Search Results

Search found 13748 results on 550 pages for 'split testing'.

Page 309/550 | < Previous Page | 305 306 307 308 309 310 311 312 313 314 315 316  | Next Page >

  • What is the best way to partition large tables in SQL Server?

    - by RyanFetz
    In a recent project the "lead" developer designed a database schema where "larger" tables would be split across two seperate databases with a view on the main database which unioned the two seperate database-tables together. The main database is what the application was driven off of so these tables looked and felt like ordinary tables (except some quirkly things around updating). This seemed like a HUGE performance problem. We do see problems with performance around these tables but nothing to make him change his mind about his design. Just wondering what is the best way to do this, or if it is even worth doing?

    Read the article

  • Normalizing Strings using Regexes

    - by RasputinJones
    How do I match this string "1 & 2" from this string "Foo Bar 1 & 2"? How do I match this string "1, 2 & 3" from this string "Foo Baz 1, 2 & 3"? Trying to split out "Foo Bar" from the string using regexes while using the presence of "1 & 2" or "1, 2 & 3" as conditionals to normalize these strings into "Foo Bar 1" and "Foo Bar 2" or "Foo Baz 1", "Foo Baz 2" and "Foo Baz 3" respectively.

    Read the article

  • How can I optimize this code?

    - by loop0
    Hi, I'm developing a logger daemon to squid to grab the logs on a mongodb database. But I'm experiencing too much cpu utilization. How can I optimize this code? from sys import stdin from pymongo import Connection connection = Connection() db = connection.squid logs = db.logs buffer = [] a = 'timestamp' b = 'resp_time' c = 'src_ip' d = 'cache_status' e = 'reply_size' f = 'req_method' g = 'req_url' h = 'username' i = 'dst_ip' j = 'mime_type' L = 'L' while True: l = stdin.readline() if l[0] == L: l = l[1:].split() buffer.append({ a: float(l[0]), b: int(l[1]), c: l[2], d: l[3], e: int(l[4]), f: l[5], g: l[6], h: l[7], i: l[8], j: l[9] } ) if len(buffer) == 1000: logs.insert(buffer) buffer = [] if not l: break connection.disconnect()

    Read the article

  • GWT: how to have different styles for splitters in different SplitLayoutPanels?

    - by user26270
    I know you can change the styles of the splitters with the defaults styles listed in the docs: .gwt-SplitLayoutPanel .gwt-SplitLayoutPanel-HDragger { horizontal dragger } .gwt-SplitLayoutPanel .gwt-SplitLayoutPanel-VDragger { vertical dragger } and we've done that in earlier development. However, now I'm developing new stuff and would like to use a different style for the splitters in a new SplitLayoutPanel. Unfortunately, we haven't or can't split the app into different modules, which might make this easier. I tried creating a new style and applying it to my new SplitLayoutPanel, but it didn't appear to have any effect on the splitters. I thought there might be a method to get a handle on the splitters in order to apply the new style to only them, but I didn't find any such method.

    Read the article

  • Targeting row when responding with js rails

    - by berto77
    I have an application where a user can vote on reviews. They can vote up or down. Now when there's a listing of reviews, I have a problem targeting the review the user voted on. I'm using a respon_to block in my rails controller and responding with js. So for instance, I have a vote_up method, and a vote_up.js.erb template. in that template, I have the following: var id = $('article.comment').attr('id').split('_')[1]; alert("id: " + id); $('.votecomment_' + id).find('.score').html("<%= @review2.vote_total %>"); I'm just alerting the id. The problem is that the id always returns the value of the first review found on the page. How can I pass the context aka this, to javascript, so I can figure out which review to target?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • problem in extracting the data from text file

    - by parijat24
    hello , i am new to python , and I want to extract the data from this format FBpp0143497 5 151 5 157 PF00339.22 Arrestin_N Domain 1 135 149 83.4 1.1e-23 1 CL0135 FBpp0143497 183 323 183 324 PF02752.15 Arrestin_C Domain 1 137 138 58.5 6e-16 1 CL0135 FBpp0131987 60 280 51 280 PF00089.19 Trypsin Domain 14 219 219 127.7 3.7e-37 1 CL0124 to this format FBpp0143497 5 151 Arrestin_N 1.1e-23 FBpp0143497 183 323 Arrestin_C 6e-16 I have written code in hope that it works but it does not work , please help! file = open('/ddfs/user/data/k/ktrip_01/hmm.txt','r') rec = file.read() for line in rec : field = line.split("\t") print field print field[:] print '>',field[0] print field[1], field[2], field[6], field[12] the hmmtext file is FBpp0143497 5 151 5 157 PF00339.22 Arrestin_N Domain 1 135 149 83.4 1.1e-23 1 CL0135 FBpp0143497 183 323 183 324 PF02752.15 Arrestin_C Domain 1 137 138 58.5 6e-16 1 CL0135 FBpp0131987 60 280 51 280 PF00089.19 Trypsin Domain 14 219 219 127.7 3.7e-37 1 CL0124

    Read the article

  • How to Best Setup a Website Project in VS.NET

    - by Jason
    I have very little experience with setting up a website from scratch in a .NET environment. As I am doing this now, I am wondering - what's the best way to go? Is it better to create a new Website Project, and include the various backend services and database code as part of that project, or is it better to split out the various aspects of the project? If the second, how would I go about doing that? I want to ensure that this project is easy to manage in the future (in terms of source control, deployment, etc), so I want to make sure I'm starting off on the right foot. I was unable to find any tutorials online, but if you have any, I would appreciate those as well. Thanks!

    Read the article

  • Have anyone ever create/manipulate a table application from the ground up/scratch?

    - by Darwin
    Have anyone ever create/manipulate a table application from the ground up/scratch? I want to create a table using flash AS 3. I like to have the features like to the MS Studio Web Developer option. The options are create a table, merge cells, split cell, resize columns, delete cell, delete row, delete column etc... I think this is going to be very complicated thing to do. I think the only way to do it is to build it from the ground up because I don’t think Flash has the library/component for it. I was able to create rows and columns by creating the # of rectangles listed it from the left to the right and move the next coordinate for the next row. Now the most challenging this is to manipulate it. This is the must have feature on my website and we don’t want use Javascript to create table on the server side to create the table.

    Read the article

  • best practice for Jquery plugin implementation and resource locations

    - by ptutt
    This is probably a very basic question, but I seem to have issues plugging in jquery plug-ins. The issue seems to be around the location of the script, css and images and ensuring the css has the correct url to the images. The standard plug-in has the following folder structure (eg : JPicker) js css images My project is asp.net mvc so I have the default: scripts images content So, I try to split the jquery plugin to the appropriate folders (not sure if this is the best way?). Then I try to correct the references to images (background urls) in the css. I believe the url is relative to the page that is implementing the css file, not the location of the css file itself. Anyway, when I try the above, the plugins don't seem to work. I believe the issue lies with the images not being found. The jquery code runs without errors, so I assume that's not the problem. Any help/advice much appreciated

    Read the article

  • Show elipses where text will be truncated as per iTunes

    - by Burt
    I a building an application with a similar layout to iTunes i.e. it has a sidebar that doubles as a menu. Some of the text will exceed the boundary and rather that having it be truncated I would like to show ellipses (see line image below "Purchased on My iPh..."). How would I go about this in WPF? Suppose I made the boundary movable i.e. user can change the size of the panel (split panel in Windows Forms), how would I go about dynamically showing the ellipses/text? Thanks in advance, B

    Read the article

  • how to query sqlite for certain rows, i.e. dividing it into pages (perl DBI)

    - by user1380641
    sorry for my noob question, I'm currently writing a perl web application with sqlite database behind it. I would like to be able to show in my app query results which might get thousands of rows - these should be split in pages - routing should be like /webapp/N - where N is the page number. what is the correct way to query the sqlite db using DBI, in order to fetch only the relavent rows. for instance, if I show 25 rows per page so I want to query the db for 1-25 rows in the first page, 26-50 in the second page etc.... Thanks in advanced!

    Read the article

  • How to distribute the chance to display each SWF evenly among banner collection?

    - by Michael Mao
    Hi all: I am working on The ausdcf.org to try adding several banner ads in swf format to the top. Everything starts to work, but I've got several questions that need your help: The client chose not to go with Google AdManager, but prefer a "minimal approach" to do this task. What I am trying to do is sort of "mimicking" the way Google AdManager does for banners, that is, to split the chance of each particular swf to be shown to the visitor evenly among the banner collection. Definitely I can add some jQuery code to do this from client-side, a random number generator and if-else statement would work - just $.load() it! However, what if I'd like to make sure those disabled Javascript (is there any now btw?) still be able to see different swfs in each visit. Any suggestion on how to approach this? Many thanks in advance.

    Read the article

  • Parse items from text file

    - by chris
    I have a text file that includes data inside {[]} tags. What would be the suggested way to parse that data so I can just use the data inside the tags? Example text file would look like this: 'this is a bunch of text that is not {[really]} useful in any {[way]}. I need to {[get]} some items {[from]} it.' I would like to end up with 'really', 'way', 'get', 'from' in a list. I guess I could use split to do it.. but seems like there might be a better way out there. I have seen a ton parsing libraries, is there one that would be perfect for what I want to do?

    Read the article

  • Length of text that can just fit into one screen without scrolling

    - by KailZhang
    I find some iphone book apps have such feature: One screen one page of text without scrolling. The text can just fit into the whole screen with linebreaks and indentations. I'm curious of how to implement this. How could I decide the length of text that just fit into the screen. And also, given the whole text, I can calculate out the number of pages. If this is not possible to be done on iPhone(runtime?), then is it possible to process the text before storing it in app? I mean I calculate how many pages I need(how to split the raw text), probably how many lines per page.

    Read the article

  • Splitting a UL into three even lists

    - by Andy
    I am printing a menu using UL, the trouble is the order that is generated by my script is ignored because im printing the LI one after the other and they're spanning three across. So the order is 1 , 2 , 3 as opposed to 1 2 3 To counteract this i wanted to split my single UL into three that way the order would be maintained. Here is my code currently which works perfectly to print a single UL. //Category Drop Down Menu $this->CategoryDropDownMenu = '<ul id="subcatmenu">'; foreach($sitemap->CategoryMenu as $val) $this->CategoryDropDownMenu .= '<li><a href="'.$val[host].$val[link].'"><span>'.htmlspecialchars($val[title]).'</span></a></li>'; $this->CategoryDropDownMenu .= '</ul>';

    Read the article

  • eliminating noise/spikes

    - by tgv
    I have a measurement data with similar positive and negative values which should be like: ReqData=[0 0 -2 -2 -2 -2 -2 -2 0 0 0 -2 -2 -2 -2 0 0 2 2 2 2 2 2 0 0 2 2 2 2 2 0 0 2 2 2 2 2 0 0 2 2 2 0 0]' However, there are some measurement noises in the data - so the real data is like this: RealData=[0 0 -2 -2 -2 -2 -2 -2 0 0 0 -2 -2 -2 -2 0 0 2 2 2 2 -4 -1 0 0 2 2 2 2 -7 0 0 2 2 2 2 -1 0 0 2 2 2 0 0]' How do I remove the end noise from the RealData and convert it into ReqData using Matlab? How do I find the start and stop indexes of each set of positive or negative data and split them using Matlab? For instance, ansPositive = [3,8, 12, 15]' and ansNegative = [18, 23, 26, 30, 33, 37, 40, 42]'.

    Read the article

  • regular expression match does not work

    - by Carlos_Liu
    I have a string ABCD:10,20,,40;1/1;1/2,1/3,1/4 I want to split the string into the following parts: ABCD -- splited by : 10,20,,40 -- splited by ; 1/1 1/2,1/3,1/4 Why the following regular expression does not work for me ? string txt = @"ABCD:10,20,,40;1/1;1/2,1/3,1/4"; Regex reg = new Regex(@"\b(?<test>\w+):(?<com>\w+);(?<p1>\w+);(?<p2>\w+)"); Match match = reg.Match(txt);

    Read the article

  • In B-trees which element gets promoted when the node splits

    - by Phenom
    Let's say there is a B-tree of order 8. This means it can have 8 pointers and 7 elements. Say the letters A through G are stored in this B-tree. So this B-tree is just a single node containing 7 elements. Then you try to insert J into the tree. There's no room, so you have to split the node and create a new root node. Which element gets promoted up into the root node?

    Read the article

  • Rename Files in Python

    - by Jeff
    Hi all, Im trying to rename some files in a directory using python. I've looked around the forums here, and because i'm a noob, I cant adapt what I need from what is out there. Say I have a file called CHEESE_CHEESE_TYPE.*** and want to remove "Cheese_" so my resulting filename would be "CHEESE_TYPE" Im trying to use the os.path.split but it's not working properly. I have also considered using string manipulations, but have not been successful with that either. Any help would be greatly appreciated. Thanks.

    Read the article

  • c# FormatException was unhandled

    - by poco
    I'm parsing chat from a game and i get this string "?68 00 00 37 00 45 00 00" recipe = recipe.Replace("?", ""); string[] rElements = new string[8]; rElements = recipe.Split(' '); int num = int.Parse(rElements[0]); I get a Format exception on that last line that i don't understand. It says that input string is not in the right format. I have checked the debugger and the first element says it is "68". Anyone have any clue what is happening?

    Read the article

  • foreach statement (get string values)

    - by nhoyti
    Can someone please help me out? My code for splitting the strings is working however, i still need to use the splitted string my page. How can i achieve this? Here's my current code private void SplitStrings() { List<string> listvalues = new List<string>(); listvalues = (List<string>)Session["mylist"]; string[] strvalues = listvalues.ToArray(); if (listvalues != null) { foreach (string strElement in listvalues) { string[] prods = strElement.ToString().Split("|".ToCharArray()); string prodName = prods[0].ToString(); Response.Write(prodName); } } } link text how can i replace the response.write with any label or literal? when i tried to use a literal on the code it displays one single string not all of the strings that's been splitted. any ideas?

    Read the article

  • [Python] Best strategy for dealing with incomplete lines of data from a file.

    - by adoran
    I use the following block of code to read lines out of a file 'f' into a nested list: for data in f: clean_data = data.rstrip() data = clean_data.split('\t') t += [data[0]] strmat += [data[1:]] Sometimes, however, the data is incomplete and a row may look like this: ['955.159', '62.8168', '', '', '', '', '', '', '', '', '', '', '', '', '', '29', '30', '0', '0'] It puts a spanner in the works because I would like Python to implicitly cast my list as floats but the empty fields '' cause it to be cast as an array of strings (dtype: s12). I could start a second 'if' statement and convert all empty fields into NULL (since 0 is wrong in this instance) but I was unsure whether this was best. Is this the best strategy of dealing with incomplete data? Should I edit the stream or do it post-hoc?

    Read the article

  • What statistics app should I use for my website?

    - by Camran
    I have my own server (with root access). I need statistics of users who visit my website etc etc... I have looked at an app called Webalyzer... Is this a good choice? I run apache2 on a Ubuntu 9 system... If you know of any good statistics apps for servers please let me know. And a follow-up question: All statistics are saved in log-files right? So how large would these log-files become then? Possibility to split them would be good, dont know if this is possible with Webalyzer though...

    Read the article

  • How to get top/left x/y of image map with javascript / jquery?

    - by jpea
    Using jQuery's position() or offset(), I can't seeme to get the top/left coordinates of an image map area. It works in FF, but nothing else - no webkit, IE, Opera. $('area').bind("click",function(){ alert($(this).position().left); }); <area shape="rect" coords="14,25,205,150" href="#"> Anyone know of a different way to access these? Normally I would just take the coords and split(",") but there are a bunch of multi-faceted area's on these pages.

    Read the article

< Previous Page | 305 306 307 308 309 310 311 312 313 314 315 316  | Next Page >