Search Results

Search found 13748 results on 550 pages for 'split testing'.

Page 308/550 | < Previous Page | 304 305 306 307 308 309 310 311 312 313 314 315  | Next Page >

  • Parse boolean values in strings for use with Function.apply

    - by as3cmdline
    I'm using String.split to parse a command line string into an array of strings. The result is then used to call a function using the Function.apply API. If apply(null, ["17"]) is called with this function: static function test(foo:int):void { trace(foo, typeof(foo)); } it works as expected (output: 17 number). However, calling apply(null, ["false"]) or apply(null, ["0"]) with this function: static function test(foo:Boolean):void { trace(foo, typeof(foo)); } does not work (expected output: false Boolean; actual output: true Boolean). Is there a way to make it recognize "true" and "false" (or anything else) as Boolean values, just like it does with numerical strings? Ideally "true" and "false" should also remain valid string values.

    Read the article

  • How I can use X-editable pass value to backend and get response

    - by leonlong
    I am new to jquery, recently I tried to use X-editable to edit a table. after I edited it , I want to pass value to PHP for process, but when I want to return something else back with value, it will get an error. What I mean is usually we can get several response from PHP, but I can get it like that through this. $('#example').editable({ type: 'text', name: 'example', url: 'exprediction.php', ajaxOptions: { dataType: 'json' }, success: function(newValue) { var response = newValue.split("|"); value1 = response[0]; value2 = response[1]; //it did not work } });

    Read the article

  • My Java regex isn't capturing the group

    - by Geo
    I'm trying to match the username with a regex. Please don't suggest a split. USERNAME=geo Here's my code: String input = "USERNAME=geo"; Pattern pat = Pattern.compile("USERNAME=(\\w+)"); Matcher mat = pat.matcher(input); if(mat.find()) { System.out.println(mat.group()); } why doesn't it find geo in the group? I noticed that if I use the .group(1), it finds the username. However the group method contains USERNAME=geo. Why?

    Read the article

  • LinqToSql Sub Entiity Multiple And Operators

    - by halit
    Hi I have an Array of Featureset Id , My Vehicles table has got sub table as FeatureSets I wrote Sql Query Like SELECT [t0].[ID] FROM [dbo].[SearchResultView] AS [t0] Join [dbo].[VehicleFeatureSet] AS [t1] on t0.ID = t1.VehicleID where t1.FeatureSetID = 1 and t1.FeatureSetID= 2 and t1.FeatureSetID= 3 I tried. But I Couldn't var features = Request.QueryString["FeatureSets"].Split(',').ToList().ConvertAll(new Converter<string, int>(StrinToint)); IQueryable<SearchResultView> result = db.SearchResultViews.Where(m => m.Active == true); foreach (var featuree in features) { result = result.Where(m => m.VehicleFeatureSets.Any(c => c.FeatureSetID == featuree)); } How Can I write this LINQ Query

    Read the article

  • Why use threading data race will occur, but will not use gevent

    - by onlytiancai
    My test code is as follows, using threading, count is not 5,000,000 , so there has been data race, but using gevent, count is 5,000,000, there was no data race . Is not gevent coroutine execution will atom "count + = 1", rather than split into a one CPU instruction to execute? # -*- coding: utf-8 -*- import threading use_gevent = True use_debug = False cycles_count = 100*10000 if use_gevent: from gevent import monkey monkey.patch_thread() count = 0 class Counter(threading.Thread): def __init__(self, name): self.thread_name = name super(Counter, self).__init__(name=name) def run(self): global count for i in xrange(cycles_count): if use_debug: print '%s:%s' % (self.thread_name, count) count = count + 1 counters = [Counter('thread:%s' % i) for i in range(5)] for counter in counters: counter.start() for counter in counters: counter.join() print 'count=%s' % count

    Read the article

  • Read a file to multiple array byte[]

    - by hankol
    I have an encryption algorithm (AES) that accepts file converted to array byte and encrypt it. Since I am going to process a very big size files, the JVM may go out of memory. I am planing to read the files in multiple array byte. each containing some part of the file. Then I teratively feed the algorithm. Finally merge them to produce encrypted file. So my question is: there any way to read a file part by part to multiple array byte? I thought I can use the following to read the file to array byte: IOUtils.toByteArray(InputStream input). And then split the array into multiple bytes using: Arrays.copyOfRange(). But I am afraid that the first code that reads file to byte will make the JVM to go out of memory. any suggestion please ? thanks

    Read the article

  • Why are Objective-C instance variables declared in an interface?

    - by Chase
    I'm just getting into Objective-C (Java is my primary OO language). Defining an object's instance variables in the interface instead of the class seems strange. I'm used to an interface being a public API definition with nothing besides method signatures (not counting constants here). Is there some reason that state is defined in an interface (even if it is private) and behaviour is defined in a class. It just seems odd that since objects are state+behavior that the definition would be split into two separate places. Is it a design benefit is some way? A pain in the rear issue that you are just forced to deal with in Objective-C? A non-issue, just different? Any background on why it's done this way? Or can you put object state in a class and I just haven't hit that part in my book yet?

    Read the article

  • How to break a list into chunks based on some property?

    - by CurlyFro
    public class InvestorMailing { public string To { get; set; } public IEnumerable<string> Attachments { get; set; } public int AttachmentCount { get; set; } public long AttachmentSize { get; set; } } i have an IList<InvestorMailing> mailingList. if the attachment size is greater than x, then i need to split my list and break it into chunks. is there an easy linq-y way to do this?

    Read the article

  • Forcing a mixed ISO-8859-1 and UTF-8 multi-line string into UTF-8 in Perl

    - by knorv
    Consider the following problem: A multi-line string $junk contains some lines which are encoded in UTF-8 and some in ISO-8859-1. I don't know a priori which lines are in which encoding, so heuristics will be needed. I want to turn $junk into pure UTF-8 with proper re-encoding of the ISO-8859-1 lines. Also, in the event of errors in the processing I want to provide a "best effort result" rather than throwing an error. My current attempt looks like this: $junk = &force_utf8($junk); sub force_utf8 { my $input = shift; my $output = ''; foreach my $line (split(/\n/, $input)) { if (utf8::valid($line)) { utf8::decode($line); } $output .= "$line\n"; } return $output; } While this appears to work I'm certain this is not the optimal solution. How would you improve the force_utf8(...) sub?

    Read the article

  • Dynamic "WHERE IN" on IQueryable (linq to SQL)

    - by user320235
    I have a LINQ to SQL query returning rows from a table into an IQueryable object. IQueryable<MyClass> items = from table in DBContext.MyTable select new MyClass { ID = table.ID, Col1 = table.Col1, Col2 = table.Col2 } I then want to perform a SQL "WHERE ... IN ...." query on the results. This works fine using the following. (return results with id's ID1 ID2 or ID3) sQuery = "ID1,ID2,ID3"; string[] aSearch = sQuery.Split(','); items = items.Where(i => aSearch.Contains(i.ID)); What I would like to be able to do, is perform the same operation, but not have to specify the i.ID part. So if I have the string of the field name I want to apply the "WHERE IN" clause to, how can I use this in the .Contains() method?

    Read the article

  • Preserve trailing whitespace Sybase

    - by AngryWhenHungry
    I have a big chunk of textual data which I split and write multiple rows of a varchar(255) column of a table. Sometimes, the last character happens to be a space. When I read back this row, the trailing space is chopped and I get only 254 characters. This messes up my data when I append the next row to the end of this one. My code sends the full 255 char (incl space) to the DB API. How can I check that the trailing space is actually written to the table? I am not in a position to rewrite/redesign legacy code. Is there any setting - either in the DB, DB interface, read/write calls etc - that I can use to preserve the trailing space?

    Read the article

  • handling matrix data in python

    - by Ovisek
    I was trying to progressively subtract values of a 3D matrix. The matrix looks like: ATOM 1223 ZX SOD A 11 2.11 -1.33 12.33 ATOM 1224 ZY SOD A 11 -2.99 -2.92 20.22 ATOM 1225 XH HEL A 12 -3.67 9.55 21.54 ATOM 1226 SS ARG A 13 -6.55 -3.09 42.11 ... here the last three columns are representing values for axes x,y,z respectively. now I what I wanted to do is, take the values of x,y,z for 1st line and subtract with 2nd,3rd,4th line in a iterative way and print the values for each axes. I was using: for line in map(str.split,inp): x = line[-3] y = line[-2] z = line[-1] for separating the values, but how to do in iterative way. should I do it by using Counter.

    Read the article

  • Reduce text length to fit cell width in a smart manner

    - by Andrei Ciobanu
    Hello, I am in project where we are building a simple web calendar using Java EE technologies. We define a table where every row is an employee, and every column represents an hour interval. The table width and column widths are adjustable. In every cell we have a text retrieved from a database, indicating what the employee is doing / should do in that time interval. The problem is that sometimes the text in cells is getting bigger than the actual cell. My task is to make the text more "readable" by reducing it's length in a "smart way" so that it can fit in the cell more "gracefully". For example if initially in a cell I have: "Writing documents", after the resize I should retrieve: "Wrtng. dcmnts" or "Writ. docum." so that the text can fit well. Is there a smart way to do it ? Or removing vocals / split the string in two is enough ?

    Read the article

  • Best way to get photoshop to optimise 35 related pictures for fast transmission

    - by thenerd
    I have 35 pictures taken from a stationary camera aimed at a lightbox in which an object is placed, rotated at 10 degrees in each picture. If I cycle through the pictures quickly, the image looks like it is rotating. If I wished to 'rotate' the object in a browser but wanted to transmit as little data as possible for this, I thought it might be a good idea to split the picture into 36 pictures, where 1 picture is any background the images have in common, and 35 pictures minus the background, just showing the things that have changed. Do you think this approach will work? Is there a better route? How would I achieve this in photoshop?

    Read the article

  • remove the spaces...

    - by tekknolagi
    !/usr/bin/python import random lower_a = ['a', 'b', 'c', 'd', 'e', 'f', 'g', 'h', 'i', 'j', 'k', 'l', 'm', 'n', 'o', 'p', 'q', 'r', 's', 't', 'u', 'v', 'w', 'x', 'y', 'z'] upper_a = ['A', 'B', 'C', 'D', 'E', 'F', 'G', 'H', 'I', 'J', 'K', 'L', 'M', 'N', 'O', 'P', 'Q', 'R', 'S', 'T', 'U', 'V', 'W', 'X', 'Y', 'Z'] num = ['0', '1', '2', '3', '4', '5', '6', '7', '8', '9'] all = [] all = " ".join("".join(lower_a) + "".join(upper_a) + "".join(num)) all = all.split() x = 0 while x < 10: for i in range(7): a = random.choice(all) print a, print x += 1 what i want to do is remove the spaces from the output what it gives now is Z 3 a A I K R G B i N 9 c E v g E r A N 8 e B 6 d v H O c a V 8 c x y b g 2 W a T T f 8 H T r 6 E p D K l 5 p u x q 8 P Z 9 T n I W X n B Q

    Read the article

  • MS Access Crashed an now all Form objects and code modules are missing

    - by owlie
    I was adding a form to our Access 07 db. I copied an existing form to use as a template, renamed it, and saved it. I opened a different form to check something and Access crashed. When I reopened the database it says: "Access has detected that this database is in an inconsistent state, and will attempt to recover the database." etc. When it reopened - all forms and reports were missing. Saved queries remain. The error message states that object recovery failures will be noted in a Recovery Errors table - but this table wasn't created. The links to the be database remained intact. The database is split - I was experimenting with a form on a front-end copy which might have something to do with it. Any ideas what would cause this (I can see loosing recent work - but nixing all form objects?!) And is there any chance of recovery?

    Read the article

  • textarea into array javascript

    - by user281180
    myList contains the following values: value1 value2 value3 function showArray() { var txt = $("#myList").text(); var textread = txt.split('\n'); var msg = ""; for (var i = 0; i < textread .length; i++) { msg += i + ": " + textread [i] + "\n"; } alert(msg); } my alert gives me the following: 0:value1 value2 value3 It`s not what I wanted and expecting, I was expecting something like: 0: value1 1: value2 2: value3 How can I get the values as expected?

    Read the article

  • How can I format numbers as money in JavaScript?

    - by Daniel Magliola
    I would like to format a price in JavaScript. Basically, I have a float variable, and I'd like to have a function that will receive that variable, and output: "$ 2,500.00" What's the best way to do this? EDIT: OK, since I haven't gotten any answers better than the code I implemented, plus my own answer has been voted down and I can't put my own answer as the right one... Here it is... var DecimalSeparator = Number("1.2").toLocaleString().substr(1,1); var AmountWithCommas = Amount.toLocaleString(); var arParts = String(AmountWithCommas).split(DecimalSeparator); var intPart = arParts[0]; var decPart = (arParts.length > 1 ? arParts[1] : ''); decPart = (decPart + '00').substr(0,2); return '£ ' + intPart + DecimalSeparator + decPart;

    Read the article

  • Distributing requests to Selenium Grid RC's?

    - by intervigil
    I've got a situation here where I have a central selenium grid hub, and several RC's running on my gogrid account. When I access it to run tests, it basically queues all the incoming test requests and executes them serially on only one of the RC's, instead of spreading them out to use available RC's. The tests come from multiple projects, so I'm not looking to parallelize the tests themselves, just to split the requests that come from multiple projects across the multiple RC's. From everything I've read, it seems like selenium grid should be doing this already, yet I only see one RC used to run every single test. Is there something I'm missing?

    Read the article

  • Problem in appending a string to a already filled string builder(at the beginning by using INSERT) a

    - by Newbie
    I have a string builder like StringBuilder sb = new StringBuilder("Value1"); sb.AppendLine("Value2"); Now I have a string say string str = "value 0"; I did sb.Insert(0,str); and then string[] strArr = sb.ToString().Trim().Replace("\r", string.Empty).Split('\n'); The result I am getting as (Array size of 2 where I should get 3) [0] value 0 Value1 [1] value2 But the desired output being [0] Value 0 [1] Value1 [2] Value2 Where I am going wrong? I am using C#3.0 Please help.. It 's urgent Thanks

    Read the article

  • How do I get artifacts from one Maven module included in the resources of another in my build?

    - by Hanno Fietz
    I have Maven modules that produce a Flex application as an SWF file. I want to include that file in a web application that is made with another Maven module from the same build. I'm wondering how and at which lifecycle phase I get Maven to grab the artifact from the other module and put it insode the appropriate folder of the webapp module. Would I use a separate assembly module? The web app is running on a Jetty server in an OSGi environment (using Pax), the server side of the web app uses Struts. The final artifact as I see it would be a WAR file including my Action etc classes, JSP templates, static contents such as CSS or JS, and the SWF movies. I might be better off with these split over some other setup, but right now, I wouldn't know which.

    Read the article

  • can list be converted into string

    - by PARIJAT
    Actually i have extracted some data from the file and want to write it in the file 2 but the program says 'sequence item 1: expected string, list found', I want to know how i can convert buffer[] ie string into sequence, so that it could be saved in file 2...I am new to the python please help* file = open('/ddfs/user/data/k/ktrip_01/hmm.txt','r') file2 = open('/ddfs/user/data/k/ktrip_01/hmm_write.txt','w') buffer = [] rec = file.readlines() for line in rec : field = line.split() print '>',field[0] term = field[0] buffer.append(term) print field[1], field[2], field[6], field[12] term1 = field [1] buffer.append(term1) term2 = field[2] buffer.append[term2] term3 = field[6] buffer.append[term3] term4 = field[12] buffer.append[term4] file2.write(buffer) file.close() file2.close()

    Read the article

  • How can I optimize this code?

    - by loop0
    Hi, I'm developing a logger daemon to squid to grab the logs on a mongodb database. But I'm experiencing too much cpu utilization. How can I optimize this code? from sys import stdin from pymongo import Connection connection = Connection() db = connection.squid logs = db.logs buffer = [] a = 'timestamp' b = 'resp_time' c = 'src_ip' d = 'cache_status' e = 'reply_size' f = 'req_method' g = 'req_url' h = 'username' i = 'dst_ip' j = 'mime_type' L = 'L' while True: l = stdin.readline() if l[0] == L: l = l[1:].split() buffer.append({ a: float(l[0]), b: int(l[1]), c: l[2], d: l[3], e: int(l[4]), f: l[5], g: l[6], h: l[7], i: l[8], j: l[9] } ) if len(buffer) == 1000: logs.insert(buffer) buffer = [] if not l: break connection.disconnect()

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • How to run a module

    - by Jimmy
    I have a module file containing the following functions: def replace(filename): match = re.sub(r'[^\s^\w]risk', 'risk', filename) return match def count_words(newstring): from collections import defaultdict word_dict=defaultdict(int) for line in newstring: words=line.lower().split() for word in words: word_dict[word]+=1 for word in word_dict: if'risk'==word: return word, word_dict[word] when I do this in IDLE: >>> mylist = open('C:\\Users\\ahn_133\\Desktop\\Python Project\\test10.txt').read() >>> newstrings=replace(mylist) ### This works fine. >>> newone=count_words(newstrings) ### This leads to the following error. I get the following error: Traceback (most recent call last): File "<pyshell#134>", line 1, in <module> newPH = replace(newPassage) File "C:\Users\ahn_133\Desktop\Python Project\text_modules.py", line 56, in replace match = re.sub(r'[^\s^\w]risk', 'risk', filename) File "C:\Python27\lib\re.py", line 151, in sub return _compile(pattern, flags).sub(repl, string, count) TypeError: expected string or buffer Is there anyway to run both functions without saving newstrings into a file, opening it using readlines(), and then running count_words function?

    Read the article

< Previous Page | 304 305 306 307 308 309 310 311 312 313 314 315  | Next Page >