Search Results

Search found 9889 results on 396 pages for 'pointer speed'.

Page 322/396 | < Previous Page | 318 319 320 321 322 323 324 325 326 327 328 329  | Next Page >

  • My button background seems stretched.

    - by Kyle Sevenoaks
    Hi, I have a button as made for you to see here. Looks fine,right? Well on the live site, euroworker.no/shipping it seems stretched. Renders fine in Chrome, IE and Safari, I thought it might have been a FF issue, but loaded the fiddle into FF and seems fine. Quick ref CSS and html: #fortsett_btn { background-image: url(http://euroworker.no/public/upload/fortsett.png?1269434047); background-repeat:no-repeat; background-position:left; background-color:none; border:none; outline;none; visibility: visible; position: relative; z-index: 2; width: 106px; height: 25px; cursor:pointer; }? And HTML <button type="submit" class="submit" id="fortsett_btn" title="Fortsett" value="">&nbsp;</button>? I wonder what's up with it.

    Read the article

  • What strategy do you use to sync your code when working from home

    - by Ben Daniel
    At my work I currently have my development environment inside a Virtual Machine. When I need to do work from home I copy my VM and any databases I need onto a laptop drive sized external USB drive. After about 10 minutes of copying I put the drive in my pocket and head home, copy back the VM and databases onto my personal computer and I'm ready to work. I follow the same steps to take the work back with me. So if I count the total amount of time I spend waiting around for files to finish copying in order for me to take work home and bring it back again, it comes to around 40 minutes! I do have a VPN connection to my work from home (providing the internet is up at both sites) and a decent internet speed (8mbits down/?up) but I find Remote Desktoping into my work machine laggy enough for me to want to work on my VM directly. So in looking at what other options I have or how I could improve my existing option I'm interested in what strategy you use or recommend to do work at home and keeping your code/environment in sync. EDIT: I'd prefer an option where I don't have to commit my changes into version control before I leave work - as I like to make meaningful descriptive comments in my commits, committing would take longer than just copying my VM onto a portable drive! lol Also I'd prefer a solution where my dev environment stays in sync too. Having said that I'm still very interested in your own solutions even if they don't exactly solve my problem as best as I'd like. :)

    Read the article

  • Is SQLDataReader slower than using the command line utility sqlcmd?

    - by Andrew
    I was recently advocating to a colleague that we replace some C# code that uses the sqlcmd command line utility with a SqlDataReader. The old code uses: System.Diagnostics.ProcessStartInfo procStartInfo = new System.Diagnostics.ProcessStartInfo("cmd", "/c " + sqlCmd); wher sqlCmd is something like "sqlcmd -S " + serverName + " -y 0 -h-1 -Q " + "\"" + "USE [" + database + "]" + ";+ txtQuery.Text +"\"";\ The results are then parsed using regular expressions. I argued that using a SQLDataReader woud be more in line with industry practices, easier to debug and maintain and probably faster. However, the SQLDataReader approach is at least the same speed and quite possibly slower. I believe I'm doing everything correctly with SQLDataReader. The code is: using (SqlConnection connection = new SqlConnection()) { try { SqlConnectionStringBuilder builder = new SqlConnectionStringBuilder(connectionString); connection.ConnectionString = builder.ToString(); ; SqlCommand command = new SqlCommand(queryString, connection); connection.Open(); SqlDataReader reader = command.ExecuteReader(); // do stuff w/ reader reader.Close(); } catch (Exception ex) { outputMessage += (ex.Message); } } I've used System.Diagnostics.Stopwatch to time both approaches and the command line utility (called from C# code) does seem faster (20-40%?). The SqlDataReader has the neat feature that when the same code is called again, it's lightening fast, but for this application we don't anticipate that. I have already done some research on this problem. I note that the command line utility sqlcmd uses OLE DB technology to hit the database. Is that faster than ADO.NET? I'm really suprised, especially since the command line utility approach involves starting up a process. I really thought it would be slower. Any thoughts? Thanks, Dave

    Read the article

  • Hooking thread exit

    - by mackenir
    Is there a way for me to hook the exit of managed threads (i.e. run some code on a thread, just before it exits?) I've developed a mechanism for hooking thread exit that works for some threads. Step 1: develop a 'hook' STA COM class that takes a callback function and calls it in its destructor. Step 2: create a ThreadStatic instance of this object on the thread I want to hook, and pass the object a managed delegate converted to an unmanaged function pointer. The delegate then gets called on thread exit (since the CLR calls IUnknown::Release on all STA COM RCWs as part of thread exit). This mechanism works on, for example, worker threads that I create in code using the Thread class. However, it doesn't seem to work for the application's main thread (be it a console or windows app). The 'hook' COM object seems to be deleted too late in the shutdown process and the attempt to call the delegate fails. (The reason I want to implement this facility is so I can run some native COM code on the exiting thread that works with STA COM objects that were created on the thread, before it's 'too late' (i.e. before the thread has exited, and it's no longer possible to work with STA COM objects on that thread.))

    Read the article

  • realloc() & ARC

    - by RynoB
    How would I be able to rewrite the the following utility class to get all the class string values for a specific type - using the objective-c runtime functions as shown below? The ARC documentation specifically states that realloc should be avoided and I also get the following compiler error on this this line: classList = realloc(classList, sizeof(Class) * numClasses); "Implicit conversion of a non-Objective-C pointer type 'void *' to '__unsafe_unretained Class *' is disallowed with ARC" The the below code is a reference to the original article which can be found here. + (NSArray *)classStringsForClassesOfType:(Class)filterType { int numClasses = 0, newNumClasses = objc_getClassList(NULL, 0); Class *classList = NULL; while (numClasses < newNumClasses) { numClasses = newNumClasses; classList = realloc(classList, sizeof(Class) * numClasses); newNumClasses = objc_getClassList(classList, numClasses); } NSMutableArray *classesArray = [NSMutableArray array]; for (int i = 0; i < numClasses; i++) { Class superClass = classList[i]; do { superClass = class_getSuperclass(superClass); if (superClass == filterType) { [classesArray addObject:NSStringFromClass(classList[i])]; break; } } while (superClass); } free(classList); return classesArray; } Your help will be much appreciated. Thanks

    Read the article

  • How to temporarily replace one primitive type with another when compiling to different targets in c#

    - by Keith
    How to easily/quickly replace float's for doubles (for example) for compiling to two different targets using these two particular choices of primitive types? Discussion: I have a large amount of c# code under development that I need to compile to alternatively use float, double or decimals depending on the use case of the target assembly. Using something like “class MYNumber : Double” so that it is only necessary to change one line of code does not work as Double is sealed, and obviously there is no #define in C#. Peppering the code with #if #else statements is also not an option, there is just too much supporting Math operators/related code using these particular primitive types. I am at a loss on how to do this apparently simple task, thanks! Edit: Just a quick comment in relation to boxing mentioned in Kyles reply: Unfortunately I need to avoid boxing, mainly since float's are being chosen when maximum speed is required, and decimals when maximum accuracy is the priority (and taking the 20x+ performance hit is acceptable). Boxing would probably rules out decimals as a valid choice and defeat the purpose somewhat. Edit2: For reference, those suggesting generics as a possible answer to this question note that there are many issues which count generics out (at least for our needs). For an overview and further references see Using generics for calculations

    Read the article

  • Does GC guarantee that cleared References are enqueued to ReferenceQueue in topological order?

    - by Dimitris Andreou
    Say there are two objects, A and B, and there is a pointer A.x --> B, and we create, say, WeakReferences to both A and B, with an associated ReferenceQueue. Assume that both A and B become unreachable. Intuitively B cannot be considered unreachable before A is. In such a case, do we somehow get a guarantee that the respective references will be enqueued in the intuitive (topological when there are no cycles) order in the ReferenceQueue? I.e. ref(A) before ref(B). I don't know - what if the GC marked a bunch of objects as unreachable, and then enqueued them in no particular order? I was reviewing Finalizer.java of guava, seeing this snippet: private void cleanUp(Reference<?> reference) throws ShutDown { ... if (reference == frqReference) { /* * The client no longer has a reference to the * FinalizableReferenceQueue. We can stop. */ throw new ShutDown(); } frqReference is a PhantomReference to the used ReferenceQueue, so if this is GC'ed, no Finalizable{Weak, Soft, Phantom}References can be alive, since they reference the queue. So they have to be GC'ed before the queue itself can be GC'ed - but still, do we get the guarantee that these references will be enqueued to the ReferenceQueue at the order they get "garbage collected" (as if they get GC'ed one by one)? The code implies that there is some kind of guarantee, otherwise unprocessed references could theoretically remain in the queue. Thanks

    Read the article

  • What is more viable to use? Javascript libraries or UI Programming tools?

    - by Haresh Karkar
    What is more viable to use:- Javascript Libraries: YUI, jQuery, ExtJs OR UI Programming tools: GWT, ExtGWT, SmartGWT It has become very difficult to choose between them as they are constantly increasing their capabilities to meet newer requirements. We all know the power of jQuery in UI manipulations. The latest news from Microsoft about jQuery being officially part of .Net developr’s toolkit will definitely make jQuery a preferred choice against other JavaScript libraries [See link: http://weblogs.asp.net/scottgu/archive/2008/09/28/jquery-and-microsoft.aspx]. But on the other hand, GWT is building a framework which could be used on client as well as on the sever side. This is definitely going to make developers’ life easy as it does not require developer to be an expert in browser quirks, XMLHttpRequest, and JavaScript in order to develop high-performance web applications. It includes SDK (Java API libraries, compiler, and development server which allows to write client-side applications in Java and deploy them as JavaScript), Speed Tracer and plug-in for Eclipse. GWT is used by many products like Google Wave and AdWords. So question is still un-answered, what is more viable to use? Any thoughts?

    Read the article

  • Do overlays/tooltips work correctly in Emacs for Windows?

    - by Cheeso
    I'm using Flymake on C# code, emacs v22.2.1 on Windows. The Flymake stuff has been working well for me. For those who don't know, you can read an overview of flymake, but the quick story is that flymake repeatedly builds the source file you are currently working on in the background, for the purpose of doing syntax checking. It then highlights the compiler warnings and erros in the current buffer. Flymake didn't work for C# initially, but I "monkey-patched it" and it works nicely now. If you edit C# in emacs, I highly recommend using flymake. The only problem I have is with the UI. Flymake highlights the errors and warnings nicely, and then inserts "overlays" with the full error or warning text. IF I hover the mouse pointer over the highlighted line in code, the overlay pops up. But as you can see, the overlay (tooltip) is truncated, and it doesn't display correctly. Flymake seems to be doing the right thing, it's the overlay part that seems broken., and overlay seems to do the right thing. It's the tooltip that is displayed incorrectly. Do overlays tooltips work correctly in emacs for Windows? Where do I look to fix this?

    Read the article

  • TableView Cells unresponsive

    - by John Donovan
    I have a TableView and I wish to be able to press several cells one after the other and have messages appear. At the moment the cells are often unresponsive. I found some coed for a similar problem someone was kind enough to post, however, although he claimed it worked 100% it doesn't work for me. The app won't even build. Here's the code: -(UIView*) hitTest:(CGPoint)point withEvent:(UIEvent*)event { // check to see if the hit is in this table view if ([self pointInside:point withEvent:event]) { UITableViewCell* newCell = nil; // hit is in this table view, find out // which cell it is in (if any) for (UITableViewCell* aCell in self.visibleCells) { if ([aCell pointInside:[self convertPoint:point toView:aCell] withEvent:nil]) { newCell = aCell; break; } } // if it touched a different cell, tell the previous cell to resign // this gives it a chance to hide the keyboard or date picker or whatever if (newCell != activeCell) { [activeCell resignFirstResponder]; self.activeCell = newCell; // may be nil } } // return the super's hitTest result return [super hitTest:point withEvent:event]; } With this code I get this warning: that my viewController may not respond to pointsInside:withEvent (it's a TableViewController). I also get some faults: request for member 'visibleCells' in something not a structure or a union. incompatible type for argument 1 of pointInsideWithEvent, expression does not have a valid object type and similar. I must admit I'm not so good at reading other people's code but I was wondering whether the problems here are obvious and if so if anyone could give me a pointer it would be greatly appreciated.

    Read the article

  • How does virtual inheritance solve the diamond problem?

    - by cambr
    class A { public: void eat(){ cout<<"A";} }; class B: virtual public A { public: void eat(){ cout<<"B";} }; class C: virtual public A { public: void eat(){ cout<<"C";} }; class D: public B,C { public: void eat(){ cout<<"D";} }; int main(){ A *a = new D(); a->eat(); } I understand the diamond problem, and above piece of code does not have that problem. How exatly does virtual inheritance solve the problem? What I understand: When I say A *a = new D();, the compiler wants to know if an object of type D can be assigned to a pointer of type A, but it has two paths that it can follow, but cannot decide by itself. So, how does virtual inheritance resolve the issue (help compiler take the decision)?

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • How to mmap the stack for the clone() system call on linux?

    - by Joseph Garvin
    The clone() system call on Linux takes a parameter pointing to the stack for the new created thread to use. The obvious way to do this is to simply malloc some space and pass that, but then you have to be sure you've malloc'd as much stack space as that thread will ever use (hard to predict). I remembered that when using pthreads I didn't have to do this, so I was curious what it did instead. I came across this site which explains, "The best solution, used by the Linux pthreads implementation, is to use mmap to allocate memory, with flags specifying a region of memory which is allocated as it is used. This way, memory is allocated for the stack as it is needed, and a segmentation violation will occur if the system is unable to allocate additional memory." The only context I've ever heard mmap used in is for mapping files into memory, and indeed reading the mmap man page it takes a file descriptor. How can this be used for allocating a stack of dynamic length to give to clone()? Is that site just crazy? ;) In either case, doesn't the kernel need to know how to find a free bunch of memory for a new stack anyway, since that's something it has to do all the time as the user launches new processes? Why does a stack pointer even need to be specified in the first place if the kernel can already figure this out?

    Read the article

  • segmentation fault on Unix - possible stack corruption

    - by bob
    hello, i'm looking at a core from a process running in Unix. Usually I can work my around and root into the backtrace to try identify a memory issue. In this case, I'm not sure how to proceed. Firstly the backtrace only gives 3 frames where I would expect alot more. For those frames, all the function parameters presented appears to completely invalid. There are not what I would expect. Some pointer parameters have the following associated with them - Cannot access memory at address Would this suggest some kind of complete stack corruption. I ran the process with libumem and all the buffers were reported as being clean. umem_status reported nothing either. so basically I'm stumped. What is the likely causes? What should I look for in code since libumem appears to have reported no errors. Any suggestions on how I can debug furhter? any extra features in mdb I should consider? thank you.

    Read the article

  • How to select and crop an image in android?

    - by Guy
    Hey, I am currently working on a live wallpaper and I allow the user to select an image which will go behind my effects. Currently I have: Intent i = new Intent(Intent.ACTION_PICK, android.provider.MediaStore.Images.Media.EXTERNAL_CONTENT_URI); i.putExtra("crop", "true"); startActivityForResult(i, 1); And slightly under that: @Override public void onActivityResult(int requestCode, int resultCode, Intent data) { super.onActivityResult(requestCode, resultCode, data); if (requestCode == 1) if (resultCode == Activity.RESULT_OK) { Uri selectedImage = data.getData(); Log.d("IMAGE SEL", "" + selectedImage); // TODO Do something with the select image URI SharedPreferences customSharedPreference = getSharedPreferences("imagePref", Activity.MODE_PRIVATE); SharedPreferences.Editor editor = customSharedPreference.edit(); Log.d("HO", "" + selectedImage); editor.putString("imagePref", getRealPathFromURI(selectedImage)); Log.d("IMAGE SEL", getRealPathFromURI(selectedImage)); editor.commit(); } } When my code is ran, Logcat tells me that selectedImage is null. If I comment out the i.putExtra("crop", "true"): Logcat does not give me the null pointer exception, and I am able to do what I want with the image. So, what is the problem here? Does any one have any idea how I can fix this? Thanks, for your time.

    Read the article

  • Where's the Win32 resource for the mouse cursor for dragging splitters?

    - by Luther Baker
    I am building a custom win32 control/widget and would like to change the cursor to a horizontal "splitter" symbol when hovering over a particular vertical line in the control. IE: I want to drag this vertical line (splitter bar) left and right (WEST and EAST). Of the the system cursors (OCR_*), the only cursor that makes sense is the OCR_SIZEWE. Unfortunately, that is the big, awkward cursor the system uses when resizing a window. Instead, I am looking for the cursor that is about 20 pixels tall and around 3 or 4 pixel wide with two small arrows pointing left and right. I can easily draw this and include it as a resource in my application but the cursor itself is so prevalent that I wanted to be sure it wasn't missing something. For example: when you use the COM drag and drop mechanism (CLSID_DragDropHelper, IDropTarget, etc) you implicitly have access to the "drag" icon (little box under the pointer). I didn't see an explicit OCR_* constant for this guy ... so likewise, if I can't find this splitter cursor outright, I am wondering if it is part of a COM object or something else in the win32 lib.

    Read the article

  • Refactoring ADO.NET - SqlTransaction vs. TransactionScope

    - by marc_s
    I have "inherited" a little C# method that creates an ADO.NET SqlCommand object and loops over a list of items to be saved to the database (SQL Server 2005). Right now, the traditional SqlConnection/SqlCommand approach is used, and to make sure everything works, the two steps (delete old entries, then insert new ones) are wrapped into an ADO.NET SqlTransaction. using (SqlConnection _con = new SqlConnection(_connectionString)) { using (SqlTransaction _tran = _con.BeginTransaction()) { try { SqlCommand _deleteOld = new SqlCommand(......., _con); _deleteOld.Transaction = _tran; _deleteOld.Parameters.AddWithValue("@ID", 5); _con.Open(); _deleteOld.ExecuteNonQuery(); SqlCommand _insertCmd = new SqlCommand(......, _con); _insertCmd.Transaction = _tran; // add parameters to _insertCmd foreach (Item item in listOfItem) { _insertCmd.ExecuteNonQuery(); } _tran.Commit(); _con.Close(); } catch (Exception ex) { // log exception _tran.Rollback(); throw; } } } Now, I've been reading a lot about the .NET TransactionScope class lately, and I was wondering, what's the preferred approach here? Would I gain anything (readibility, speed, reliability) by switching to using using (TransactionScope _scope = new TransactionScope()) { using (SqlConnection _con = new SqlConnection(_connectionString)) { .... } _scope.Complete(); } What you would prefer, and why? Marc

    Read the article

  • Replacing/Extending Visual Studio's Generate Stub in Visual Studio 2010

    - by devoured elysium
    When we write the name of a method that doesn't exist, Visual Studio 2010 asks us if we'd like to generate a method stub with that name. What I'd like to know if is it possible to replace that same code stub generating command with one made by myself. I never did any kind of extensibility programming for Visual Studio so I have a couple of questions: How hard is it? Is it something I can learn in a couple of nights, or is it something that'll make me "lose" a lot of time? It seems to me that there isn't a lot of support for that kind of programming, as generally people are not that interested in developing solutions that extend the Visual Studio IDE. I searched on SO and it doesn't appear to have many threads about extending Visual Studio. I don't know how the generate method stub thing works in Visual Studio, but I just wanted to turn it into something a bit more flexible and useful. Has anyone dealt with these kind of things before, that can give me a pointer to where to start? I know of MS VSX site but that has a lot of resources and can be overwhelming for someone new to the subject as I am. What technology will I need to use? T4? Maybe I'll need to know a lot about the code, like Visual Studio does, so I can know other method's type arguments, names, etc. Is that what T4 is for? Thanks

    Read the article

  • Passing VB Callback function to C dll - noob is stuck.

    - by WaveyDavey
    Callbacks in VB (from C dll). I need to pass a vb function as a callback to a c function in a dll. I know I need to use addressof for the function but I'm getting more and more confused as to how to do it. Details: The function in the dll that I'm passing the address of a callback to is defined in C as : PaError Pa_OpenStream( PaStream** stream, const PaStreamParameters *inputParameters, const PaStreamParameters *outputParameters, double sampleRate, unsigned long framesPerBuffer, PaStreamFlags streamFlags, PaStreamCallback *streamCallback, void *userData ); where the function is parameter 7, *streamCallback. The type PaStreamCallback is defines thusly: typedef int PaStreamCallback( const void *input, void *output, unsigned long frameCount, const PaStreamCallbackTimeInfo* timeInfo, PaStreamCallbackFlags statusFlags, void *userData ); In my vb project I have: Private Declare Function Pa_OpenStream Lib "portaudio_x86.dll" _ ( ByVal stream As IntPtr _ , ByVal inputParameters As IntPtr _ , ByVal outputParameters As PaStreamParameters _ , ByVal samprate As Double _ , ByVal fpb As Double _ , ByVal paClipoff As Long _ , ByVal patestCallBack As IntPtr _ , ByVal data As IntPtr) As Integer (don't worry if I've mistyped some of the other parameters, I'll get to them later! Let's concentrate on the callback for now.) In module1.vb I have defined the callback function: Function MyCallback( ByVal inp As Byte, _ ByVal outp As Byte, _ ByVal framecount As Long, _ ByVal pastreamcallbacktimeinfo As Byte, _ ByVal pastreamcallbackflags As Byte, _ ByVal userdata As Byte) As Integer ' do clever things here End Function The external function in the dll is called with err = Pa_OpenStream( ptr, _ nulthing, _ outputParameters, _ SAMPLE_RATE, _ FRAMES_PER_BUFFER, _ clipoff, _ AddressOf MyCallback, _ dataptr) This is broken in the declaration of the external function - it doesn't like the type IntPtr as a function pointer for AddressOf. Can anyone show me how to implement passing this callback function please ? Many thanks David

    Read the article

  • Haskell Linear Algebra Matrix Library for Arbitrary Element Types

    - by Johannes Weiß
    I'm looking for a Haskell linear algebra library that has the following features: Matrix multiplication Matrix addition Matrix transposition Rank calculation Matrix inversion is a plus and has the following properties: arbitrary element (scalar) types (in particular element types that are not Storable instances). My elements are an instance of Num, additionally the multiplicative inverse can be calculated. The elements mathematically form a finite field (??2256). That should be enough to implement the features mentioned above. arbitrary matrix sizes (I'll probably need something like 100x100, but the matrix sizes will depend on the user's input so it should not be limited by anything else but the memory or the computational power available) as fast as possible, but I'm aware that a library for arbitrary elements will probably not perform like a C/Fortran library that does the work (interfaced via FFI) because of the indirection of arbitrary (non Int, Double or similar) types. At least one pointer gets dereferenced when an element is touched (written in Haskell, this is not a real requirement for me, but since my elements are no Storable instances the library has to be written in Haskell) I already tried very hard and evaluated everything that looked promising (most of the libraries on Hackage directly state that they wont work for me). In particular I wrote test code using: hmatrix, assumes Storable elements Vec, but the documentation states: Low Dimension : Although the dimensionality is limited only by what GHC will handle, the library is meant for 2,3 and 4 dimensions. For general linear algebra, check out the excellent hmatrix library and blas bindings I looked into the code and the documentation of many more libraries but nothing seems to suit my needs :-(. Update Since there seems to be nothing, I started a project on GitHub which aims to develop such a library. The current state is very minimalistic, not optimized for speed at all and only the most basic functions have tests and therefore should work. But should you be interested in using or helping out developing it: Contact me (you'll find my mail address on my web site) or send pull requests.

    Read the article

  • understanding valgrind output

    - by sbsp
    Hi, i made a post earlier asking about checking for memory leaks etc, i did say i wasnt to familiar with the terminal in linux but someone said to me it was easy with valgrind i have managed to get it running etc but not to sure what the output means. Glancing over, all looks good to me but would like to run it past you experience folk for confirmation if possible. THe output is as follows ^C==2420== ==2420== HEAP SUMMARY: ==2420== in use at exit: 2,240 bytes in 81 blocks ==2420== total heap usage: 82 allocs, 1 frees, 2,592 bytes allocated ==2420== ==2420== LEAK SUMMARY: ==2420== definitely lost: 0 bytes in 0 blocks ==2420== indirectly lost: 0 bytes in 0 blocks ==2420== possibly lost: 0 bytes in 0 blocks ==2420== still reachable: 2,240 bytes in 81 blocks ==2420== suppressed: 0 bytes in 0 blocks ==2420== Reachable blocks (those to which a pointer was found) are not shown. ==2420== To see them, rerun with: --leak-check=full --show-reachable=yes ==2420== ==2420== For counts of detected and suppressed errors, rerun with: -v ==2420== ERROR SUMMARY: 0 errors from 0 contexts (suppressed: 13 from 8) Is all good here? the only thing concerning me is the still reachable part. Is that ok? Thanks everyone

    Read the article

  • count on LINQ union

    - by brechtvhb
    I'm having this link statement: List<UserGroup> domains = UserRepository.Instance.UserIsAdminOf(currentUser.User_ID); query = (from doc in _db.Repository<Document>() join uug in _db.Repository<User_UserGroup>() on doc.DocumentFrom equals uug.User_ID where domains.Contains(uug.UserGroup) select doc) .Union(from doc in _db.Repository<Document>() join uug in _db.Repository<User_UserGroup>() on doc.DocumentTo equals uug.User_ID where domains.Contains(uug.UserGroup) select doc); Running this statement doesn't cause any problems. But when I want to count the resultset the query suddenly runs quite slow. totalRecords = query.Count(); The result of this query is : SELECT COUNT([t5].[DocumentID]) FROM ( SELECT [t4].[DocumentID], [t4].[DocumentFrom], [t4].[DocumentTo] FROM ( SELECT [t0].[DocumentID], [t0].[DocumentFrom], [t0].[DocumentTo FROM [dbo].[Document] AS [t0] INNER JOIN [dbo].[User_UserGroup] AS [t1] ON [t0].[DocumentFrom] = [t1].[User_ID] WHERE ([t1].[UserGroupID] = 2) OR ([t1].[UserGroupID] = 3) OR ([t1].[UserGroupID] = 6) UNION SELECT [t2].[DocumentID], [t2].[DocumentFrom], [t2].[DocumentTo] FROM [dbo].[Document] AS [t2] INNER JOIN [dbo].[User_UserGroup] AS [t3] ON [t2].[DocumentTo] = [t3].[User_ID] WHERE ([t3].[UserGroupID] = 2) OR ([t3].[UserGroupID] = 3) OR ([t3].[UserGroupID] = 6) ) AS [t4] ) AS [t5] Can anyone help me to improve the speed of the count query? Thanks in advance!

    Read the article

  • Banning by IP with php/mysql

    - by incrediman
    I want to be able to ban users by IP. My idea is to keep a list of IP's as rows in an BannedIPs table (the IP column would be an index). To check users' IP's against the table, I will keep a session variable called $_SESSION['IP'] for each session. If on any request, $_SESSION['IP'] doesn't match $_SERVER['REMOTE_ADDR'], I will update $_SESSION['IP'] and check the BannedIPs table to see if the IP is banned. (A flag will also be saved as a session variable specifying whether or not the user is banned) Here are the things I'm wondering: Does that sound like a good strategy with regards to speed and security (would someone be able to get around the IP ban somehow, other than changing IP's)? What's the best way to structure a mysql query that checks to see if a row exists? That is, what's the best way to query the db to see if a row with a certain IP exists (to check if it's banned)? Should I save the IP's as integers or strings? Note that... I estimate there will be between 1,000-10,000 banned IP's stored in the database. $_SERVER['REMOTE_ADDR'] is the IP from which the current request was sent.

    Read the article

  • Can a GeneralPath be modified?

    - by Dov
    java2d is fairly expressive, but requires constructing lots of objects. In contrast, the older API would let you call methods to draw various shapes, but lacks all the new features like transparency, stroke, etc. Java has fairly high costs associated with object creation. For speed, I would like to create a GeneralPath whose structure does not change, but go in and change the x,y points inside. path = new GeneralPath(GeneralPath.WIND_EVEN_ODD, 10); path.moveTo(x,y); path.lineTo(x2, y2); double len = Math.sqrt((x2-x)*(x2-x) + (y2-y)*(y2-y)); double dx = (x-x2) * headLen / len; double dy = (y-y2) * headLen / len; double dx2 = -dy * (headWidth/headLen); double dy2 = dx * (headWidth/headLen); path.lineTo(x2 + dx + dx2, y2 + dy + dy2); path.moveTo(x2 + dx - dx2, y2 + dy - dy2); path.lineTo(x2,y2); This one isn't even that long. Imagine a much longer sequence of commands, and only the ones on the end are changing. I just want to be able to overwrite commands, to have an iterator effectively. Does that exist?

    Read the article

  • Assigning a property across threads

    - by Mike
    I have set a property across threads before and I found this post http://stackoverflow.com/questions/142003/cross-thread-operation-not-valid-control-accessed-from-a-thread-other-than-the-t about getting a property. I think my issue with the code below is setting the variable to the collection is an object therefore on the heap and therefore is just creating a pointer to the same object So my question is besides creating a deep copy, or copying the collection into a different List object is there a better way to do the following to aviod the error during the for loop. Cross-thread operation not valid: Control 'lstProcessFiles' accessed from a thread other than the thread it was created on. Code: private void btnRunProcess_Click(object sender, EventArgs e) { richTextBox1.Clear(); BackgroundWorker bg = new BackgroundWorker(); bg.DoWork += new DoWorkEventHandler(bg_DoWork); bg.RunWorkerCompleted += new RunWorkerCompletedEventHandler(bg_RunWorkerCompleted); bg.RunWorkerAsync(lstProcessFiles.SelectedItems); } void bg_DoWork(object sender, DoWorkEventArgs e) { WorkflowEngine engine = new WorkflowEngine(); ListBox.SelectedObjectCollection selectedCollection=null; if (lstProcessFiles.InvokeRequired) { // Try #1 selectedCollection = (ListBox.SelectedObjectCollection) this.Invoke(new GetSelectedItemsDelegate(GetSelectedItems), new object[] { lstProcessFiles }); // Try #2 //lstProcessFiles.Invoke( // new MethodInvoker(delegate { // selectedCollection = lstProcessFiles.SelectedItems; })); } else { selectedCollection = lstProcessFiles.SelectedItems; } // *********Same Error on this line******************** // Cross-thread operation not valid: Control 'lstProcessFiles' accessed // from a thread other than the thread it was created on. foreach (string l in selectedCollection) { if (engine.LoadProcessDocument(String.Format(@"C:\TestDirectory\{0}", l))) { try { engine.Run(); WriteStep(String.Format("Ran {0} Succussfully", l)); } catch { WriteStep(String.Format("{0} Failed", l)); } engine.PrintProcess(); WriteStep(String.Format("Rrinted {0} to debug", l)); } } } private delegate void WriteDelegate(string p); private delegate ListBox.SelectedObjectCollection GetSelectedItemsDelegate(ListBox list); private ListBox.SelectedObjectCollection GetSelectedItems(ListBox list) { return list.SelectedItems; }

    Read the article

< Previous Page | 318 319 320 321 322 323 324 325 326 327 328 329  | Next Page >