Search Results

Search found 9447 results on 378 pages for 'str replace'.

Page 321/378 | < Previous Page | 317 318 319 320 321 322 323 324 325 326 327 328  | Next Page >

• Which languages support class replacement?

  - by Alix

  Hi, I'm writing my master thesis, which deals with AOP in .NET, among other things, and I mention the lack of support for replacing classes at load time as an important factor in the fact that there are currently no .NET AOP frameworks that perform true dynamic weaving -- not without imposing the requirement that woven classes must extend ContextBoundObject or MarshalByRefObject or expose all their semantics on an interface. You can however do this in Java thanks to ClassFileTransformer: You extend ClassFileTransformer. You subscribe to the class load event. On class load, you rewrite the class and replace it. All this is very well, but my project director has asked me, quite in the last minute, to give him a list of languages that do / do not support class replacement. I really have no time to look for this now: I wouldn't feel comfortable just doing a superficial research and potentially putting erroneous information in my thesis. So I ask you, oh almighty programming community, can you help out? Of course, I'm not asking you to research this yourselves. Simply, if you know for sure that a particular language supports / doesn't support this, leave it as an answer. If you're not sure please don't forget to point it out. Thanks so much!

  Read the article

• Removing HTML entities while preserving line breaks with JSoup

  - by shrodes

  I have been using JSoup to parse lyrics and it has been great until now, but have run into a problem. I can use Node.html() to return the full HTML of the desired node, which retains line breaks as such: Gl&oacute;andi augu, silfurn&aacute;tt <br />Bl&oacute;&eth; alv&ouml;ru, starir &aacute; <br />&Oacute;&eth;ur hundur er &iacute; v&iacute;gam&oacute;&eth;, &iacute; maga... m&eacute;r <br /> <br />Kolni&eth;ur gref, kvik sem dreg h&eacute;r <br />Kolni&eth;ur svart, hvergi bjart n&eacute; But has the unfortunate side-effect, as you can see, of retaining HTML entities and tags. However, if I use Node.text(), I can get a better looking result, free of tags and entities: Glóandi augu, silfurnátt Blóð alvöru, starir á Óður hundur er í vígamóð, í maga... mér Kolniður gref, kvik sem dreg hér Kolniður svart, Which has another unfortunate side-effect of removing the line breaks and compressing into a single line. Simply replacing <br /> from the node before calling Node.text() yields the same result, and it seems that that method is compressing the text onto a single line in the method itself, ignoring newlines. Is it possible to have the best of both worlds, and have tags and entities replaced correctly which preserving the line breaks, or is there another method or way of decoding entities and removing tags without having to replace them manually?

  Read the article

• How use unobtrusive validation without a model

  - by Ross Cyrus

  i have simple a form wich made by htmlHelper(mvc3) then inside of it i have 2 input field 1:type=text 2:type=submit to submit the form. there is no model behind.so i need to perfom a clientside validation on the textfield before submit it to the server.but i dont know how. i tried this puting manualy the 'data-* artibute , but does not work : @using( Html.BeginForm()) { <label for="UserName" >User Name</label> <div class="editor-field"> <input type="text" data-val="true" data-val-requierd="You must provide an user Name" id="userName" name="userName" placeholder="Enter Your User Name" /> </div> <input type="submit" value="Recover" /> } the "jquery.validate.min.js" and jquery.validate.unobtrusive.min.js and jquery.validate.min.js and jquery.validate.unobtrusive.min.js are loaded to the page. It doesnt let me to answer my self ,so i put it here : I solve it my self,just made an other view wich has its own model and Required on its propertyis and then just copy the renderd html to my own,and i got this and works : <input data-val="true" data-val-required="You must provide an user Name" id="UserName" name="UserName" type="text" value="" placeholder="Enter your User Name"/> <span class="field-validation-valid" data-valmsg-for="UserName" data-valmsg-replace="true"></span> And there is no type="Required".any way thank you guys.

  Read the article

• What shall be the code in xaml which makes a particular image to act as a button?

  - by Abhi

  Dear all I am new to Silverlight. And i have to make a demo application where in designing is done by using Microsoft Expression Blend 2 and developing should be done using Visual Studio(c++). Now i am first trying to become familiar with xaml files. So i was trying to make a simple demo where in i have to create a button and that button should be replace with an png image. In order to do so i tried with the mentioned below example. But i was not able to see anything in the screen. <UserControl xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" x:Class="SilverlightApplication1.Page" Width="640" Height="480"> <Grid x:Name="LayoutRoot" Background="White"> <Button x:Name="LogoutButton" > <Button.Template> <ControlTemplate> <Image Source="SilverlightApplication1\bounce_photo.png" /> </ControlTemplate> </Button.Template> </Button> </Grid> Please let me know where i am wrong and what shall i do to obtain the result. With regards Abhineet Agarwal

  Read the article

• using jquery selector to change attribute in variable returned from ajax request

  - by Blake

  I'm trying to pull in a filename.txt (contains html) using ajax and change the src path in the data variable before I load it into the target div. If I first load it into the div the browser first requests the broken image and I don't want this so I would like to do my processing before I load anything onto the page. I can pull the src values fine but I can't change them. In this example the src values aren't changed. Is there a way to do this with selectors or can they only modify DOM elements? Otherwise I may have to do some regex replace but using a selector will be more convenient if possible. $.ajax( { url: getDate+'/'+name+'.txt', success: function(data) { $('img', data).attr('src', 'new_test_src'); $('#'+target).fadeOut('slow', function(){ $('#'+target).html(data); $('#'+target).fadeIn('slow'); }); } }); My reason is I'm building a fully standalone javascript template system for a newsletter and since images and other things are upload via a drupal web file manager I want the content creators to keep their paths very short and simple and I can then modify them before I load in the content. This will also be distributed on a CD so I can need to change the paths for that so they still work.

  Read the article

• Asp.Net MVC - Binding of parameter to model value!

  - by Pino

  This seems like the model binding is causing me issues. Essentially I have a model called ProductOption and for the purpose of this question it has 2 fields ID (Int) PK ProductID (Int) FK I have a standard route set-up context.MapRoute( "Product_default", "Product/{controller}/{action}/{id}", new { controller = "Product", action = "Index", id = UrlParameter.Optional } ); and if the user wants to add an option the URL is, /Product/Options/Add/1 in the above URL 1 is the ProductID, I have the following code to return a blank model the the view, [HttpGet] public ActionResult Add(int id) { return View("Manage", new ProductOptionModel() { ProductID = id }); } Now in my view I keep a hidden field <%= Html.HiddenFor(x=>x.ID) %> This is used to determine (on submit) if we are editing or adding a new option. However the Model binder in .net seems to replace .ID (Which was 0 when leaving the above get actionresult) with 1 (or the value of the id parameter in the URL) How can I stop or work around this? ViewModel public class ProductExtraModel { //Database public int ID { get; set; } public string Name { get; set; } public int ProductID { get; set; } public ProductModel Product { get; set; } }

  Read the article

• Question about the evolution of interaction paradigm between web server program and content provider program?

  - by smwikipedia

  Hi experts, In my opinion, web server is responsible to deliver content to client. If it is static content like pictures and static html document, web server just deliver them as bitstream directly. If it is some dynamic content that is generated during processing client's request, the web server will not generate the conetnt itself but call some external proram to genearte the content. AFAIK, this kind of dynamice content generation technologies include the following: CGI ISAPI ... And from here, I noticed that: ...In IIS 7, modules replace ISAPI filters... Is there any others? Could anyone help me complete the above list and elabrate on or show some links to their evolution? I think it would be very helpful to understand application such as IIS, TomCat, and Apache. I once wrote a small CGI program, and though it serves as a content generator, it is still nothing but a normal standalone program. I call it normal because the CGI program has a main() entry point. But with the recenetly technology like ASP.NET, I am not writing complete program, but only some class library. Why does such radical change happens? Many thanks.

  Read the article

• Silverlight performance with many loaded controls

  - by gius

  I have a SL application with many DataGrids (from Silverlight Toolkit), each on its own view. If several DataGrids are opened, changing between views (TabItems, for example) takes a long time (few seconds) and it freezes the whole application (UI thread). The more DataGrids are loaded, the longer the change takes. These DataGrids that slow the UI chanage might be on other places in the app and not even visible at that moment. But once they are opened (and loaded with data), they slow showing other DataGrids. Note that DataGrids are NOT disposed and then recreated again, they still remain in memory, only their parent control is being hidden and visible again. I have profiled the application. It shows that agcore.dll's SetValue function is the bottleneck. Unfortunately, debug symbols are not available for this Silverlight native library responsible for drawing. The problem is not in the DataGrid control - I tried to replace it with XCeed's grid and the performance when changing views is even worse. Do you have any idea how to solve this problem? Why more opened controls slow down other controls? I have created a sample that shows this issue: http://cenud.cz/PerfTest.zip UPDATE: Using VS11 profiler on the sample provided suggests that the problem could be in MeasureOverride being called many times (for each DataGridCell, I guess). But still, why is it slower as more controls are loaded elsewhere? Is there a way to improve the performance?

  Read the article

• Trying to use jquery ui in google chrome extension in the content level

  - by user135697

  The problem is that the scope of the content script is on the web page that your plugin is suppose to be used at. So the css background:url(images/ui-bg_inset-hard_100_fcfdfd_1x100.png) becomes url('http://webpageforplugin/images/ui-bg_inset-hard_100_fcfdfd_1x100.png') in order for this to work as far as i understood i need to have it to point to: url('chrome-extension://extensionId/images/ui-bg_inset-hard_100_fcfdfd_1x100.png') So i tried to haxorz the document.styleSheets var ss = document.styleSheets; for (var i=0; i<ss.length; i++) { var found=-1, x,i; var rules = ss[i].cssRules || ss[i].rules; for (var j=0; j<rules.length; j++) { if ('.ui-helper-hidden'==rules[j].selectorText){ found=i; break; } } if (found>-1){ for (var j=0; j<rules.length; j++) { if (x=rules[j].style.background){ if ((i=x.indexOf('url'))!=-1) rules[j].style.background = x.replace('http://page/images/','chrome-extension://extensionId/images/'); } } break; } }; I feel that i'm missing the obvious. That there must be an easier way. Even if i manage to change this how will i get the extension id to build the string. Btw this doesn't work, the icons are not properly fetched. (I hardcoded the extension id) Any ideas?

  Read the article

• Manifesto for Integrated Development Environments

  - by Hugo S Ferreira

  Have you recently take a peek at Coda, or Espresso, or Textmate? Or even Google Chrome's Developer Tools? They are well designed, intuitive, interface rich, and extensible. But Coda, Espresso or Textmate, among several, are text editors, not IDEs. On the other side, VIM and Emacs live in the last century, and Eclipse is an overbloated platform. This is more like an outcry for a decent, common infrastructure for REAL IDEs. But there's some questions attached: (i) what features are needed for such a product and (ii) what products are out there that could fullfil this need, and what are they missing. So here's my draft for a manifesto: Manifesto for Integrated Development Environments: We favor interactivity and productivity over syntax and tools. We favor inline, contextual documentation over man and html files. We favor high-definition, graphic-capable color screens over 80x25 character terminals. We favor the use of advanced input schemas over unintuitive keyboard shortcuts. We favor a common, extensible and customizable infrastructure over unmaintained chaintools. We know the difference between search&replace and refactoring. We know the difference between integrated debugging support over a terminal window. We know the difference between semantic-aware code-completion over dumb textual templates. We favor the usage of standards like (E)BNF.

  Read the article

• Is there a FAST way to export and install an app on my phone, while signing it with my own keystore?

  - by Alexei Andreev

  So, I've downloaded my own application from the market and installed it on my phone. Now, I am trying to install a temporary new version from Eclipse, but here is the message I get: Re-installation failed due to different application signatures. You must perform a full uninstall of the application. WARNING: This will remove the application data! Please execute 'adb uninstall com.applicationName' in a shell. Launch canceled! Now, I really really don't want to uninstall the application, because I will lose all my data. One solution I found is to Export my application, creating new .apk, and then install it via HTC Sync (probably a different program based on what phone you have). The problem is this takes a long time to do, since I need to enter the password for the keystore each time and then wait for HTC Sync. It's a pain in the ass! So the question is: Is there a way to make Eclipse automatically use my keystore to sign the application (quickly and automatically)? Or perhaps to replace debug keystore with my own? Or perhaps just tell it to remember the password, so I don't have to enter it every time...? Or some other way to solve this problem?

  Read the article

• Given a typical Rails 3 environment, why am I unable to execute any tests?

  - by Tom

  I'm working on writing simple unit tests for a Rails 3 project, but I'm unable to actually execute any tests. Case in point, attempting to run the test auto-generated by Rails fails: require 'test_helper' class UserTest < ActiveSupport::TestCase # Replace this with your real tests. test "the truth" do assert true end end Results in the following error: <internal:lib/rubygems/custom_require>:29:in `require': no such file to load -- test_helper (LoadError) from <internal:lib/rubygems/custom_require>:29:in `require' from user_test.rb:1:in `<main>' Commenting out the require 'test_helper' line and attempting to run the test results in this error: user_test.rb:3:in `<main>': uninitialized constant Object::ActiveSupport (NameError) The action pack gems appear to be properly installed and up to date: actionmailer (3.0.3, 2.3.5) actionpack (3.0.3, 2.3.5) activemodel (3.0.3) activerecord (3.0.3, 2.3.5) activeresource (3.0.3, 2.3.5) activesupport (3.0.3, 2.3.5) Ruby is at 1.9.2p0 and Rails is at 3.0.3. The sample dump of my test directory is as follows: /fixtures /functional /integration /performance /unit -- /helpers -- user_helper_test.rb -- user_test.rb test_helper.rb I've never seen this problem before - I've run the typical rake tasks for preparing the test environment. I have nothing out of the ordinary in my application or environment configuration files, nor have I installed any unusual gems that would interfere with the test environment. Edit Xavier Holt's suggestion, explicitly specifying the path to the test_helper worked; however, this revealed an issue with ActiveSupport. Now when I attempt to run the test, I receive the following error message (as also listed above): user_test.rb:3:in `<main>': uninitialized constant Object::ActiveSupport (NameError) But as you can see above, Action Pack is all installed and update to date.

  Read the article

• How to set HTMLField's widget's height in Admin?

  - by Georgie Porgie

  I have a HTMLField in a model as it's the laziest way to utilize tinymce widget in Admin. But the problem is that the textarea field doesn't have "rows" property set. So the textarea doesn't have enough height comfortable enough for editing in Admin. Is there any way to set the height of HTMLField without defining a ModelAdmin class? Update: I solved the problem by using the following code: def create_mce_formfield(db_field): return db_field.formfield(widget = TinyMCE( attrs = {'cols': 80, 'rows': 30}, mce_attrs = { 'external_link_list_url': reverse('tinymce.views.flatpages_link_list'), 'plugin_preview_pageurl': reverse('tinymce-preview', args= ('tinymce',)), 'plugins': "safari,pagebreak,style,layer,table,save,advhr,advimage,advlink,emotions,iespell,inlinepopups,insertdatetime,preview,media,searchreplace,print,contextmenu,paste,directionality,fullscreen,noneditable,visualchars,nonbreaking,xhtmlxtras,template", 'theme_advanced_buttons1': "save,newdocument,|,bold,italic,underline,strikethrough,|,justifyleft,justifycenter,justifyright,justifyfull,styleselect,formatselect,fontselect,fontsizeselect", 'theme_advanced_buttons2': "cut,copy,paste,pastetext,pasteword,|,search,replace,|,bullist,numlist,|,outdent,indent,blockquote,|,undo,redo,|,link,unlink,anchor,image,cleanup,help,code,|,insertdate,inserttime,preview,|,forecolor,backcolor", 'theme_advanced_buttons3': "tablecontrols,|,hr,removeformat,visualaid,|,sub,sup,|,charmap,emotions,iespell,media,advhr,|,print,|,ltr,rtl,|,fullscreen", 'theme_advanced_buttons4': "insertlayer,moveforward,movebackward,absolute,|,styleprops,|,cite,abbr,acronym,del,ins,attribs,|,visualchars,nonbreaking,template,pagebreak", 'theme_advanced_toolbar_location': "top", 'theme_advanced_toolbar_align': "left", 'theme_advanced_statusbar_location': "bottom", 'theme_advanced_resizing': True, 'extended_valid_elements': "iframe[src|title|width|height|allowfullscreen|frameborder|webkitAllowFullScreen|mozallowfullscreen|allowFullScreen]", }, )) class TinyMCEFlatPageAdmin(FlatPageAdmin): def formfield_for_dbfield(self, db_field, **kwargs): if db_field.name == 'content': return create_mce_formfield(db_field) return super(TinyMCEFlatPageAdmin, self).formfield_for_dbfield(db_field, **kwargs)

  Read the article

• problems with async jquery and loops

  - by Seth Vargo

  I am so confused. I am trying to append portals to a page by looping through an array and calling a method I wrote called addModule(). The method gets called the right number of times (checked via an alert statement), in the correct order, but only one or two of the portals actually populate. I have a feeling its something with the loop and async, but it's easier explained with the code: moduleList = [['weather','test'],['test']]; for(i in moduleList) { $('#content').append(''); for(j in moduleList[i]) { addModule(i,moduleList[i][j]); //column,name } } function addModule(column,name) { alert('adding module ' + name); $.get('/modules/' + name.replace(' ','-') + '.php',function(data){ $('#'+column).append(data); }); } for each array in the main array, I append a new column, since that's what each sub-array is - a column of portals. Then I loop through that sub array and call addModule on that column and the name of that module (which works correctly). Something buggy happens in my addModule method that it only adds the first and last modules, or sometimes a middle one, or sometimes none at all... im so confused!

  Read the article

• is using private shared objects/variables on class level harmful ?

  - by haansi

  Hello, Thanks for your attention and time. I need your opinion on an basic architectural issue please. In page behind classes I am using a private and shared object and variables (list or just client or simplay int id) to temporary hold data coming from database or class library. This object is used temporarily to catch data and than to return, pass to some function or binding a control. 1st: Can this approach harm any way ? I couldn't analyze it but a thought was using such shared variables may replace data in it when multiple users may be sending request at a time? 2nd: Please comment also on using such variables in BLL (to hold data coming from DAL/database). In this example every time new object of BLL class will be made. Here is sample code: public class ClientManager { Client objclient = new Client(); //Used in 1st and 2nd method List<Client> clientlist = new List<Client>();// used in 3rd and 4th method ClientRepository objclientRep = new ClientRepository(); public List<Client> GetClients() { return clientlist = objclientRep.GetClients(); } public List<Client> SearchClients(string Keyword) { return clientlist = objclientRep.SearchClients(Keyword); } public Client GetaClient(int ClientId) { return objclient = objclientRep.GetaClient(ClientId); } public Client GetClientDetailForConfirmOrder(int UserId) { return objclientRep.GetClientDetailForConfirmOrder(UserId); } } I am really thankful to you for sparing time and paying kind attention.

  Read the article

• [CODE GENERATION] How to generate DELETE statements in PL/SQL, based on the tables FK relations?

  - by The chicken in the kitchen

  Is it possible via script/tool to generate authomatically many delete statements based on the tables fk relations, using Oracle PL/SQL? In example: I have the table: CHICKEN (CHICKEN_CODE NUMBER) and there are 30 tables with fk references to its CHICKEN_CODE that I need to delete; there are also other 150 tables foreign-key-linked to that 30 tables that I need to delete first. Is there some tool/script PL/SQL that I can run in order to generate all the necessary delete statements based on the FK relations for me? (by the way, I know about cascade delete on the relations, but please pay attention: I CAN'T USE IT IN MY PRODUCTION DATABASE, because it's dangerous!) I'm using Oracle DataBase 10G R2. This is the result I've written, but it is not recursive: This is a view I have previously written, but of course it is not recursive! CREATE OR REPLACE FORCE VIEW RUN ( OWNER_1, CONSTRAINT_NAME_1, TABLE_NAME_1, TABLE_NAME, VINCOLO ) AS SELECT OWNER_1, CONSTRAINT_NAME_1, TABLE_NAME_1, TABLE_NAME, '(' || LTRIM ( EXTRACT (XMLAGG (XMLELEMENT ("x", ',' || COLUMN_NAME)), '/x/text()'), ',') || ')' VINCOLO FROM ( SELECT CON1.OWNER OWNER_1, CON1.TABLE_NAME TABLE_NAME_1, CON1.CONSTRAINT_NAME CONSTRAINT_NAME_1, CON1.DELETE_RULE, CON1.STATUS, CON.TABLE_NAME, CON.CONSTRAINT_NAME, COL.POSITION, COL.COLUMN_NAME FROM DBA_CONSTRAINTS CON, DBA_CONS_COLUMNS COL, DBA_CONSTRAINTS CON1 WHERE CON.OWNER = 'TABLE_OWNER' AND CON.TABLE_NAME = 'TABLE_OWNED' AND ( (CON.CONSTRAINT_TYPE = 'P') OR (CON.CONSTRAINT_TYPE = 'U')) AND COL.TABLE_NAME = CON1.TABLE_NAME AND COL.CONSTRAINT_NAME = CON1.CONSTRAINT_NAME --AND CON1.OWNER = CON.OWNER AND CON1.R_CONSTRAINT_NAME = CON.CONSTRAINT_NAME AND CON1.CONSTRAINT_TYPE = 'R' GROUP BY CON1.OWNER, CON1.TABLE_NAME, CON1.CONSTRAINT_NAME, CON1.DELETE_RULE, CON1.STATUS, CON.TABLE_NAME, CON.CONSTRAINT_NAME, COL.POSITION, COL.COLUMN_NAME) GROUP BY OWNER_1, CONSTRAINT_NAME_1, TABLE_NAME_1, TABLE_NAME; ... and it contains the error of using DBA_CONSTRAINTS instead of ALL_CONSTRAINTS...

  Read the article

• Changing default compiler in Linux, using SCons

  - by ereOn

  On my Linux platform, I have several versions of gcc. Under usr/bin I have: gcc34 gcc44 gcc Here are some outputs: $ gcc --version gcc (GCC) 4.1.2 20080704 (Red Hat 4.1.2-48) $ gcc44 --version gcc44 (GCC) 4.4.0 20090514 (Red Hat 4.4.0-6) I need to use the 4.4 version of gcc however the default seems to the 4.1 one. I there a way to replace /usr/bin/gcc and make gcc44 the default compiler not using a symlink to /usr/bin/gcc44 ? The reason why I can't use a symlink is because my code will have to be shipped in a RPM package using mock. mock creates a minimal linux installation from scratch and just install the specified dependencies before compiling my code in it. I cannot customize this "minimal installation". Ideally, the perfect solution would be to install an official RPM package that replaces gcc with gcc44 as the default compiler. Is there such a package ? Is this even possible/good ? Additional information I have to use SCons (a make alternative) and it doesn't let me specify the binary to use for gcc. I will also accept any answer that will tell me how to specify the gcc binary in my SConstruct file.

  Read the article

• Matlab GUI - How to get the previous value entered from a callback function?

  - by Graham

  Hi, I know that this is probably a simple problem but I am new to Matlab GUI's and basically want to get the old value which used to be stored in the text box to replace the value which has just been entered. E.g. Text box contains a valid string, User enters invalid string, Callback func, validates input and realises new input is an error and reverts to the old previous value. How should this be implemented or done? Atm I am just using the get and set property values. Below is some sample code: function sampledist_Callback(hObject, eventdata, handles) % hObject handle to sampledist (see GCBO) % eventdata reserved - to be defined in a future version of MATLAB % handles structure with handles and user data (see GUIDATA) % Hints: get(hObject,'String') returns contents of sampledist as text % str2double(get(hObject,'String')) returns contents of sampledist as a double input = str2double(get(hObject,'String')); if(input < 0 || input > 500) errordlg('Sampled Dist. must be > 0 and < 500','Sample Dist - Input Error'); set(handles.sampledist,'String',['10']); %<--- I would like this value 10 to be the previous entry! guidata(hObject,handles); else set(handles.sampledist,'String',['',input]); guidata(hObject,handles); end

  Read the article

• IntelliJ Doesn't Notice Changes in Interface

  - by yar

  [I've decided to give IntelliJ another go (to replace Eclipse), since its Groovy support is supposed to be the best. But back to Java...] I have an Interface that defines a constant public static final int CHANNEL_IN = 1; and about 20 classes in my Module that implement that interface. I've decided that this constant was a bad idea so I did what I do in Eclipse: I deleted the entire line. This should cause the Project tree to light up like a Christmas tree and all classes that implement that interface and use that constant to break. Instead, this is not happening. If I don't actually double-click on the relevant classes -- which I find using grep -- the module even builds correctly (using Build - Make Module). If I double-click on a relevant class, the error is shown both in the Project Tree and in the Editor. I am not able to replicate this behavior in small tests, but in large modules it works (incorrectly) this way. Is there some relevant setting in IntelliJ for this?

  Read the article

• Starting Beyond Compare from the Command Line

  - by Logan

  I have Beyond Compare 3 installed at; "C:\Program Files\Beyond Compare 3\BCompare.exe" and Cygwin; "C:\Cygwin\bin\bash.exe" What I would like is to be able to use a command such as; diff <file1> <file2> into the Cygwin shell and to have the shell fork a process opening the two files in beyond compare. I looked at the Beyond Compare Support Page but I'm afraid It was too brief for me. I tried copying the text verbatim (apart from path to executable) to no avail; Instead of using a batch file, create a file named "bc.sh" with the following line: "$(cygpath 'C:\Progra~1\Beyond~1\bcomp.exe')" `cygpath -w "$6"` `cygpath -w "$7"` /title1="$3" /title2="$5" /readonly Was I supposed to replace cygpath? I get a 'Command not found' error when I enter the name of the script on the command line. gavina@whwgavina1 /cygdrive $ "C:\Documents and Settings\gavina\Desktop\bc.sh" bash: C:\Documents and Settings\gavina\Desktop\bc.sh: command not found Does anyone have Beyond Compare working as I have described? Is this even possible in a Windows environment? Thanks in advance!

  Read the article

• prototype findElements querySelectorAll error

  - by JD

  i'm call the "down" function but am getting an invalid argument using 1.6.1_rc2 here's the html snippet: <TR id=000000214A class="activeRow searchResultsDisplayOver" conceptID="0000001KIU"> <TD> <DIV class=gridRowWrapper> <SPAN class=SynDesc>Asymmetric breasts</SPAN> <DIV class=buttonWrapper> <SPAN class=btnAddFav title="Add to Favorites">&nbsp;</SPAN> </DIV> </DIV> </TD> </TR> here's the code: var description = row.down('span.SynDesc').innerHTML; row is a dom reference to the element. prototype is appending a # then the id of the element: findElements: function(root) { root = root || document; var e = this.expression, results; switch (this.mode) { case 'selectorsAPI': if (root !== document) { var oldId = root.id, id = $(root).identify(); id = id.replace(/[\.:]/g, "\\$0"); e = "#" + id + " " + e; } results = $A(root.querySelectorAll(e)).map(Element.extend); <-- e = "#000000214A span.SynDesc" root.id = oldId; return results; case 'xpath': return document._getElementsByXPath(this.xpath, root); default: return this.matcher(root); } i get an "invalid argument" error? if i put a breakpoint before the offending line and change e to be equal to "span.SynDesc" it works fine. help. :)

  Read the article

• Latex - Apply an operation to every character in a string

  - by hroest

  Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

  Read the article

• Updating Android Tab Icons

  - by lnediger

  I have an activity which has a TabHost containing a set of TabSpecs each with a listview containing the items to be displayed by the tab. When each TabSpec is created, I set an icon to be displayed in the tab header. The TabSpecs are created in this way within a setupTabs() method which loops to create the appropriate number of tabs: TabSpec ts = mTabs.newTabSpec("tab"); ts.setIndicator("TabTitle", iconResource); ts.setContent(new TabHost.TabContentFactory( { public View createTabContent(String tag) { ... } }); mTabs.addTab(ts); There are a couple instances where I want to be able to change the icon which is displayed in each tab during the execution of my program. Currently I am deleting all the tabs, and calling the above code again to re-create them. mTabs.getTabWidget().removeAllViews(); mTabs.clearAllTabs(true); setupTabs(); Is there a way to replace the icon that is being displayed without deleting and re-creating all of the tabs?

  Read the article

• Manually Trigger or Prevent Javascript Lazy Loading in Website from Bookmarklet

  - by stwhite

  One of the problems with using a bookmarklet for grabbing images on a page is that if a website uses lazy loading, the bookmarklet won't detect the image because it will have a placeholder, e.g. "grey.gif" and not the actual source of the image. Javascript on page load, is run to replace these urls. I'm looking for a solution to retrieve those images that are not being displayed by either triggering or preventing Lazy Loading from running. This bookmarklet isn't limited to one specific domain. So far some ideas I've had are: Ping the domain and retrieve the page html if no images are found the first time around: Problem: this then requires parsing the actual html. Problem: with lazy loading, a few images will always show, just none below the fold. Scroll page to initiate lazy loading when bookmarklet is clicked, then scroll back to top. Trigger Lazy Loading from inside bookmarklet using script. Lazy Loader adds the "original" attribute, potentially could check if attribute exists w/ value. Problem: ???

  Read the article

• Problem in Application_Error in Global.asax

  - by mmtemporary

  my problem is User.Identity.Name or Request.Url.AbsoluteUri in exception handling is empty when exception email to me. this is Application_Code: void Application_Error(object sender, EventArgs e) { Server.Transfer("~/errors/default.aspx"); } and this is default.aspx code: protected void Page_Load(object sender, EventArgs e) { if (Server.GetLastError() == null) return; Exception ex = Server.GetLastError().GetBaseException(); if (ex == null) return; string message = string.Format("User: ", User.Identity.Name); message += Environment.NewLine; message += string.Format("AbsoluteUri: ", Request.Url.AbsoluteUri); message += Environment.NewLine; message += string.Format("Form: ", Request.Form.ToString()); message += Environment.NewLine; message += string.Format("QueryString: ", Request.QueryString.ToString()); message += Environment.NewLine; HttpBrowserCapabilities browser = Request.Browser; string s = "Browser Capabilities:\n" + "Type = " + browser.Type + "\n" + "Name = " + browser.Browser + "\n" + "Version = " + browser.Version + "\n" + "Platform = " + browser.Platform + "\n" + "Is Crawler = " + browser.Crawler + "\n" + "Supports Cookies = " + browser.Cookies + "\n" + "Supports JavaScript = " + browser.EcmaScriptVersion.ToString() + "\n" + "\n"; message += s; message += Environment.NewLine; message += ex.ToString(); Exception lastException = (Exception)Application["LastException"]; if (lastException == null || lastException.Message != ex.Message) { Application.Lock(); Application["LastException"] = ex; Application.UnLock(); SiteHelper.SendEmail(SiteHelper.AdministratorEMail, "Error!!!", message, false); } Server.ClearError(); } but i receive email like this (this is header without full exception content): User: AbsoluteUri: Form: QueryString: Browser Capabilities: Type = IE8 Name = IE Version = 8.0 Platform = WinXP Is Crawler = False Supports Cookies = True Supports JavaScript = 1.2 why username and request url is emty? this problem is exist when i replace transfer with redirect or i don't use both. tanx

  Read the article

< Previous Page | 317 318 319 320 321 322 323 324 325 326 327 328  | Next Page >