My Questions: (1) What if a malicious code is made as a DLL (and that will have same functions mandated by plugin framework) and put into my plugins directory? In that case, my app will think that its a plugin and picks it and calls its functions, so the malicious code can easily bring down my entire app down (In the worst case could make my app as a malicious code launcher!!!). (2) Is using DLLs the only way available to implement plugin design pattern? (Not only for the fear of malicious plugin, but its a generic question out of curiosity :) ) (3) I think a lot of softwares are written with plugin model for extendability, if so, how do they defend against such attacks? (4) In general what do you think about my decision to use plugin model for extendability (do you think I should look at any other alternatives?) Thank you -MicroKernel :)

    Read the article

  • google maps api keys to be set webserver-wide, (as env var? inside apache?)

    - by ~knb
    I have a web site with many virtual hosts and each registered with several domain names (ending in .org, .de), site1.mysite.de, site2.mysite.org Then I have different templating systems based on several programming languages (perl and php) in use on the web server. The Google Maps Api requires a unique Google Maps api key for each vhost. I want to have something like a web-server wide variable $goomapkey that I can call from inside my code. In PHP code, Now I have a kludgy case-analysis solution like $domain = substr($_SERVER['SERVER_NAME'], -3); if (".de" == $domain){ //if ("xxxxxx" eq substr($ENV{SERVER_NAME}, 0, 5)){ // $gookey = "ABQIAAA..."; //} else { //site1.de $gookey = "ABQIAAAA1Js..."; //} } elseif ("dev" == substr($_SERVER['SERVER_NAME'], 0, 3)){ //dev.mysite.org $gookey = "ABQIAAAA1JsSb..."; } else { //www.mysite.org $gookey = "ABQIAAAA1JsS..."; //TODO: Add more keys for each virtual host, for my.machinename.de, IP-address based URL, ... } ... inside my php-based CMS. A non-ideal solution, because it is, php-only, and I still have to set it at several html templates inside the CMS, and there are too many cases. I want the google maps api key to be set by the apache web server who examines the request *early in the request loop before any php page template code is constructed and evaluated. is an environment variable a good solution? which technology should be used to set the $goomapkey variable? I'd prefer mod_perl2 Apache request handler, but the documentation is confusing (many API changes in the past ). Which Apache module could I use? Is there a built-in Apache module that does the same thing?

    Read the article

  • How to structure this Symfony web project?

    - by James William
    I am new to Symfony and am not sure how to best structure my web project. The solution must accommodate 3 use cases: Public access to www.mydomain.com for general use Member only access to member.mydomain.com Administrator access to admin.mydomain.com All three virtual hosts point to the Symfony /web directory Questions: Is this 3 separate applications in my Symfony project (e.g. "frontend", "backend" and "admin" or "public", "member", "admin")? Is this a good approach if there is to be some duplicate code (e.g. generating a member list would be common across all 3 applications, but presented differently)? How would I route to the various applications based on the subdomain when a user accesses *.mydomain.com? Where in Symfony should this routing logic be placed? Or, is this one application with modules for each of the above use cases? EDIT: I do not have access to httpd.conf in apache to specify a default page for virtual hosts. I can only specify a directory for each subdomain using the hostin provider's cPanel.

    Read the article

  • C# array of objects - conditional validation

    - by fishdump
    Sorry about the vague title! I have an class with a number of member variables (system, zone, site, ...) public sealed class Cello { public String Company; public String Zone; public String System; public String Site; public String Facility; public String Process; //... } I have an array of objects of this class. private Cello[] m_cellos = null; // ... I need to know whether the array contains objects with the same site but different systems, zones or companies since such a situation would be illegal. I have various other checks to make but they are all along similar lines. The Array class has a number of functions that look promising but I am not very up on defining 'key selector' functions and things like that. Any suggestions or pointers would be greatly appreciated. --- Alistair.

    Read the article

  • C++ linker unresolved external symbol (again;) from other source file *.obj file. (VC++ express)

    - by bua
    Hi there, I'm back to C/C++ after some break. I've a following problem: I've a solution where I've several projects (compilable and linkable). Now I need to add another project to this solution which depends on some sources from other projects. My new project compiles without any problems (I've added "existing sources" to my project). the error: 1>Linking... 1>LicenceManager.obj : error LNK2019: unresolved external symbol "int __cdecl saveLic(char *,struct Auth *)" (?saveLic@@YAHPADPAUAuth@@@Z) referenced in function "public: void __thiscall LicenceManager::generateLicence(int,char *)" (?generateLicence@LicenceManager@@QAEXHPAD@Z) 1>LicenceManager.obj : error LNK2019: unresolved external symbol "void __cdecl getSysInfo(struct Auth *)" (?getSysInfo@@YAXPAUAuth@@@Z) referenced in function "public: void __thiscall LicenceManager::generateLicence(int,char *)" (?generateLicence@LicenceManager@@QAEXHPAD@Z) Functions saveLic, and getSysInfo are defined in files which I've added to my new project from existing ones. There is object file created during compilation with those functions in target dir, but my LicenceManager class doesn't want to link. I use some extern "C" , and #pragma pack somewhere, but no more fancy stuff. I think every directory, lib and other necessary dependencies are visible in settings for this project. Thanks for any advice.

    Read the article

  • Specifying SOAP Headers for a Zend_Soap Service

    - by Stephen
    I have a generally straight forward web service that I've written (converting code to ZF from a Java implementation of the same service and trying to maintain the same wsdl structure as much as possible). The service loads a PHP class, rather than individual functions. The PHP class contains three different functions within it. Everything seems to be working just fine, except that I can't seem to figure out how to specify that a given function parameter should be passed as a SOAP header. I've not seen any mention of SOAP headers in the Server context, only how to pass header parameters with a client to a server. In addition to the standard parameters for the function that would be sent in the SOAP body and detailed in the docblock, I would like to specify two parameters (a username and password) that would be sent in a SOAP header. I have to assume this is possible, but haven't been able to find anything online, nor have I had any responses to a similar post on Zend's forum. Is there something that can be added in the docblock area to specify a parameter as a header (maybe in a similar fashion to using WebParam?)? Any suggestions/examples on how to get this accomplished would be greatly appreciated!

    Read the article

  • C# Interface Method calls from a controller

    - by ArjaaAine
    I was just working on some application architecture and this may sound like a stupid question but please explain to me how the following works: Interface: public interface IMatterDAL { IEnumerable<Matter> GetMattersByCode(string input); IEnumerable<Matter> GetMattersBySearch(string input); } Class: public class MatterDAL : IMatterDAL { private readonly Database _db; public MatterDAL(Database db) { _db = db; LoadAll(); //Private Method } public virtual IEnumerable<Matter> GetMattersBySearch(string input) { //CODE return result; } public virtual IEnumerable<Matter> GetMattersByCode(string input) { //CODE return results; } Controller: public class MatterController : ApiController { private readonly IMatterDAL _publishedData; public MatterController(IMatterDAL publishedData) { _publishedData = publishedData; } [ValidateInput(false)] public JsonResult SearchByCode(string id) { var searchText = id; //better name for this var results = _publishedData.GetMattersBySearch(searchText).Select( matter => new { MatterCode = matter.Code, MatterName = matter.Name, matter.ClientCode, matter.ClientName }); return Json(results); } This works, when I call my controller method from jquery and step into it, the call to the _publishedData method, goes into the class MatterDAL. I want to know how does my controller know to go to the MatterDAL implementation of the Interface IMatterDAL. What if I have another class called MatterDAL2 which is based on the interface. How will my controller know then to call the right method? I am sorry if this is a stupid question, this is baffling me.

    Read the article

  • PHP's fopen is terminally failing

    - by Skittles
    Okay, I have GOT to be missing something totally rudimentary here. I have an extremely simple use of PHP's fopen function, but for some reason, it will not open the file no matter what I do. The odd part about this is that I use fopen in another function in the same script and it's working perfectly. I'm using the fclose in both functions. So, I know it's not a matter of a rogue file handle. I have confirmed the file's path and the existence of the target file also. I'm running the script at the command-line as root, so I know it's not apache that's the cause. And since I am running the script as root, I am fairly confident that permissions are not the issue. So, what on earth am I missing here? function get_file_list() { $file = '/home/site/tmp/return_files_list.txt'; $fp = fopen($file, 'r') or die("Could not open file: /home/site/tmp/return_files_list.txt for reading.\n"); $files_list = array(); while($line = fgets($fp)) { $files_list[] = $line; } fclose($fp); return $files_list; } function num_records_in_file($filename) { $fp = fopen( $filename, 'r' ); # or die("Could not open file: $filename\n"); $counter = 0; if ($fp) { while (!feof( $fp )) { $line = fgets( $fp ); $arr = explode( '|', $line ); if (( ( $arr[0] != 'HDR' && $arr[0] != 'TRL' ) && $arr[0] != '' )) { ++$counter; continue; } } } fclose( $fp ); return $counter; } As requested, here's both functions. The second function is passed an absolute path to the file. That is what I used to confirm that the file is there and that the path is correct.

    Read the article

  • Link compatibility between C++ and D

    - by Caspin
    D easily interfaces with C. D just as easily interfaces with C++, but (and it's a big but) the C++ needs to be extremely trivial. The code cannot use: namespaces templates multiple inheritance mix virtual with non-virtual methods more? I completely understand the inheritance restriction. The rest however, feel like artificial limitations. Now I don't want to be able to use std::vector<T> directly, but I would really like to be able to link with std::vector<int> as an externed template. The C++ interfacing page has this particularly depressing comment. D templates have little in common with C++ templates, and it is very unlikely that any sort of reasonable method could be found to express C++ templates in a link-compatible way with D. This means that the C++ STL, and C++ Boost, likely will never be accessible from D. Admittedly I'll probably never need std::vector while coding in D, but I'd love to use QT or boost. So what's the deal. Why is it so hard to express non-trivial C++ classes in D? Would it not be worth it to add some special annotations or something to express at least namespaces?

    Read the article

  • ASP.NET MVC4: How do I keep from having multiple identical results in my lookup tables

    - by sehummel
    I'm new to ASP.NET so this may be an easy question. I'm seeding my database with several rows of dummy data. Here is one of my rows: new Software { Title = "Microsoft Office", Version = "2012", SerialNumber = "12346231434543", Platform = "PC", Notes = "Macs really rock!", PurchaseDate = "2011-12-04", Suite = true, SubscriptionEndDate = null, SeatCount = 0, SoftwareTypes = new List<SoftwareType> { new SoftwareType { Type="Suite" }}, Locations = new List<Location> { new Location { LocationName = "Paradise" }}, Publishers = new List<SoftwarePublisher> { new SoftwarePublisher { Publisher = "Microsoft" }}} But when I do this, a new row is created for each location, with the LocationName being set in each row like this. We only have two locations. How do I get it to create a LocationID property for the Software class and in my Locations class. Here is my Location class: public class Location { public int Id { get; set; } [Required] [StringLength(20)] public string LocationName { get; set; } public virtual Software Software { get; set; } } I have this line in my Software class to reference this table: public virtual List<Location> Locations { get; set; } Again, what I want when I am done is a Locations table with two entries, and a LocationID field in my Software table. How do I do this?

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Problem with inner classes of the same name in Visual C++

    - by starblue
    I have a problem with Visual C++, where apparently inner classes with the same name but in different outer classes are confused. The problem occurs for two layers, where each layer has a listener interface as an inner class. B is a listener of A, and has its own listener in a third layer above it (not shown). The structure of the code looks like this: A.h class A { class Listener { Listener(); virtual ~Listener() = 0; } [...] } B.h class B : public A::Listener { class Listener { Listener(); virtual ~Listener() = 0; } [...] } B.cpp B::Listener::Listener() {} B::Listener::~Listener() {} I get the error B.cpp(49) : error C2509: '{ctor}' : member function not declared in 'B' The C++ compiler for Renesas sh2a has no problem with this, but then it is more liberal than Visual C++ in some other respects, too. If I rename the listener interfaces to have different names the problem goes away, but I'd like to avoid that (the real class names instead of A or B are rather long). Is what I'm doing correct C++, or is the complaint by Visual C++ justified? Is there a way to work around this problem without renaming the listener interfaces?

    Read the article

  • How much is too much memory allocation in NDK?

    - by Maximus
    The NDK download page notes that, "Typical good candidates for the NDK are self-contained, CPU-intensive operations that don't allocate much memory, such as signal processing, physics simulation, and so on." I came from a C background and was excited to try to use the NDK to operate most of my OpenGL ES functions and any native functions related to physics, animation of vertices, etc... I'm finding that I'm relying quite a bit on Native code and wondering if I may be making some mistakes. I've had no trouble with testing at this point, but I'm curious if I may run into problems in the future. For example, I have game struct defined (somewhat like is seen in the San-Angeles example). I'm loading vertex information for objects dynamically (just what is needed for an active game area) so there's quite a bit of memory allocation happening for vertices, normals, texture coordinates, indices and texture graphic data... just to name the essentials. I'm quite careful about freeing what is allocated between game areas. Would I be safer setting some caps on array sizes or should I charge bravely forward as I'm going now?

    Read the article

  • Performing measures within the execution of a c++ code every t milliseconds

    - by user506901
    Given a while loop and the function ordering as follows: int k=0; int total=100; while(k<total){ doSomething(); if(approx. t milliseconds elapsed) { measure(); } ++k; } I want to perform 'measure' every t-th milliseconds. However, since 'doSomething' can be close to the t-th millisecond from the last execution, it is acceptable to perform the measure after approximately t milliseconds elapsed from the last measure. My question is: how could this be achieved? One solution would be to set timer to zero, and measure it after every 'doSomething'. When it is withing the acceptable range, I perform measures, and reset. However, I'm not which c++ function I should use for such a task. As I can see, there are certain functions, but the debate on which one is the most appropriate is outside of my understanding. Note that some of the functions actually take into account the time taken by some other processes, but I want my timer to only measure the time of the execution of my c++ code (I hope that is clear). Another thing is the resolution of the measurements, as pointed out below. Suppose the medium option of those suggested.

    Read the article

  • Reading XML or objects from a Web service

    - by Shawn
    This is my first time working with webservices and I am a bit lost. I successfully called the functions, but I only can get one value from the service. I read that the easiest way is to read xml or create objects and then call their values. Currently I use functions that return the desired value but I need to call them 3 times to get all the data witch is a waste of time and resources. I tried to call the service with the URL and use it as a website or getting the service to work the same way without importing into the program. The thing is that i cant find a way to pass the values into the url, because of that i get only blank pages. What is the fastest way to get my data from the services? I need city name, temperature and a flag if the city is valid. I need to pass the zip code to the service. Thank you. My current code wetther.Weather wether = new wetther.Weather(); string farenhait = wether.GetCityWeatherByZIP(zip).Temperature; string city = wether.GetCityWeatherByZIP(zip).City; bool correct = wether.GetCityWeatherByZIP(zip).Success; I tried it that way // Retrieve XML document XmlTextReader reader = new XmlTextReader("http://xml.weather.yahoo.com/forecastrss?p=94704"); // Skip non-significant whitespace reader.WhitespaceHandling = WhitespaceHandling.Significant; // Read nodes one at a time while (reader.Read()) { // Print out info on node Console.WriteLine("{0}: {1}", reader.NodeType.ToString(), reader.Name); } This one works for the yahoo page but not for mine. I need to use this webservice - http://wsf.cdyne.com/WeatherWS/Weather.asmx

    Read the article

  • Who needs singletons?

    - by sexyprout
    Imagine you access your MySQL database via PDO. You got some functions, and in these functions, you need to access the database. The first thing I thought of is global, like: $db = new PDO('mysql:host=127.0.0.1;dbname=toto', 'root', 'pwd'); function some_function() { global $db; $db->query('...'); } But it's considered as a bad practice. So, after a little search, I ended up with the Singleton pattern, which "applies to situations in which there needs to be a single instance of a class." According to the example of the manual, we should do this: class Database { private static $instance, $db; private function __construct(){} static function singleton() { if(!isset(self::$instance)) self::$instance = new __CLASS__; return self:$instance; } function get() { if(!isset(self::$db)) self::$db = new PDO('mysql:host=127.0.0.1;dbname=toto', 'user', 'pwd') return self::$db; } } function some_function() { $db = Database::singleton(); $db->get()->query('...'); } some_function(); But I just can't understand why you need that big class when you can do it merely with: class Database { private static $db; private function __construct(){} static function get() { if(!isset(self::$rand)) self::$db = new PDO('mysql:host=127.0.0.1;dbname=toto', 'user', 'pwd'); return self::$db; } } function some_function() { Database::get()->query('...'); } some_function(); This last one works perfectly and I don't need to worry about $db anymore. But maybe I'm forgetting something. So, who's wrong, who's right?

    Read the article

  • Can a custom MFC window/dialog be a class template instantiation?

    - by John
    There's a bunch of special macros that MFC uses when creating dialogs, and in my quick tests I'm getting weird errors trying to compile a template dialog class. Is this likely to be a big pain to achieve? Here's what I tried: MyDlg.h template <class W> class CMyDlg : public CDialog { typedef CDialog super; DECLARE_DYNAMIC(CMyDlg <W>) public: CMyDlg (CWnd* pParent); // standard constructor virtual ~CMyDlg (); // Dialog Data enum { IDD = IDD_MYDLG }; protected: virtual void DoDataExchange(CDataExchange* pDX); // DDX/DDV support DECLARE_MESSAGE_MAP() private: W *m_pWidget; //W will always be a CDialog }; IMPLEMENT_DYNAMIC(CMyDlg<W>, super) <------------------- template <class W> CMyDlg<W>::CMyDlg(CWnd* pParent) : super(CMyDlg::IDD, pParent) { m_pWidget = new W(this); } I get a whole bunch of errors but main one appears to be: error C2955: 'CMyDlg' : use of class template requires template argument list I tried using some specialised template versions of macros but it doesn't help much, other errors change but this one remains. Note my code is all in one file, since C++ templates don't like .h/.cpp like normal. I'm assuming someone must have done this in the past, possibly creating custom versions of macros, but I can't find it by searching, since 'template' has other meanings.

    Read the article

  • Creating Modules for VB Program (Similar to firefox add on)

    - by Assimilater
    Hi all. I have a contact manager program that I'd like to design for multiple network marketing companies. My desired structure would include a core program which covers basic contact management functions. After that one could purchase a module for their specific network marketing company. This module would contain a variety of controls that the original program would need to be able to manipulate. Here is an example of what it would have to have: A group box containing buttons that link to a genealogy view, and the option to import one's donwnline from the back office provided by a company. A panel which is displayed on the contact page allowing the user to input business information or which will be filled by importing a downline from the back office: ie business ID, qualification level, sponsor information etc. a panel displayed when one searches for contacts on the contact list page which allows the user to sort based on information such as when they joined, what their business id is and so forth. a panel which is displayed in a personal business overview page which presents to an individual how many people in their downline are at each qualification level and develop a mailing list for individuals of a certain qualification level. I have the code developed to perform all these functions, I just wanted to give you an example of what needed to be done. I'm thinking that what I'm trying to create is a library that one can download and the program will recognize, but I'm not really sure where to go. What I'm really trying to do is figure out what kind of file I can make that will contain all this code and the GUI information that the program will recognize. Any ideas? With thanks, John

    Read the article

  • How to catch unintentional function interpositioning with GCC?

    - by SiegeX
    Reading through my book Expert C Programming, I came across the chapter on function interpositioning and how it can lead to some serious hard to find bugs if done unintentionally. The example given in the book is the following: my_source.c mktemp() { ... } main() { mktemp(); getwd(); } libc mktemp(){ ... } getwd(){ ...; mktemp(); ... } According to the book, what happens in main() is that mktemp() (a standard C library function) is interposed by the implementation in my_source.c. Although having main() call my implementation of mktemp() is intended behavior, having getwd() (another C library function) also call my implementation of mktemp() is not. Apparently, this example was a real life bug that existed in SunOS 4.0.3's version of lpr. The book goes on to explain the fix was to add the keyword static to the definition of mktemp() in my_source.c; although changing the name altogether should have fixed this problem as well. This chapter leaves me with some unresolved questions that I hope you guys could answer: Should our software group adopt the practice of putting the keyword static in front of all functions that we don't want to be exposed? Does GCC have a way to warn about function interposition? We certainly don't ever intend on this happening and I'd like to know about it if it does. Can interposition happen with functions introduced by static libraries? Thanks for the help.

    Read the article

  • Checking if a function has C-linkage at compile-time

    - by scjohnno
    Is there any way to check if a given function is declared with C-linkage (that is, with extern "C") at compile-time? I am developing a plugin system. Each plugin can supply factory functions to the plugin-loading code. However, this has to be done via name (and subsequent use of GetProcAddress or dlsym). This requires that the functions be declared with C-linkage so as to prevent name-mangling. It would be nice to be able to throw a compiler error if the referred-to function is declared with C++-linkage (as opposed to finding out at runtime when a function with that name does not exist). Here's a simplified example of what I mean: extern "C" void my_func() { } void my_other_func() { } // Replace this struct with one that actually works template<typename T> struct is_c_linkage { static const bool value = true; }; template<typename T> void assertCLinkage(T *func) { static_assert(is_c_linkage<T>::value, "Supplied function does not have C-linkage"); } int main() { assertCLinkage(my_func); // Should compile assertCLinkage(my_other_func); // Should NOT compile } Thanks.

    Read the article

  • NHibernate + Cannot insert the value NULL into...

    - by mybrokengnome
    I've got a MS-SQL database with a table created with this code CREATE TABLE [dbo].[portfoliomanager]( [idPortfolioManager] [int] NOT NULL PRIMARY KEY IDENTITY, [name] [varchar](45) NULL ) so that idPortfolioManager is my primary key and also auto-incrementing. Now on my Windows WPF application I'm using NHibernate to help with adding/updating/removing/etc. data from the database. Here is the class that should be connecting to the portfoliomanager table namespace PortfolioManager { [Class(Table="portfoliomanager",NameType=typeof(PortfolioManagerClass))] public class PortfolioManagerClass { [Id(Name = "idPortfolioManager")] [Generator(1, Class = "identity")] public virtual int idPortfolioManager { get; set; } [NHibernate.Mapping.Attributes.Property(Name = "name")] public virtual string name { get; set; } public PortfolioManagerClass() { } } } and some short code to try and insert something PortfolioManagerClass portfolio = new PortfolioManagerClass(); Portfolio.name = "Brad's Portfolios"; The problem is, when I try running this, I get this error: {System.Data.SqlClient.SqlException: Cannot insert the value NULL into column 'idPortfolioManager', table 'PortfolioManagementSystem.dbo.portfoliomanager'; column does not allow nulls. INSERT fails. The statement has been terminated... with an outer exception of {"could not insert: [PortfolioManager.PortfolioManagerClass][SQL: INSERT INTO portfoliomanager (name) VALUES (?); select SCOPE_IDENTITY()]"} I'm hoping this is the last error I'll have to solve with NHibernate just to get it to do something, it's been a long process. Just as a note, I've also tried setting Class="native" and unsaved-value="0" with the same error. Thanks! Edit: Ok removing the 1, from Generator actually allows the program to run (not sure why that was even in the samples I was looking at) but it actually doesn't get added to the database. I logged in to the server and ran the sql server profiler tool and I never see the connection coming through or the SQL its trying to run, but NHibernate isn't throwing an error anymore. Starting to think it would be easier to just write SQL statements myself :(

    Read the article

< Previous Page | 303 304 305 306 307 308 309 310 311 312 313 314  | Next Page >