Search Results

Search found 8258 results on 331 pages for 'sequence points'.

Page 308/331 | < Previous Page | 304 305 306 307 308 309 310 311 312 313 314 315  | Next Page >

  • Multi-threaded Pooled Allocators

    - by Darren Engwirda
    I'm having some issues using pooled memory allocators for std::list objects in a multi-threaded application. The part of the code I'm concerned with runs each thread function in isolation (i.e. there is no communication or synchronization between threads) and therefore I'd like to setup separate memory pools for each thread, where each pool is not thread-safe (and hence fast). I've tried using a shared thread-safe singleton memory pool and found the performance to be poor, as expected. This is a heavily simplified version of the type of thing I'm trying to do. A lot has been included in a pseudo-code kind of way, sorry if it's confusing. /* The thread functor - one instance of MAKE_QUADTREE created for each thread */ class make_quadtree { private: /* A non-thread-safe memory pool for int linked list items, let's say that it's * something along the lines of BOOST::OBJECT_POOL */ pooled_allocator<int> item_pool; /* The problem! - a local class that would be constructed within each std::list as the * allocator but really just delegates to ITEM_POOL */ class local_alloc { public : //!! I understand that I can't access ITEM_POOL from within a nested class like //!! this, that's really my question - can I get something along these lines to //!! work?? pointer allocate (size_t n) { return ( item_pool.allocate(n) ); } }; public : make_quadtree (): item_pool() // only construct 1 instance of ITEM_POOL per // MAKE_QUADTREE object { /* The kind of data structures - vectors of linked lists * The idea is that all of the linked lists should share a local pooled allocator */ std::vector<std::list<int, local_alloc>> lists; /* The actual operations - too complicated to show, but in general: * * - The vector LISTS is grown as a quadtree is built, it's size is the number of * quadtree "boxes" * * - Each element of LISTS (each linked list) represents the ID's of items * contained within each quadtree box (say they're xy points), as the quadtree * is grown a lot of ID pop/push-ing between lists occurs, hence the memory pool * is important for performance */ } }; So really my problem is that I'd like to have one memory pool instance per thread functor instance, but within each thread functor share the pool between multiple std::list objects.

    Read the article

  • Optimizing Vector elements swaps using CUDA

    - by Orion Nebula
    Hi all, Since I am new to cuda .. I need your kind help I have this long vector, for each group of 24 elements, I need to do the following: for the first 12 elements, the even numbered elements are multiplied by -1, for the second 12 elements, the odd numbered elements are multiplied by -1 then the following swap takes place: Graph: because I don't yet have enough points, I couldn't post the image so here it is: http://www.freeimagehosting.net/image.php?e4b88fb666.png I have written this piece of code, and wonder if you could help me further optimize it to solve for divergence or bank conflicts .. //subvector is a multiple of 24, Mds and Nds are shared memory _shared_ double Mds[subVector]; _shared_ double Nds[subVector]; int tx = threadIdx.x; int tx_mod = tx ^ 0x0001; int basex = __umul24(blockDim.x, blockIdx.x); Mds[tx] = M.elements[basex + tx]; __syncthreads(); // flip the signs if (tx < (tx/24)*24 + 12) { //if < 12 and even if ((tx & 0x0001)==0) Mds[tx] = -Mds[tx]; } else if (tx < (tx/24)*24 + 24) { //if >12 and < 24 and odd if ((tx & 0x0001)==1) Mds[tx] = -Mds[tx]; } __syncthreads(); if (tx < (tx/24)*24 + 6) { //for the first 6 elements .. swap with last six in the 24elements group (see graph) Nds[tx] = Mds[tx_mod + 18]; Mds [tx_mod + 18] = Mds [tx]; Mds[tx] = Nds[tx]; } else if (tx < (tx/24)*24 + 12) { // for the second 6 elements .. swp with next adjacent group (see graph) Nds[tx] = Mds[tx_mod + 6]; Mds [tx_mod + 6] = Mds [tx]; Mds[tx] = Nds[tx]; } __syncthreads(); Thanks in advance ..

    Read the article

  • Correlation formula explanation needed d3.js

    - by divakar
    function getCorrelation(xArray, yArray) { alert(xArray); alert(yArray); function sum(m, v) {return m + v;} function sumSquares(m, v) {return m + v * v;} function filterNaN(m, v, i) {isNaN(v) ? null : m.push(i); return m;} // clean the data (because we know that some values are missing) var xNaN = _.reduce(xArray, filterNaN , []); var yNaN = _.reduce(yArray, filterNaN , []); var include = _.intersection(xNaN, yNaN); var fX = _.map(include, function(d) {return xArray[d];}); var fY = _.map(include, function(d) {return yArray[d];}); var sumX = _.reduce(fX, sum, 0); var sumY = _.reduce(fY, sum, 0); var sumX2 = _.reduce(fX, sumSquares, 0); var sumY2 = _.reduce(fY, sumSquares, 0); var sumXY = _.reduce(fX, function(m, v, i) {return m + v * fY[i];}, 0); var n = fX.length; var ntor = ( ( sumXY ) - ( sumX * sumY / n) ); var dtorX = sumX2 - ( sumX * sumX / n); var dtorY = sumY2 - ( sumY * sumY / n); var r = ntor / (Math.sqrt( dtorX * dtorY )); // Pearson ( http://www.stat.wmich.edu/s216/book/node122.html ) var m = ntor / dtorX; // y = mx + b var b = ( sumY - m * sumX ) / n; // console.log(r, m, b); return {r: r, m: m, b: b}; } I have finding correlation between the points i plot using this function which is not written by me. my xarray=[120,110,130,132,120,118,134,105,120,0,0,0,0,137,125,120,127,120,160,120,148] yarray=[80,70,70,80,70,62,69,70,70,62,90,42,80,72,0,0,0,0,78,82,68,60,58,82,60,76,86,82,70] I can t able to understand the function perfectly. Can anybody explain it with the data i pasted here. I also wanted to remove the zeros getting calculated from this function.

    Read the article

  • Intent filter for browsing XML (specifically rss) in android

    - by Leif Andersen
    I have an activity that I want to run every time the user goes to an xml (specifically rss) page in the browser (at least assuming the user get's it from the list of apps that can support it). I currently already have the current intent filter: <activity android:name=".activities.EpisodesListActivity" android:theme="@android:style/Theme.NoTitleBar"> <intent-filter> <category android:name="android.intent.category.BROWSABLE"></category> <category android:name="android.intent.category.DEFAULT"></category> <action android:name="android.intent.action.VIEW"></action> <data android:scheme="http"></data> </intent-filter> </activity> Now as you can guess, this is an evil intent, as it wants to open whenever a page is requested via http. However, when I ad the line: <data android:mimeType="application/rss+xml"></data> to make it: <activity android:name=".activities.EpisodesListActivity" android:theme="@android:style/Theme.NoTitleBar"> <intent-filter> <category android:name="android.intent.category.BROWSABLE"></category> <category android:name="android.intent.category.DEFAULT"></category> <action android:name="android.intent.action.VIEW"></action> <data android:scheme="http"></data> <data android:mimeType="application/rss+xml"></data> </intent-filter> </activity> The application no longer claims to be able to run rss files. Also, if I change the line to: <data android:mimeType="application/xml"></data> It also won't work (for generic xml file even). So what intent filter do I need to make in order to claim that the activity supports rss. (Also, bonus points if you can tell me how I know what URL it was the user opened. So far, I've always sent that information from one activity to the other using extras). Thank you for your help

    Read the article

  • Changing Data in ListView

    - by legr3c
    Hi In my app I use a ListView to display data from the database. The data changes sometimes, for example when the user applies new filters or changes the sorting method. I use AsyncTask to get the databsase cursor that points to the new data set because sometimes data needs to be loaded from the net which can take some time. What I do now looks something like this: private class updateTask extends AsyncTask<Void, Void, Void> { /* * runs on the UI thread before doInBackground */ @Override protected void onPreExecute(){ // prepare some stuff... } /* * runs in a separate thread * used for time-consuming loading operation */ @Override protected Void doInBackground() { //get new database cursor mCursor = mDbAdapter.getCursor(); return null; } /* * runs on the UI thread after doInBackground */ @Override protected void onPostExecute(Void result){ if(mCursor!=null){ MyActivity.this.startManagingCursor(mCursor); mCursorAdapter = new MyCustomCursorAdapter(MyActivity.this, mCursor); mListView.setAdapter(mCursorAdapter); } } } This works so far but I realize that creating a new CursorAdapter and calling setAdapter on my ListView each time isn't the correct way to do it. Also, after setAdapter the scroll position of the list is set back to the top. I found this post which describes how to do it properly. So now I want to do something like this: onCreate(){ // ... // create the CursorAdapter using null as the initial cursor MyCustomCursorAdapter cursorAdapter = new MyCustomCursorAdapter(this, null); mListView.setAdapter(cursorAdapter); // ... } private class updateTask extends AsyncTask<Void, Void, Void> { /* * runs on the UI thread before doInBackground */ @Override protected void onPreExecute(){ // prepare some stuff... } /* * runs in a separate thread * used for time-consuming loading operation */ @Override protected Void doInBackground() { //get new database cursor mCursor = mDbAdapter.getCursor(); return null; } /* * runs on the UI thread after doInBackground */ @Override protected void onPostExecute(Void result){ // this returns null! MyCustomCursorAdapter cursorAdapter = (MyCustomCursorAdapter)mListView.getAdapter(); Cursor oldCursor = cursorAdapter.getCursor(); if(oldCursor!=null){ MyActivity.this.stopManagingCursor(oldCursor); oldCursor.close(); } if(mCursor!=null){ MyActivity.this.startManagingCursor(mCursor); cursorAdapter.changeCursor(mCursor); } } } This however doesn't work for me because (MyCustomCursorAdapter)mListView.getAdapter(); always returns null. Why does this happen? What am I doing wrong? Edit: Some additional information: my adapter implements SectionIndexer. I don't really think that this has anything to do with my problem but it has caused me some troubles before so I thought I'd mention it.

    Read the article

  • What alternatives do I have for source control and does GIT does that?

    - by RubberDuck
    I work as a freelancer programmer for some clients and also create apps for myself. When I work for myself, obviously I work alone. I generally don't work in a linear way. My big problems today are: I have a lot of apps that use the same classes I have developed; In the past, I put all these common classes on a directory outside all projects and included them on my apps using absolute paths, but this method sucks because by accident (if you forget) you may change a path or the disk and all projects are broken. Then I decided to copy those classes to my projects every time. Because the majority of these classes do not change frequently, I am relatively ok, but when they change, I am in hell; When I change one of these classes I have to propagate the changes to all other apps using copies of them. I have also tried to create frameworks but thanks to Apple, I cannot create frameworks for iOS and have to create libraries and bundles and create a nightmare of paths from one to the other and to the project to make that sh!t works. So, I am done with frameworks/libraries on Xcode until Xcode is a decent IDE. So, I see I need something better to manage my source code. What I need is this (I never used GIT on Xcode. I have read Apple docs but I still have these points): does git locally on Xcode allows me to deal with assets or just code? Can I have the equivalent of a "framework" (code + assets) managed by git locally? Can an entire xcodeproj be managed as a unity? I mean, Suppose I have a xcodeproj created and want GIT to manage it. How do I enable git on a project that was created without it and start designating files for management. (I have enabled git on Xcode's preferences, but all source control menu is grayed out). Is git the best option? Do I have another? Remember that my main condition is that the files should stay on the local computer. Please save me (I am a bit dramatic today). Thanks.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • WPF ClickOnce Bootstrap Dection Failure on One Machine

    - by Dexter Morgan
    Hello Friend, I've decided to use ClickOnce technology to deploy my new WPF application. By and large, ClickOnce works as advertised but I've hit a minor glitch regarding Bootstrapping and framework detection. Some background: - I'm using the standard Visual Studio-generated publish.htm page as my launch page. - The only prerequisite is the .NET Framework 4.0 Client Profile. - All clients using IE 8. - All clients already have the .NET 4.0 Client Profile installed. ClickOnce works as advertised on the vast majority of machines. The VS-generated JScript correctly detects that the framework is installed and presents the user with a Run button. The app launches just fine. I'm getting odd results on one of the machines, however. On the offending machine, the VS-generated JScript tells the user that the prereqs may not be installed -- or rather, it FAILS to detect that the framework is already installed. The "launch" link successfully launches the application but the Run link points to the bootstrapper setup.exe. Why is it failing to detect the framework on this one machine? It occurred to me that framework detection is largely a matter of examining the useragent string that's submitted by the browser. So, what you see below are two UserAgent strings. The first is from a machine where things are working properly. The second is from the offending machine. THIS ONE WORKS: 2011-01-11 15:14:14 W3SVC1 192.168.0.36 GET /publish.htm - 80 - 72.130.187.100 Mozilla/4.0+(compatible;+MSIE+8.0;+Windows+NT+6.0;+Trident/4.0;+SLCC1;+.NET+CLR+2.0.50727;+Media+Center+PC+5.0;+.NET+CLR+3.5.21022;+.NET+CLR+3.5.30729;+.NET+CLR+3.0.30729;+.NET4.0C) 304 0 0 THIS ONE DOESN'T: 2011-01-11 18:49:12 W3SVC1 192.168.0.36 GET /publish.htm - 80 - 76.212.204.169 Mozilla/4.0+(compatible;+MSIE+8.0;+Windows+NT+6.1;+WOW64;+Trident/4.0;+GTB6.6;+SLCC2;+.NET+CLR+2.0.50727;+.NET+CLR+3.5.30729;+.NET+CLR+3.0.30729;+Media+Center+PC+6.0;+.NET4.0C) 200 0 0 The useragent string of both machines clearly states, "hey the .NET 4.0 client profile is installed here" -- yet the second machine seems unable to detect it. I don't know enough about useragent strings to understand why the former works and the latter fails. The only difference as far as I can tell is that the offending machine is running 64bit. But that shouldn't make a difference. Should it? Any ideas? Dexter Morgan

    Read the article

  • git: setting a single tracking remote from a public repo.

    - by Gauthier
    I am confused with remote branches. My local repo: (local) ---A---B---C-master My remote repo (called int): (int) ---A---B---C---D---E-master What I want to do is to setup the local repo's master branch to follow that of int. Local repo: (local) ---A---B---C---D---E-master-remotes/int/master So that when int changes to: (int) ---A---B---C---D---E---F-master I can run git pull from the local repo's master and get (local) ---A---B---C---D---E---F-master-remotes/int/master Here's what I have tried: git fetch int gets me all the branches of int into remote branches. This can get messy since int might have hundreds of branches. git fetch int master gets me the commits, but no ref to it, only FETCH_HEAD. No remote branch either. git fetch int master:new_master works but I don't want a new name every time I update, and no remote branch is setup. git pull int master does what I want, but there is still no remote branch setup. I feel that it is ok to do so (that's the best I have now), but I read here and there that with the remote setup it is enough with git pull. git branch --track new_master int/master, as per http://www.gitready.com/beginner/2009/03/09/remote-tracking-branches.html . I get "not a valid object name: int/master". git remote -v does show me that int is defined and points at the correct location (1. worked). What I miss is the int/master branch, which is precisely what I want to get. git fetch in master:int/master. Well, int/master is created, but is no remote. So to summarize, I've tried some stuff with no luck. I would expect 2 to give me the remote branch to master in the repo int. The solution I use now is option 3. I read somewhere that you could change some config file by hand, but isn't that a bit cumbersome? The "cumbersome" way of editting the config file did work: [branch "master"] remote = int merge = master It can be done from command line: $ git config branch.master.remote int $ git config branch.master.merge master Any reason why option 2 above wouldn't do that automatically? Even in that case, git pull fetches all branches from the remote.

    Read the article

  • Applying Unity in dynamic menu

    - by Rajarshi
    I was going through Unity 2.0 to check if it has an effective use in our new application. My application is a Windows Forms application and uses a traditional bar menu (at the top), currently. My UIs (Windows Forms) more or less support Dependency Injection pattern since they all work with a class (Presentation Model Class) supplied to them via the constructor. The form then binds to the properties of the supplied P Model class and calls methods on the P Model class to perform its duties. Pretty simple and straightforward. How P Model reacts to the UI actions and responds to them by co-ordinating with the Domain Class (Business Logic/Model) is irrelevant here and thus not mentioned. The object creation sequence to show up one UI from menu then goes like this - Create Business Model instance Create Presentation Model instance with Business Model instance passed to P Model constructor. Create UI instance with Presentation Model instance passed to UI constructor. My present solution: To show an UI in the method above from my menu I would have to refer all assemblies (Business, PModel, UI) from my Menu class. Considering I have split the modules into a number of physical assemblies, that would be a dificult task to add references to about 60 different assemblies. Also the approach is not very scalable since I would certainly need to release more modules and with this approach I would have to change the source code every time I release a new module. So primarily to avoid the reference of so many assemblies from my Menu class (assembly) I did as below - Stored all the dependency described above in a database table (SQL Server), e.g. ModuleShortCode | BModelAssembly | BModelFullTypeName | PModelAssembly | PModelFullTypeName | UIAssembly | UIFullTypeName Now used a static class named "Launcher" with a method "Launch" as below - Launcher.Launch("Discount") Launcher.Launch("Customers") The Launcher internally uses data from the dependency table and uses Activator.CreateInstance() to create each of the objects and uses the instance as constructor parameter to the next object being created, till the UI is built. The UI is then shown as a modal dialog. The code inside Launcher is somewhat like - Form frm = ResolveForm("Discount"); frm.ShowDialog(); The ResolveForm does the trick of building the chain of objects. Can Unity help me here? Now when I did that I did not have enough information on Unity and now that I have studied Unity I think I have been doing more or less the same thing. So I tried to replace my code with Unity. However, as soon as I started I hit a block. If I try to resolve UI forms in my Menu as Form customers = myUnityContainer.Resolve(); or Form customers = myUnityContainer.Resolve(typeof(Customers)); Then either way, I need to refer to my UI assembly from my Menu assembly since the target Type "Customers" need to be known for Unity to resolve it. So I am back to same place since I would have to refer all UI assemblies from the Menu assembly. I understand that with Unity I would have to refer fewer assemblies (only UI assemblies) but those references are needed which defeats my objectives below - Create the chain of objects dynamically without any assembly reference from Menu assembly. This is to avoid Menu source code changing every time I release a new module. My Menu also is built dynamically from a table. Be able to supply new modules just by supplying the new assemblies and inserting the new Dependency row in the table by a database patch. At this stage, I have a feeling that I have to do it the way I was doing, i.e. Activator.CreateInstance() to fulfil all my objectives. I need to verify whether the community thinks the same way as me or have a better suggestion to solve the problem. The post is really long and I sincerely thank you if you come til this point. Waiting for your valuable suggestions. Rajarshi

    Read the article

  • SQL Server architecture guidance

    - by Liam
    Hi, We are designing a new version of our existing product on a new schema. Its an internal web application with possibly 100 concurrent users (max)This will run on a SQL Server 2008 database. On of the discussion items recently is whether we should have a single database of split the database for performance reasons across 2 separate databases. The database could grow anywhere from 50-100GB over 5 years. We are Developers and not DBAs so it would be nice to get some general guidance. [I know the answer is not simple as it depends on the schema, archiving policy, amount of data etc. ] Option 1 Single Main Database [This is my preferred option]. The plan would be to have all the tables in a single database and possibly to use file groups and partitioning to separate the data if required across multiple disks. [Use schema if appropriate]. This should deal with the performance concerns One of the comments wrt this was that the a single server instance would still be processing this data so there would still be a processing bottle neck. For reporting we could have a separate reporting DB but this is still being discussed. Option 2 Split the database into 2 separate databases DB1 - Customers, Accounts, Customer resources etc DB2 - This would contain the bulk of the data [i.e. Vehicle tracking data, financial transaction tables etc]. These tables would typically contain a lot of data. [It could reside on a separate server if required] This plan would involve keeping the main data in a smaller database [DB1] and retaining the [mainly] read only transaction type data in a separate DB [DB2]. The UI would mainly read from DB1 and thus be more responsive. [I'm aware that this option makes it harder for Referential Integrity to be enforced.] Points for consideration As we are at the design stage we can at least make proper use of indexes to deal performance issues so thats why option 1 to me is attractive and its more of a standard approach. For both options we are considering implementing an archiving database. Apologies for the long Question. In summary the question is 1 DB or 2? Thanks in advance, Liam

    Read the article

  • grdb not working variables

    - by stupid_idiot
    hi, i know this is kinda retarded but I just can't figure it out. I'm debugging this: xor eax,eax mov ah,[var1] mov al,[var2] call addition stop: jmp stop var1: db 5 var2: db 6 addition: add ah,al ret the numbers that I find on addresses var1 and var2 are 0x0E and 0x07. I know it's not segmented, but that ain't reason for it to do such escapades, because the addition call works just fine. Could you please explain to me where is my mistake? I see the problem, dunno how to fix it yet though. The thing is, for some reason the instruction pointer starts at 0x100 and all the segment registers at 0x1628. To address the instruction the used combination is i guess [cs:ip] (one of the segment registers and the instruction pointer for sure). The offset to var1 is 0x10 (probably because from the begining of the code it's the 0x10th byte in order), i tried to examine the memory and what i got was: 1628:100 8 bytes 1628:108 8 bytes 1628:110 <- wtf? (assume another 8 bytes) 1628:118 ... whatever tricks are there in the memory [cs:var1] points somewhere else than in my code, which is probably where the label .data would usually address ds.... probably.. i don't know what is supposed to be at 1628:10 ok, i found out what caused the assness and wasted me whole fuckin day. the behaviour described above is just correct, the code is fully functional. what i didn't know is that grdb debugger for some reason sets the begining address to 0x100... the sollution is to insert the directive ORG 0x100 on the first line and that's the whole thing. the code was working because instruction pointer has the right address to first instruction and goes one by one, but your assembler doesn't know what effective address will be your program stored at so it pretty much remains relative to first line of the code which means all the variables (if not using label for data section) will remain pointing as if it started at 0x0. which of course wouldn't work with DOS. and grdb apparently emulates some DOS features... sry for the language, thx everyone for effort, hope this will spare someone's time if having the same problem... heheh.. at least now i know the reason why to use .data section :))))

    Read the article

  • How do I learn algorithms?

    - by Panthe
    Brief History: Just graduated high school, learned a bit of python and C++, have no friends with any helpful computer knowledge at all. Out of anyone i met in my school years I was probably the biggest nerd, but no one really knew. I consider my self to have a vast amount of knowledge on computers and tech then the average person. built/fixed tons of computers, and ability to troubleshoot pretty much any problem I came across. Now that high school is over, Ive really been thinking about my career. Loving, living computers for the past 15 years of my life I decided to take my ability's and try to learn computer programming, why I didn't start earlier I don't know, seems to be big mistake on my part... Doing some research I concluded that Python was the first programming language I should learn, since it was high level and easier to understand then C++ and Java. I also knew that to become good at what I did I needed to know more then just 2 or 3 languages, which didn't seem like a big problem considering once I learned the way Python worked, mainly syntax changed, and the rest would come naturally. I watched a couple of youtube videos, downloaded some book pdf's and snooped around from some tutorials here and there to get the hang of what to do. A two solid weeks had passed of trying to understand the syntax, create small programs that used the basic functions and understanding how it worked, I think i have got the hang of it. It breaks down into what ive been dealing with all this time (although i kinda knew) is that, input,output, loops, functions and other things derived from 0's and 1's storing data and recalling it, ect. (A VERY BASIC IDEA). Ive been able to create small programs, Hangman, file storing, temperature conversion, Caeser Cipher decode/encoding, Fibonacci Sequence and more, which i can create and understand how each work. Being 2 weeks into this, I have learned alot. Nothing at all compared to what i should be lear ning in the years to come if i get a grip on what I'm doing. While doing these programs I wont stop untill I've done doing a practice problem on a book, which embarresing enough will take me a couple hour depending on the complexity of it. I absolutly will not put aside the challenge until its complete, WHICH CAN BE EXTREMELY DRAINING, ive tried most problems without cheating and reached success, which makes me feel extremely proud of my self after completing something after much trial and error. After all this I have met the demon, alogrithm's which seem to be key to effiecent code. I cant seem to rap my head around some of the computer codes people put out there using numbers, and sometimes even basic functions, I have been able to understand them after a while but i know there are alot more complex things to come, considering my self smart, functions that require complex codes, actually hurt my brain. NOTHING EVER IN LIFE HURT MY BRAIN....... not even math classes in highschool, trying to understand some of the stuff people put out there makes me feel like i have a mental disadvantage lol... i still walk forward though, crossing my fingers that the understanding will come with time. Sorry if is this is long i just wish someone takes all these things into consideration when answering my question. even through all these downsides im still pushing through and continuing to try and get good at this, i know reading these tutorials wont make me any good unless i can become creative and make my own, understand other peoples programs, so this leads me to the simple question i could have asked in the beginning..... WHERE IN THE WORLD DO I START ? Ive been trying to find out how to understand some of the open source projects, how i can work with experianced coders to learn from them and help them, but i dont think thats even possible by the way how far people's knowledge is compared to me, i have no freinds who i can learn from, can someone help me and guide me into the right direction.. i have a huge motivation to get good at coding, anything information would be extremely helpful

    Read the article

  • What regular expression(s) would I use to remove escaped html from large sets of data.

    - by Elizabeth Buckwalter
    Our database is filled with articles retrieved from RSS feeds. I was unsure of what data I would be getting, and how much filtering was already setup (WP-O-Matic Wordpress plugin using the SimplePie library). This plugin does some basic encoding before insertion using Wordpress's built in post insert function which also does some filtering. I've figured out most of the filters before insertion, but now I have whacko data that I need to remove. This is an example of whacko data that I have data in one field which the content I want in the front, but this part removed which is at the end: <img src="http://feeds.feedburner.com/~ff/SoundOnTheSound?i=xFxEpT2Add0:xFbIkwGc-fk:V_sGLiPBpWU" border="0"></img> <img src="http://feeds.feedburner.com/~ff/SoundOnTheSound?d=qj6IDK7rITs" border="0"></img> &lt;img src=&quot;http://feeds.feedburner.com/~ff/SoundOnTheSound?i=xFxEpT2Add0:xFbIkwGc-fk:D7DqB2pKExk&quot; Notice how some of the images are escape and some aren't. I believe this has to do with the last part being cut off so as to be unrecognizable as an html tag, which then caused it to be html endcoded. Another field has only this which is now filtered before insertion, but I have to get rid of the others: &lt;img src=&quot;http://farm3.static.flickr.com/2183/2289902369_1d95bcdb85.jpg&quot; alt=&quot;post_img&quot; width=&quot;80&quot; (all examples are on one line, but broken up for readability) Question: What is the best way to work with the above escaped html (or portion of an html tag)? I can do it in Perl, PHP, SQL, Ruby, and even Python. I believe Perl to be the best at text parsing, so that's why I used the Perl tag. And PHP times out on large database operations, so that's pretty much out unless I wanted to do batch processing and what not. PS One of the nice things about using Wordpress's insert post function, is that if you use php's strip_tags function to strip out all html, insert post function will insert <p> at the paragraph points. Let me know if there's anything more that I can answer. Some article that didn't quite answer my questions. (http://stackoverflow.com/questions/2016751/remove-text-from-within-a-database-text-field) (http://stackoverflow.com/questions/462831/regular-expression-to-escape-html-ampersands-while-respecting-cdata)

    Read the article

  • Using Selenium-IDE with a rich Javascript application?

    - by Darien
    Problem At my workplace, we're trying to find the best way to create automated-tests for an almost wholly javascript-driven intranet application. Right now we're stuck trying to find a good tradeoff between: Application code in reusable and nest-able GUI components. Tests which are easily created by the testing team Tests which can be recorded once and then automated Tests which do not break after small cosmetic changes to the site XPath expressions (or other possible expressions, like jQuery selectors) naively generated from Selenium-IDE are often non-repeatable and very fragile. Conversely, having the JS code generate special unique ID values for every important DOM-element on the page... well, that is its own headache, complicated by re-usable GUI components and IDs needing to be consistent when the test is re-run. What successes have other people had with this kind of thing? How do you do automated application-level testing of a rich JS interface? Limitations We are using JavascriptMVC 2.0, hopefully 3.0 soon so that we can upgrade to jQuery 1.4.x. The test-making folks are mostly trained to use Selenium IDE to directly record things. The test leads would prefer a page-unique HTML ID on each clickable element on the page... Training the testers to write or alter special expressions (such as telling them which HTML class-names are important branching points) is a no-go. We try to make re-usable javascript components, but this means very few GUI components can treat themselves (or what they contain) as unique. Some of our components already use HTML ID values in their operation. I'd like to avoid doing this anyway, but it complicates the idea of ID-based testing. It may be possible to add custom facilities (like a locator-builder or new locator method) to the Selenium-IDE installation testers use. Almost everything that goes on occurs within a single "page load" from a conventional browser perspective, even when items are saved Current thoughts I'm considering a system where a custom locator-builder (javascript code) for Selenium-IDE will talk with our application code as the tester is recording. In this way, our application becomes partially responsible for generating a mostly-flexible expression (XPath or jQuery) for any given DOM element. While this can avoid requiring more training for testers, I worry it may be over-thinking things.

    Read the article

  • Representing xml through a single class

    - by Charles
    I am trying to abstract away the difficulties of configuring an application that we use. This application takes a xml configuration file and it can be a bit bothersome to manually edit this file, especially when we are trying to setup some automatic testing scenarios. I am finding that reading xml is nice, pretty easy, you get a network of element nodes that you can just go through and build your structures quite nicely. However I am slowly finding that the reverse is not quite so nice. I want to be able to build a xml configuration file through a single easy to use interface and because xml is composed of a system of nodes I am having a lot of struggle trying to maintain the 'easy' part. Does anyone know of any examples or samples that easily and intuitively build xml files without declaring a bunch of element type classes and expect the user to build the network themselves? For example if my desired xml output is like so <cook version="1.1"> <recipe name="chocolate chip cookie"> <ingredients> <ingredient name="flour" amount="2" units="cups"/> <ingredient name="eggs" amount="2" units="" /> <ingredient name="cooking chocolate" amount="5" units="cups" /> </ingredients> <directions> <direction name="step 1">Preheat oven</direction> <direction name="step 2">Mix flour, egg, and chocolate</direction> <direction name="step 2">bake</direction> </directions> </recipe> <recipe name="hot dog"> ... How would I go about designing a class to build that network of elements and make one easy to use interface for creating recipes? Right now I have a recipe object, an ingredient object, and a direction object. The user must make each one, set the attributes in the class and attach them to the root object which assembles the xml elements and outputs the formatted xml. Its not very pretty and I just know there has to be a better way. I am using python so bonus points for pythonic solutions

    Read the article

  • In R, how do you get the best fitting equation to a set of data?

    - by Matherion
    I'm not sure wether R can do this (I assume it can, but maybe that's just because I tend to assume that R can do anything :-)). What I need is to find the best fitting equation to describe a dataset. For example, if you have these points: df = data.frame(x = c(1, 5, 10, 25, 50, 100), y = c(100, 75, 50, 40, 30, 25)) How do you get the best fitting equation? I know that you can get the best fitting curve with: plot(loess(df$y ~ df$x)) But as I understood you can't extract the equation, see Loess Fit and Resulting Equation. When I try to build it myself (note, I'm not a mathematician, so this is probably not the ideal approach :-)), I end up with smth like: y.predicted = 12.71 + ( 95 / (( (1 + df$x) ^ .5 ) / 1.3)) Which kind of seems to approximate it - but I can't help to think that smth more elegant probably exists :-) I have the feeling that fitting a linear or polynomial model also wouldn't work, because the formula seems different from what those models generally use (i.e. this one seems to need divisions, powers, etc). For example, the approach in Fitting polynomial model to data in R gives pretty bad approximations. I remember from a long time ago that there exist languages (Matlab may be one of them?) that do this kind of stuff. Can R do this as well, or am I just at the wrong place? (Background info: basically, what we need to do is find an equation for determining numbers in the second column based on the numbers in the first column; but we decide the numbers ourselves. We have an idea of how we want the curve to look like, but we can adjust these numbers to an equation if we get a better fit. It's about the pricing for a product (a cheaper alternative to current expensive software for qualitative data analysis); the more 'project credits' you buy, the cheaper it should become. Rather than forcing people to buy a given number (i.e. 5 or 10 or 25), it would be nicer to have a formula so people can buy exactly what they need - but of course this requires a formula. We have an idea for some prices we think are ok, but now we need to translate this into an equation.

    Read the article

  • Different meaning in the mysql code?

    - by Emre Saracoglu
    $result=mysql_query("select * from dosyabegeni where veri_id='" . get_custom_field('dwcode') . "'"); Not Working It says the number and the screen, but the application does not work veri_id='" . get_custom_field('dwcode') . "'"); veri_id='" . echo get_custom_field('dwcode') . "'"); Working veri_id='HelloTest'"); veri_id='1234567890'"); veri_id='" . $_GET['test'] . "'"); Main Codes <?php include('/home/emre2010/public_html/EntegreOz/DosyaBegeni/config.php'); $result=mysql_query("select * from dosyabegeni where veri_id='" .get_custom_field('dwcode') . "'"); while($row = mysql_fetch_array($result)) { $sira_id=$row['sira_id']; $veri_id=$row['veri_id']; $begeni=$row['begeni']; ?> <div class="reviewbox"> <div class="summarywrap"> <div class="summarywrapinner"> <div class="summary"> <div class="reviewsection"><div class="rating points"> <a href="#" class="begeni" id="<?php echo $sira_id; ?>"> <span style="color:#fff;" align="center"> <?php echo $begeni; ?> </span> </a> <p class="ratingtext">completed!</p></div> </div><div class="clear"></div> <div class="clear"></div> </div> <div class="ratingsummary"></div> <div class="clear"></div> </div> <div class="clear"></div> </div> What's the problem?

    Read the article

  • Java: Is there a way to efficiently insert or remove many elements from the middle of a LinkedList?

    - by allyourcode
    I was expecting to find this in Java's LinkedList, since the point of linked lists is to be able to efficiently insert (and remove) anywhere (assuming you have some kind of pointer to the location where you want to insert or remove). I'm not finding anything in the API though. Am I overlooking something? The closest thing I can find to this are the add and remove method in ListIterator. This has some limitations though. In particular, other iterators become invalid as soon as the underlying LinkedList is modified via remove, according to the API. This is born out in my tests as well; the following program results in a IllegalStateException: import java.util.*; public class RemoveFromLinkedList { public static void main(String[] args) { LinkedList<Integer> myList= new LinkedList<Integer>(); for (int i = 0; i < 10; ++i) { myList.add(i); } ListIterator<Integer> i1 = myList.listIterator(); ListIterator<Integer> i2 = myList.listIterator(); for (int i = 0; i < 3; ++i) { i1.next(); i2.next(); } System.out.println("i1.next() should be 3: " + i1.next()); i1.remove(); i1.remove(); // Exception! System.out.println("i2.next() should be 5: " + i2.next()); } } Ideally, what I'm expecting is something like this: // In my imagination only. This is the way Java actually works, afaict. // Construct two insertion/deletion points in LinkedList myLinkedList. myIterator = myLinkedList.iterator(); for (...) { myIterator.next(); } start = myIterator.clone(); for (...) { myIterator.next(); } // Later... after = myLinkedList.spliceAfter(myIterator, someOtherLinkedList); // start, myIterator, and after are still all valid; thus, I can do this: // Removes everything I just spliced in, as well as some other stuff before that. myLinkedList.remove(start, after); // Now, myIterator is invalid, but not start, nor after. C++ has something like this for its list class (template). Only iterators pointing to moved elements become invalidated, not ALL iterators.

    Read the article

  • Sqlite3 : "Database is locked" error

    - by Miraaj
    Hi all, In my cocoa application I am maintaining a SQLite db within resources folder and trying to do some select, delete operations in it but after some time it starts giving me 'Database is locked' error. The methods which I am using for select delete operations are as follows: // method to retrieve data if (sqlite3_open([databasePath UTF8String], &database) != SQLITE_OK) { sqlite3_close(database); NSAssert(0, @"Failed to open database"); } NSLog(@"mailBodyFor:%d andFlag:%d andFlag:%@",UId,x,Ffolder); NSMutableArray *recordsToReturn = [[NSMutableArray alloc] initWithCapacity:2]; NSString *tempMsg; const char *sqlStatementNew; NSLog(@"before switch"); switch (x) { case 9: // tempMsg=[NSString stringWithFormat:@"SELECT * FROM users_messages"]; tempMsg=[NSString stringWithFormat:@"SELECT message,AttachFileOriName as oriFileName,AttachmentFileName as fileName FROM users_messages WHERE id = (select message_id from users_messages_status where id= '%d')",UId]; NSLog(@"mail body query - %@",tempMsg); break; default: break; } sqlStatementNew = [tempMsg cStringUsingEncoding:NSUTF8StringEncoding]; sqlite3_stmt *compiledStatementNew; NSLog(@"before if statement"); if(sqlite3_prepare_v2(database, sqlStatementNew, -1, &compiledStatementNew, NULL) == SQLITE_OK) { NSLog(@"the sql is finalized"); while(sqlite3_step(compiledStatementNew) == SQLITE_ROW) { NSMutableDictionary *recordDict = [[NSMutableDictionary alloc] initWithCapacity:3]; NSString *message; if((char *)sqlite3_column_text(compiledStatementNew, 0)){ message = [NSString stringWithUTF8String:(char *)sqlite3_column_text(compiledStatementNew, 0)]; } else{ message = @""; } NSLog(@"message - %@",message); NSString *oriFileName; if((char *)sqlite3_column_text(compiledStatementNew, 1)){ oriFileName = [NSString stringWithUTF8String:(char *)sqlite3_column_text(compiledStatementNew, 1)]; } else{ oriFileName = @""; } NSLog(@"oriFileName - %@",oriFileName); NSString *fileName; if((char *)sqlite3_column_text(compiledStatementNew, 2)){ fileName = [NSString stringWithUTF8String:(char *)sqlite3_column_text(compiledStatementNew, 2)]; } else{ fileName = @""; } NSLog(@"fileName - %@",fileName); [recordDict setObject:message forKey:@"message"]; [recordDict setObject:oriFileName forKey:@"oriFileName"]; [recordDict setObject:fileName forKey:@"fileName"]; [recordsToReturn addObject:recordDict]; [recordDict release]; } sqlite3_finalize(compiledStatementNew); sqlite3_close(database); NSLog(@"user messages return -%@",recordsToReturn); return recordsToReturn; } else{ NSLog(@"Error while creating retrieving mailBodyFor in messaging '%s'", sqlite3_errmsg(database)); sqlite3_close(database); } // method to delete data if (sqlite3_open([databasePath UTF8String], &database) != SQLITE_OK) { sqlite3_close(database); NSAssert(0, @"Failed to open database"); } NSString *deleteQuery = [[NSString alloc] initWithFormat:@"delete from users_messages_status where id IN(%@)",ids]; NSLog(@"users_messages_status msg deleteQuery - %@",deleteQuery); sqlite3_stmt *deleteStmnt; const char *sql = [deleteQuery cStringUsingEncoding:NSUTF8StringEncoding]; if(sqlite3_prepare_v2(database, sql, -1, &deleteStmnt, NULL) != SQLITE_OK){ NSLog(@"Error while creating delete statement. '%s'", sqlite3_errmsg(database)); } else{ NSLog(@"successful deletion from users_messages"); } if(SQLITE_DONE != sqlite3_step(deleteStmnt)){ NSLog(@"Error while deleting. '%s'", sqlite3_errmsg(database)); } sqlite3_close(database); Things are going wrong in this sequence Data is retrieved 'Database is locked' error arises on performing delete operation. When I retry to perform 1st step.. it now gives same error. Can anyone suggest me: If I am doing anything wrong or missing some check? Is there any way to unlock it when it gives locked error? Thanks, Miraaj

    Read the article

  • Avoiding explicit recursion in Haskell

    - by Travis Brown
    The following simple function applies a given monadic function iteratively until it hits a Nothing, at which point it returns the last non-Nothing value. It does what I need, and I understand how it works. lastJustM :: (Monad m) => (a -> m (Maybe a)) -> a -> m a lastJustM g x = g x >>= maybe (return x) (lastJustM g) As part of my self-education in Haskell I'm trying to avoid explicit recursion (or at least understand how to) whenever I can. It seems like there should be a simple non-explicitly recursive solution in this case, but I'm having trouble figuring it out. I don't want something like a monadic version of takeWhile, since it could be expensive to collect all the pre-Nothing values, and I don't care about them anyway. I checked Hoogle for the signature and nothing shows up. The m (Maybe a) bit makes me think a monad transformer might be useful here, but I don't really have the intuitions I'd need to come up with the details (yet). It's probably either embarrassingly easy to do this or embarrassingly easy to see why it can't or shouldn't be done, but this wouldn't be the first time I've used self-embarrassment as a pedagogical strategy. Background: Here's a simplified working example for context: suppose we're interested in random walks in the unit square, but we only care about points of exit. We have the following step function: randomStep :: (Floating a, Ord a, Random a) => a -> (a, a) -> State StdGen (Maybe (a, a)) randomStep s (x, y) = do (a, gen') <- randomR (0, 2 * pi) <$> get put gen' let (x', y') = (x + s * cos a, y + s * sin a) if x' < 0 || x' > 1 || y' < 0 || y' > 1 then return Nothing else return $ Just (x', y') Something like evalState (lastJustM (randomStep 0.01) (0.5, 0.5)) <$> newStdGen will give us a new data point.

    Read the article

  • Fastest way to pad a number in Java to a certain number of digits

    - by Martin
    Am trying to create a well-optimised bit of code to create number of X-digits in length (where X is read from a runtime properties file), based on a DB-generated sequence number (Y), which is then used a folder-name when saving a file. I've come up with three ideas so far, the fastest of which is the last one, but I'd appreciate any advice people may have on this... 1) Instantiate a StringBuilder with initial capacity X. Append Y. While length < X, insert a zero at pos zero. 2) Instantiate a StringBuilder with initial capacity X. While length < X, append a zero. Create a DecimalFormat based on StringBuilder value, and then format the number when it's needed. 3) Create a new int of Math.pow( 10, X ) and add Y. Use String.valueOf() on the new number and then substring(1) it. The second one can obviously be split into outside-loop and inside-loop sections. So, any tips? Using a for-loop of 10,000 iterations, I'm getting similar timings from the first two, and the third method is approximately ten-times faster. Does this seem correct? Full test-method code below... // Setup test variables int numDigits = 9; int testNumber = 724; int numIterations = 10000; String folderHolder = null; DecimalFormat outputFormat = new DecimalFormat( "#,##0" ); // StringBuilder test long before = System.nanoTime(); for ( int i = 0; i < numIterations; i++ ) { StringBuilder sb = new StringBuilder( numDigits ); sb.append( testNumber ); while ( sb.length() < numDigits ) { sb.insert( 0, 0 ); } folderHolder = sb.toString(); } long after = System.nanoTime(); System.out.println( "01: " + outputFormat.format( after - before ) + " nanoseconds" ); System.out.println( "Sanity check: Folder = \"" + folderHolder + "\"" ); // DecimalFormat test before = System.nanoTime(); StringBuilder sb = new StringBuilder( numDigits ); while ( sb.length() < numDigits ) { sb.append( 0 ); } DecimalFormat formatter = new DecimalFormat( sb.toString() ); for ( int i = 0; i < numIterations; i++ ) { folderHolder = formatter.format( testNumber ); } after = System.nanoTime(); System.out.println( "02: " + outputFormat.format( after - before ) + " nanoseconds" ); System.out.println( "Sanity check: Folder = \"" + folderHolder + "\"" ); // Substring test before = System.nanoTime(); int baseNum = (int)Math.pow( 10, numDigits ); for ( int i = 0; i < numIterations; i++ ) { int newNum = baseNum + testNumber; folderHolder = String.valueOf( newNum ).substring( 1 ); } after = System.nanoTime(); System.out.println( "03: " + outputFormat.format( after - before ) + " nanoseconds" ); System.out.println( "Sanity check: Folder = \"" + folderHolder + "\"" );

    Read the article

  • Java java.util.ConcurrentModificationException error

    - by vijay
    Hi all, please can anybody help me solve this problem last so many days I could not able to solve this error. I tried using synchronized method and other ways but did not work so please help me Error java.util.ConcurrentModificationException at java.util.AbstractList$Itr.checkForComodification(Unknown Source) at java.util.AbstractList$Itr.remove(Unknown Source) at JCA.startAnalysis(JCA.java:103) at PrgMain2.doPost(PrgMain2.java:235) Code public synchronized void startAnalysis() { //set Starting centroid positions - Start of Step 1 setInitialCentroids(); Iterator<DataPoint> n = mDataPoints.iterator(); //assign DataPoint to clusters loop1: while (true) { for (Cluster c : clusters) { c.addDataPoint(n.next()); if (!n.hasNext()) break loop1; } } //calculate E for all the clusters calcSWCSS(); //recalculate Cluster centroids - Start of Step 2 for (Cluster c : clusters) { c.getCentroid().calcCentroid(); } //recalculate E for all the clusters calcSWCSS(); // List copy = new ArrayList(originalList); //synchronized (c) { for (int i = 0; i < miter; i++) { //enter the loop for cluster 1 for (Cluster c : clusters) { for (Iterator<DataPoint> k = c.getDataPoints().iterator(); k.hasNext(); ) { // synchronized (k) { DataPoint dp = k.next(); System.out.println("Value of DP" +dp); //pick the first element of the first cluster //get the current Euclidean distance double tempEuDt = dp.getCurrentEuDt(); Cluster tempCluster = null; boolean matchFoundFlag = false; //call testEuclidean distance for all clusters for (Cluster d : clusters) { //if testEuclidean < currentEuclidean then if (tempEuDt > dp.testEuclideanDistance(d.getCentroid())) { tempEuDt = dp.testEuclideanDistance(d.getCentroid()); tempCluster = d; matchFoundFlag = true; } //if statement - Check whether the Last EuDt is > Present EuDt } //for variable 'd' - Looping between different Clusters for matching a Data Point. //add DataPoint to the cluster and calcSWCSS if (matchFoundFlag) { tempCluster.addDataPoint(dp); //k.notify(); // if(k.hasNext()) k.remove(); for (Cluster d : clusters) { d.getCentroid().calcCentroid(); } //for variable 'd' - Recalculating centroids for all Clusters calcSWCSS(); } //if statement - A Data Point is eligible for transfer between Clusters. // }// syn } //for variable 'k' - Looping through all Data Points of the current Cluster. }//for variable 'c' - Looping through all the Clusters. }//for variable 'i' - Number of iterations. // syn }

    Read the article

  • where is the error in this C code , and how to get rid of the warnings?

    - by mekasperasky
    #include<stdio.h> #include<string.h> //This program is a sorting application that reads a sequence of numbers from a file and prints them on the screen . The reading from the file here , is a call back function . typedef int (*CompFunc)(const char* , const char* ); typedef int (*ReadCheck)(char nullcheck); char array[100]; //Let this fucntion be done in the library itself . It doesnt care as to where the compare function and how is it implemented . Meaning suppose the function wants to do sort in ascending order or in descending order then the changes have to be done by the client code in the "COMPARE" function who will be implementing the lib code . void ReadFile(FILE *fp,ReadCheck rc) { char a; char d[100]; int count = 0,count1=0; a=fgetc(fp); while(1 != (*rc)(a)) { if(a=='\0') { strcpy(array[count],d); count=count+1; } else { d[count1]=a; count1=count1+1; } } } void Bubblesort(int* array , int size , int elem_size , CompFunc cf) { int i,j; int *temp; for( i=0;i < size ;i++) { for ( j=0;j < size -1 ; j++) { // make the callback to the comparision function if(1 == (*cf)(array+j*elem_size,array+ (j+1)*elem_size)) { //interchanging of elements temp = malloc(sizeof(int *) * elem_size); memcpy(temp , array+j*elem_size,elem_size); memcpy(array+j*elem_size,array+(j+1)*elem_size,elem_size); memcpy(array + (j+1)*elem_size , temp , elem_size); free(temp); } } } } //Let these functions be done at the client side int Compare(const char* el1 , const char* el2) { int element1 = *(int*)el1; int element2 = *(int*)el2; if(element1 < element2 ) return -1; if(element1 > element2) return 1 ; return 0; } int ReadChecked(char nullcheck) { if (nullcheck=='\n') return 1; else return 0; } int main() { FILE fp1; int k; fp1=fopen("readdata.txt","r"); Readfile(fp1,&ReadChecked); Bubblesort((char*)array,5,sizeof(array[0]),&Compare); printf("after sorting \n"); for (k=0;k<5;k++) printf("%d",array[k]); return 0; } The error i get is fsc1.c: In function ‘ReadFile’: fsc1.c:19: warning: passing argument 1 of ‘strcpy’ makes pointer from integer without a cast fsc1.c: In function ‘Bubblesort’: fsc1.c:40: warning: passing argument 1 of ‘cf’ from incompatible pointer type fsc1.c:40: warning: passing argument 2 of ‘cf’ from incompatible pointer type fsc1.c:43: warning: incompatible implicit declaration of built-in function ‘malloc’ fsc1.c:47: warning: incompatible implicit declaration of built-in function ‘free’ fsc1.c: In function ‘main’: fsc1.c:80: error: incompatible types in assignment fsc1.c:82: warning: passing argument 1 of ‘Bubblesort’ from incompatible pointer type

    Read the article

  • How to create multiple Repository object inside a Repository class using Unit Of Work?

    - by Santosh
    I am newbie to MVC3 application development, currently, we need following Application technologies as requirement MVC3 framework IOC framework – Autofac to manage object creation dynamically Moq – Unit testing Entity Framework Repository and Unit Of Work Pattern of Model class I have gone through many article to explore an basic idea about the above points but still I am little bit confused on the “Repository and Unit Of Work Pattern “. Basically what I understand Unit Of Work is a pattern which will be followed along with Repository Pattern in order to share the single DB Context among all Repository object, So here is my design : IUnitOfWork.cs public interface IUnitOfWork : IDisposable { IPermitRepository Permit_Repository{ get; } IRebateRepository Rebate_Repository { get; } IBuildingTypeRepository BuildingType_Repository { get; } IEEProjectRepository EEProject_Repository { get; } IRebateLookupRepository RebateLookup_Repository { get; } IEEProjectTypeRepository EEProjectType_Repository { get; } void Save(); } UnitOfWork.cs public class UnitOfWork : IUnitOfWork { #region Private Members private readonly CEEPMSEntities context = new CEEPMSEntities(); private IPermitRepository permit_Repository; private IRebateRepository rebate_Repository; private IBuildingTypeRepository buildingType_Repository; private IEEProjectRepository eeProject_Repository; private IRebateLookupRepository rebateLookup_Repository; private IEEProjectTypeRepository eeProjectType_Repository; #endregion #region IUnitOfWork Implemenation public IPermitRepository Permit_Repository { get { if (this.permit_Repository == null) { this.permit_Repository = new PermitRepository(context); } return permit_Repository; } } public IRebateRepository Rebate_Repository { get { if (this.rebate_Repository == null) { this.rebate_Repository = new RebateRepository(context); } return rebate_Repository; } } } PermitRepository .cs public class PermitRepository : IPermitRepository { #region Private Members private CEEPMSEntities objectContext = null; private IObjectSet<Permit> objectSet = null; #endregion #region Constructors public PermitRepository() { } public PermitRepository(CEEPMSEntities _objectContext) { this.objectContext = _objectContext; this.objectSet = objectContext.CreateObjectSet<Permit>(); } #endregion public IEnumerable<RebateViewModel> GetRebatesByPermitId(int _permitId) { // need to implment } } PermitController .cs public class PermitController : Controller { #region Private Members IUnitOfWork CEEPMSContext = null; #endregion #region Constructors public PermitController(IUnitOfWork _CEEPMSContext) { if (_CEEPMSContext == null) { throw new ArgumentNullException("Object can not be null"); } CEEPMSContext = _CEEPMSContext; } #endregion } So here I am wondering how to generate a new Repository for example “TestRepository.cs” using same pattern where I can create more then one Repository object like RebateRepository rebateRepo = new RebateRepository () AddressRepository addressRepo = new AddressRepository() because , what ever Repository object I want to create I need an object of UnitOfWork first as implmented in the PermitController class. So if I would follow the same in each individual Repository class that would again break the priciple of Unit Of Work and create multiple instance of object context. So any idea or suggestion will be highly appreciated. Thank you

    Read the article

< Previous Page | 304 305 306 307 308 309 310 311 312 313 314 315  | Next Page >