Search Results

Search found 9889 results on 396 pages for 'pointer speed'.

Page 322/396 | < Previous Page | 318 319 320 321 322 323 324 325 326 327 328 329  | Next Page >

• Windows Programming: ID2D1Bitmap Interface - Getting the Bitmap Data

  - by LostInBrackets

  I've been writing my own library of functions to access some of the new Direct2D Windows libraries. In particular, I've been working on the ID2D1Bitmap interface. I wanted to write a function to return a pointer to the start of the bitmap data (for the editing of particular pixels, or custom encoding or whatever else I might wish for in the future). Unfortunately... problem ahead... I can't seem to find a way to get access to the raw pixel data from the ID2D1Bitmap Interface. Does anyone have an idea how to access this? One of my friends suggested drawing the bitmap to a surface and extracting the bitmap data from there. I don't know if this would work. It definitely seems inefficient and I wouldn't know which kind of surface to use. Any help is appreciated. (c++ in particular, but I assume the code won't be tooo different between languages) (I know I could just read in the data direct from the file, but I'm using the WIC decoders which means it could be in any number of indecipherable formats)

  Read the article

• Does GC guarantee that cleared References are enqueued to ReferenceQueue in topological order?

  - by Dimitris Andreou

  Say there are two objects, A and B, and there is a pointer A.x --> B, and we create, say, WeakReferences to both A and B, with an associated ReferenceQueue. Assume that both A and B become unreachable. Intuitively B cannot be considered unreachable before A is. In such a case, do we somehow get a guarantee that the respective references will be enqueued in the intuitive (topological when there are no cycles) order in the ReferenceQueue? I.e. ref(A) before ref(B). I don't know - what if the GC marked a bunch of objects as unreachable, and then enqueued them in no particular order? I was reviewing Finalizer.java of guava, seeing this snippet: private void cleanUp(Reference<?> reference) throws ShutDown { ... if (reference == frqReference) { /* * The client no longer has a reference to the * FinalizableReferenceQueue. We can stop. */ throw new ShutDown(); } frqReference is a PhantomReference to the used ReferenceQueue, so if this is GC'ed, no Finalizable{Weak, Soft, Phantom}References can be alive, since they reference the queue. So they have to be GC'ed before the queue itself can be GC'ed - but still, do we get the guarantee that these references will be enqueued to the ReferenceQueue at the order they get "garbage collected" (as if they get GC'ed one by one)? The code implies that there is some kind of guarantee, otherwise unprocessed references could theoretically remain in the queue. Thanks

  Read the article

• WCF Double Hop questions about Security and Binding.

  - by Ken Maglio

  Background information: .Net Website which calls a service (aka external service) facade on an app server in the DMZ. This external service then calls the internal service which is on our internal app server. From there that internal service calls a stored procedure (Linq to SQL Classes), and passes the serialized data back though to the external service, and from there back to the website. We've done this so any communication goes through an external layer (our external app server) and allows interoperability; we access our data just like our clients consuming our services. We've gotten to the point in our development where we have completed the system and it all works, the double hop acts as it should. However now we are working on securing the entire process. We are looking at using TransportWithMessageCredentials. We want to have WS2007HttpBinding for the external for interoperability, but then netTCPBinding for the bridge through the firewall for security and speed. Questions: If we choose WS2007HttpBinding as the external services binding, and netTCPBinding for the internal service is this possible? I know WS-* supports this as does netTCP, however do they play nice when passing credential information like user/pass? If we go to Kerberos, will this impact anything? We may want to do impersonation in the future. If you can when you answer post any reference links about why you're answering the way you are, that would be very helpful to us. Thanks!

  Read the article

• How does virtual inheritance solve the diamond problem?

  - by cambr

  class A { public: void eat(){ cout<<"A";} }; class B: virtual public A { public: void eat(){ cout<<"B";} }; class C: virtual public A { public: void eat(){ cout<<"C";} }; class D: public B,C { public: void eat(){ cout<<"D";} }; int main(){ A *a = new D(); a->eat(); } I understand the diamond problem, and above piece of code does not have that problem. How exatly does virtual inheritance solve the problem? What I understand: When I say A *a = new D();, the compiler wants to know if an object of type D can be assigned to a pointer of type A, but it has two paths that it can follow, but cannot decide by itself. So, how does virtual inheritance resolve the issue (help compiler take the decision)?

  Read the article

• GAE Task Queue oddness

  - by b3nw

  I have been testing the taskqueue with mixed success. Currently I am using the default queue, in default settings ect ect.... I have a test url setup which inserts about 8 tasks into the queue. With short order, all 8 are completed properly. So far so good. The problem comes up when I re-load that url twice under say a minute. Now watching the task queue, all the tasks are added properly, but only the first batch execute it seems. But the "Run in Last Minute" # shows the right number of tasks being run.... The request logs tell a different story. They show only the first set of 8 running, but all task creation urls working successfully. The oddness of this is that if I wait say a minute between the task creation url requests, it will work fine. Oddly enough changing the bucket_size or execution speed does not seem to help. Only the first batch are executed. I have also reduced the number of requests all the way down to 2, and still found only the first 2 execute. Any others added display the same issues as above. Any suggestions? Thanks

  Read the article

• iPhone - dequeueReusableCellWithIdentifier usage

  - by Jukurrpa

  Hi, I'm working on a iPhone app which has a pretty large UITableView with data taken from the web, so I'm trying to optimize its creation and usage. I found out that dequeueReusableCellWithIdentifier is pretty useful, but after seeing many source codes using this, I'm wondering if the usage I make of this function is the good one. Here is what people usually do: UITableViewCell* cell = [tableView dequeueReusableCellWithIdentifier:@"Cell"]; if (cell == nil) { cell = [[UITableViewCell alloc] initWithFrame:CGRectZero reuseIdentifier:@"Cell"]; // Add elements to the cell return cell; And here is the way I did it: NSString identifier = [NSString stringWithFormat:@"Cell @d", indexPath.row]: // The cell row UITableViewCell* cell = [tableView dequeueReusableCellWithIdentifier:identifier]; if (cell != nil) return cell; cell = [[UITableViewCell alloc] initWithFrame:CGRectZero reuseIdentifier:identifier]; // Add elements to the cell return cell; The difference is that people use the same identifier for every cell, so dequeuing one only avoids to alloc a new one. For me, the point of queuing was to give each cell a unique identifier, so when the app asks for a cell it already displayed, neither allocation nor element adding have to be done. In fine I don't know which is best, the "common" method ceils the table's memory usage to the exact number of cells it display, whislt the method I use seems to favor speed as it keeps all calculated cells, but can cause large memory consumption (unless there's an inner limit to the queue). Am I wrong to use it this way? Or is it just up to the developper, depending on his needs?

  Read the article

• What strategy do you use to sync your code when working from home

  - by Ben Daniel

  At my work I currently have my development environment inside a Virtual Machine. When I need to do work from home I copy my VM and any databases I need onto a laptop drive sized external USB drive. After about 10 minutes of copying I put the drive in my pocket and head home, copy back the VM and databases onto my personal computer and I'm ready to work. I follow the same steps to take the work back with me. So if I count the total amount of time I spend waiting around for files to finish copying in order for me to take work home and bring it back again, it comes to around 40 minutes! I do have a VPN connection to my work from home (providing the internet is up at both sites) and a decent internet speed (8mbits down/?up) but I find Remote Desktoping into my work machine laggy enough for me to want to work on my VM directly. So in looking at what other options I have or how I could improve my existing option I'm interested in what strategy you use or recommend to do work at home and keeping your code/environment in sync. EDIT: I'd prefer an option where I don't have to commit my changes into version control before I leave work - as I like to make meaningful descriptive comments in my commits, committing would take longer than just copying my VM onto a portable drive! lol Also I'd prefer a solution where my dev environment stays in sync too. Having said that I'm still very interested in your own solutions even if they don't exactly solve my problem as best as I'd like. :)

  Read the article

• TableView Cells unresponsive

  - by John Donovan

  I have a TableView and I wish to be able to press several cells one after the other and have messages appear. At the moment the cells are often unresponsive. I found some coed for a similar problem someone was kind enough to post, however, although he claimed it worked 100% it doesn't work for me. The app won't even build. Here's the code: -(UIView*) hitTest:(CGPoint)point withEvent:(UIEvent*)event { // check to see if the hit is in this table view if ([self pointInside:point withEvent:event]) { UITableViewCell* newCell = nil; // hit is in this table view, find out // which cell it is in (if any) for (UITableViewCell* aCell in self.visibleCells) { if ([aCell pointInside:[self convertPoint:point toView:aCell] withEvent:nil]) { newCell = aCell; break; } } // if it touched a different cell, tell the previous cell to resign // this gives it a chance to hide the keyboard or date picker or whatever if (newCell != activeCell) { [activeCell resignFirstResponder]; self.activeCell = newCell; // may be nil } } // return the super's hitTest result return [super hitTest:point withEvent:event]; } With this code I get this warning: that my viewController may not respond to pointsInside:withEvent (it's a TableViewController). I also get some faults: request for member 'visibleCells' in something not a structure or a union. incompatible type for argument 1 of pointInsideWithEvent, expression does not have a valid object type and similar. I must admit I'm not so good at reading other people's code but I was wondering whether the problems here are obvious and if so if anyone could give me a pointer it would be greatly appreciated.

  Read the article

• Compiler optimization causing the performance to slow down

  - by aJ

  I have one strange problem. I have following piece of code: template<clss index, class policy> inline int CBase<index,policy>::func(const A& test_in, int* srcPtr ,int* dstPtr) { int width = test_in.width(); int height = test_in.height(); double d = 0.0; //here is the problem for(int y = 0; y < height; y++) { //Pointer initializations //multiplication involving y //ex: int z = someBigNumber*y + someOtherBigNumber; for(int x = 0; x < width; x++) { //multiplication involving x //ex: int z = someBigNumber*x + someOtherBigNumber; if(soemCondition) { // floating point calculations } *dstPtr++ = array[*srcPtr++]; } } } The inner loop gets executed nearly 200,000 times and the entire function takes 100 ms for completion. ( profiled using AQTimer) I found an unused variable double d = 0.0; outside the outer loop and removed the same. After this change, suddenly the method is taking 500ms for the same number of executions. ( 5 times slower). This behavior is reproducible in different machines with different processor types. (Core2, dualcore processors). I am using VC6 compiler with optimization level O2. Follwing are the other compiler options used : -MD -O2 -Z7 -GR -GX -G5 -X -GF -EHa I suspected compiler optimizations and removed the compiler optimization /O2. After that function became normal and it is taking 100ms as old code. Could anyone throw some light on this strange behavior? Why compiler optimization should slow down performance when I remove unused variable ? Note: The assembly code (before and after the change) looked same.

  Read the article

• Do overlays/tooltips work correctly in Emacs for Windows?

  - by Cheeso

  I'm using Flymake on C# code, emacs v22.2.1 on Windows. The Flymake stuff has been working well for me. For those who don't know, you can read an overview of flymake, but the quick story is that flymake repeatedly builds the source file you are currently working on in the background, for the purpose of doing syntax checking. It then highlights the compiler warnings and erros in the current buffer. Flymake didn't work for C# initially, but I "monkey-patched it" and it works nicely now. If you edit C# in emacs, I highly recommend using flymake. The only problem I have is with the UI. Flymake highlights the errors and warnings nicely, and then inserts "overlays" with the full error or warning text. IF I hover the mouse pointer over the highlighted line in code, the overlay pops up. But as you can see, the overlay (tooltip) is truncated, and it doesn't display correctly. Flymake seems to be doing the right thing, it's the overlay part that seems broken., and overlay seems to do the right thing. It's the tooltip that is displayed incorrectly. Do overlays tooltips work correctly in emacs for Windows? Where do I look to fix this?

  Read the article

• argv Memory Allocation

  - by Joshua Green

  I was wondering if someone could tell me what I am doing wrong that I get this Unhandled Exception error message: 0xC0000005: Access violation reading location 0x0000000c. with a green pointer pointing at my first Prolog code (fid_t): Here is my header file: class UserTaskProlog { public: UserTaskProlog( ArRobot* r ); ~UserTaskProlog( ); protected: int cycles; char* argv[ 1 ]; term_t tf; term_t tx; term_t goal_term; functor_t goal_functor; ArRobot* robot; void logTask( ); }; And here is my main code: UserTaskProlog::UserTaskProlog( ArRobot* r ) : robot( r ), robotTaskFunc( this, &UserTaskProlog::logTask ) { cycles = 0; argv[ 0 ] = "libpl.dll"; argv[ 1 ] = NULL; PL_initialise( 1, argv ); PlCall( "consult( 'myPrologFile.pl' )" ); robot->addSensorInterpTask( "UserTaskProlog", 50, &robotTaskFunc ); } UserTaskProlog::~UserTaskProlog( ) { robot->remSensorInterpTask( &robotTaskFunc ); } void UserTaskProlog::logTask( ) { cycles++; fid_t fid = PL_open_foreign_frame( ); tf = PL_new_term_ref( ); PL_put_integer( tf, 5 ); tx = PL_new_term_ref( ); goal_term = PL_new_term_ref( ); goal_functor = PL_new_functor( PL_new_atom( "factorial" ), 2 ); PL_cons_functor( goal_term, goal_functor, tf, tx ); int fact; if ( PL_call( goal_term, NULL ) ) { PL_get_integer( tx, &fact ); cout << fact << endl; } PL_discard_foreign_frame( fid ); } int main( int argc, char** argv ) { ArRobot robot; ArArgumentParser argParser( &argc, argv ); UserTaskProlog talk( &robot ); } Thank you,

  Read the article

• Passing VB Callback function to C dll - noob is stuck.

  - by WaveyDavey

  Callbacks in VB (from C dll). I need to pass a vb function as a callback to a c function in a dll. I know I need to use addressof for the function but I'm getting more and more confused as to how to do it. Details: The function in the dll that I'm passing the address of a callback to is defined in C as : PaError Pa_OpenStream( PaStream** stream, const PaStreamParameters *inputParameters, const PaStreamParameters *outputParameters, double sampleRate, unsigned long framesPerBuffer, PaStreamFlags streamFlags, PaStreamCallback *streamCallback, void *userData ); where the function is parameter 7, *streamCallback. The type PaStreamCallback is defines thusly: typedef int PaStreamCallback( const void *input, void *output, unsigned long frameCount, const PaStreamCallbackTimeInfo* timeInfo, PaStreamCallbackFlags statusFlags, void *userData ); In my vb project I have: Private Declare Function Pa_OpenStream Lib "portaudio_x86.dll" _ ( ByVal stream As IntPtr _ , ByVal inputParameters As IntPtr _ , ByVal outputParameters As PaStreamParameters _ , ByVal samprate As Double _ , ByVal fpb As Double _ , ByVal paClipoff As Long _ , ByVal patestCallBack As IntPtr _ , ByVal data As IntPtr) As Integer (don't worry if I've mistyped some of the other parameters, I'll get to them later! Let's concentrate on the callback for now.) In module1.vb I have defined the callback function: Function MyCallback( ByVal inp As Byte, _ ByVal outp As Byte, _ ByVal framecount As Long, _ ByVal pastreamcallbacktimeinfo As Byte, _ ByVal pastreamcallbackflags As Byte, _ ByVal userdata As Byte) As Integer ' do clever things here End Function The external function in the dll is called with err = Pa_OpenStream( ptr, _ nulthing, _ outputParameters, _ SAMPLE_RATE, _ FRAMES_PER_BUFFER, _ clipoff, _ AddressOf MyCallback, _ dataptr) This is broken in the declaration of the external function - it doesn't like the type IntPtr as a function pointer for AddressOf. Can anyone show me how to implement passing this callback function please ? Many thanks David

  Read the article

• Javascript not able to read data generated by ajax script

  - by user1371033

  I have a situation in which my Jquery Ajax script generates HTML table. And another script is meant to filter the table column by providing a dropdown comprising of unique values in that particular column. If i have static content in html page the filter script works fine. But is not able to read table content when it is generated via Ajax that is during runtime. Any idea what could be the reason. I also tried to align script in order. My Ajax script is here:- $(document).ready(function() { $("#getResults").click(function(){ bug = $("#bug").val(); priority = $("#priority").val(); component = $("#component").val(); fixVersion = $("#fixVersion").val(); dateType = $("#dateType").val(); fromDate = $("#dp2").val(); toDate = $("#dp3").val(); $("#query").empty(); $("tbody").empty(); $.post("getRefineSearchResultsPath", {bug:bug,priority:priority,component:component, fixVersion:fixVersion,dateType:dateType,fromDate:fromDate,toDate:toDate }, function(data) { // setting value for csv report button //clear the value attribute for button first $("#query_csv").removeAttr("value"); //setting new value to "value" attribute of the csv button $("#query_csv").attr("value", function(){ return $(data).find("query").text(); }); $("#query").append("<p class='text-success'>Query<legend></legend><small>" +$(data).find("query").text() +"</small></p>"); var count = 1; $(data).find("issue").each(function(){ var $issue = $(this); var value = "<tr>"; value += "<td>" +count +"</td>"; value += "<td>" +$issue.find('issueKey').text() +"</td>"; value += "<td>" +$issue.find('type').text() +"</td>"; value += "<td><div id='list' class='summary'>" +$issue.find('summary').text() +"</div></td>"; value += "<td><div id='list' class='mousescroll'>" +$issue.find('description').text() +"</div></td>"; value += "<td>" +$issue.find('priority').text() +"</td>"; value += "<td>" +$issue.find('component').text() +"</td>"; value += "<td>" +$issue.find('status').text() +"</td>"; value += "<td>" +$issue.find('fixVersion').text() +"</td>"; value += "<td>" +$issue.find('resolution').text() +"</td>"; value += "<td>" +$issue.find('created').text() +"</td>"; value += "<td>" +$issue.find('updated').text() +"</td>"; value += "<td>" +$issue.find('os').text() +"</td>"; value += "<td>" +$issue.find('frequency').text() +"</td>"; value += "<td>"; var number_of_attachement = $issue.find('attachment').size(); if(number_of_attachement > 0){ value += "<div id='list' class='attachment'>"; value += "<ul class='unstyled'>"; $issue.find('attachment').each(function(){ var $attachment = $(this); value += "<li>"; value += "<a href='#' onclick='document.f1.attachmentName.value='" +$attachment.find('attachmentName').text(); value += "';document.f1.issueKey.value='"+$attachment.find('attachmentissueKey').text(); value += "';document.f1.digest.value='"+$attachment.find('attachmentdigest').text(); value += "';document.f1.submit();'>"+$attachment.find('attachmentName').text(); value += "</a>"; value += "</li>"; value += "<br>"; }); value +="</ul>"; value +="</div>"; } value += "</td>"; value += "</tr>"; $("tbody").append(value); count++; }); }); }); }); And my script to filter table is here, I got this script from this link http://www.javascripttoolbox.com/lib/table/ My JSP page is here:- <html> <body> <table class="table table-bordered table-condensed table-hover example sort01 table-autosort:0 table-autofilter table-autopage:10 table-page-number:t1page table-page-count:t1pages table-filtered-rowcount:t1filtercount table-rowcount:t1allcount"> <thead > <tr> <th class="table-sortable:numeric" Style="width:3%;">No.</th> <th class="table-sortable:default" Style="width:5.5%;">Issue Key <br> </th> <th>Type</th> <th Style="text-align: center;">Summary</th> <th Style="text-align: center;">Description</th> <th class="table-filterable table-sortable:default" id ="priorityColumn" Style="width:5%">Priority</th> <th class="table-filterable table-sortable:default" >Component</th> <th class="table-filterable table-sortable:default" Style="width:5%">Status</th> <th class="table-filterable table-sortable:default">Fix Version</th> <th class="table-filterable table-sortable:default" Style="width:6%">Resolution</th> <th>Created</th> <th>Updated</th> <th>OS</th> <th>Frequency</th> <th>Attachments</th> </tr> </thead> <tbody> </tbody> <tfoot> <tr> <td class="table-page:previous" style="cursor:pointer;"><img src="table/icons/previous.gif" alt="Previous"><small>Prev</small></td> <td colspan="13" style="text-align:center;">Page <span id="t1page"></span>&nbsp;of <span id="t1pages"></span></td> <td class="table-page:next" style="cursor:pointer;">Next <img src="table/icons/next.gif" alt="Previous"></td> </tr> <tr Style="background-color: #dddddd"> <td colspan="15"><span id="t1filtercount"></span>&nbsp;of <span id="t1allcount"></span>&nbsp;rows match filter(s)</td> </tr> <tr class="text-success"> <td colspan="15">Total Results : ${count}</td> </tr> </tfoot> </table> </body> </html>

  Read the article

• Search for string allowing for one mismatches in any location of the string, Python

  - by Vincent

  I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

  Read the article

• Converting UnicodeString to PAnsiChar in Delphi XE

  - by moodforaday

  In Delphi XE I am using the BASS audio library, which contains this function: function BASS_StreamCreateURL(url: PAnsiChar; offset: DWORD; flags: DWORD; proc: DOWNLOADPROC; user: Pointer):HSTREAM; stdcall; external bassdll; The 'url' parameter is of type PAnsiChar, so in my code I do a cast: FStreamHandle := BASS_StreamCreateURL(PAnsiChar( url ) [...] The compiler emits a warning on this line: "suspicious typecast of string to PAnsiChar". In trying to eliminate the warning, I found that the recommended way is to use a double cast: FStreamHandle := BASS_StreamCreateURL(PAnsiChar( AnsiString( url )) [...] This does eliminate the warning, but the BASS function now returns error code 2 ("cannot open file"), which tells me the URL string it receives is somehow broken. I cannot see what the bass DLL actually receives, but using a breakpoint in the debugger the string looks good: var s : PAnsiChar; begin s := PAnsiChar( AnsiString( url )); At this point string s appears fine, but the BASS function fails when I pass it. My initial code: PAnsiChar( url ) works well with BASS, but emits a warning. So what's the correct way of getting from UnicodeString to PAnsiChar without a warning?

  Read the article

• Refactoring ADO.NET - SqlTransaction vs. TransactionScope

  - by marc_s

  I have "inherited" a little C# method that creates an ADO.NET SqlCommand object and loops over a list of items to be saved to the database (SQL Server 2005). Right now, the traditional SqlConnection/SqlCommand approach is used, and to make sure everything works, the two steps (delete old entries, then insert new ones) are wrapped into an ADO.NET SqlTransaction. using (SqlConnection _con = new SqlConnection(_connectionString)) { using (SqlTransaction _tran = _con.BeginTransaction()) { try { SqlCommand _deleteOld = new SqlCommand(......., _con); _deleteOld.Transaction = _tran; _deleteOld.Parameters.AddWithValue("@ID", 5); _con.Open(); _deleteOld.ExecuteNonQuery(); SqlCommand _insertCmd = new SqlCommand(......, _con); _insertCmd.Transaction = _tran; // add parameters to _insertCmd foreach (Item item in listOfItem) { _insertCmd.ExecuteNonQuery(); } _tran.Commit(); _con.Close(); } catch (Exception ex) { // log exception _tran.Rollback(); throw; } } } Now, I've been reading a lot about the .NET TransactionScope class lately, and I was wondering, what's the preferred approach here? Would I gain anything (readibility, speed, reliability) by switching to using using (TransactionScope _scope = new TransactionScope()) { using (SqlConnection _con = new SqlConnection(_connectionString)) { .... } _scope.Complete(); } What you would prefer, and why? Marc

  Read the article

• CSS absolute DIV causing other absolute DIV problems

  - by Tim

  Hello, I have implemented a chat script which requires an absolutely positioned DIV to be wrapped around the pages content. This is to ensure the chat windows stay at the bottom. The problem is that because of the absolute positioning of this main wrapper, all other absolutely positioned elements (eg. Jquery Auto-completes, datepicker's etc) now scroll up and down with the page. Here is an example of the HTML: <body> <div id="main_container"> <div id="content">Elements like Jquery Autocompletes, Datepickers with absolute positioned elements in here</div> </div> The DIV "main_container" style looks like this: #main_container { width:100%; background-color:#ffffff; /* DO NOT REMOVE THIS; or you'll have issue w/ the scrollbar, when the mouse pointer is on a white space */ overflow-x: hidden; overflow-y: scroll; height:100%; /* this will make sure that the height will extend at the bottom */ position:absolute; /* container div must be absolute, for our fixed bar to work */ } I hope there is a simple fix as the chat script is too good to get rid of. Thanks, Tim

  Read the article

• segmentation fault on Unix - possible stack corruption

  - by bob

  hello, i'm looking at a core from a process running in Unix. Usually I can work my around and root into the backtrace to try identify a memory issue. In this case, I'm not sure how to proceed. Firstly the backtrace only gives 3 frames where I would expect alot more. For those frames, all the function parameters presented appears to completely invalid. There are not what I would expect. Some pointer parameters have the following associated with them - Cannot access memory at address Would this suggest some kind of complete stack corruption. I ran the process with libumem and all the buffers were reported as being clean. umem_status reported nothing either. so basically I'm stumped. What is the likely causes? What should I look for in code since libumem appears to have reported no errors. Any suggestions on how I can debug furhter? any extra features in mdb I should consider? thank you.

  Read the article

• Convert function to read from string instead of file in C

  - by Dusty

  I've been tasked with updating a function which currently reads in a configuration file from disk and populates a structure: static int LoadFromFile(FILE *Stream, ConfigStructure *cs) { int tempInt; ... if ( fscanf( Stream, "Version: %d\n",&tempInt) != 1 ) { printf("Unable to read version number\n"); return 0; } cs->Version = tempInt; ... } to one which allows us to bypass writing the configuration to disk and instead pass it directly in memory, roughly equivalent to this: static int LoadFromString(char *Stream, ConfigStructure *cs) A few things to note: The current LoadFromFile function is incredibly dense and complex, reading dozens of versions of the config file in a backward compatible manner, which makes duplication of the overall logic quite a pain. The functions that generate the config file and those that read it originate in totally different parts of the old system and therefore don't share any data structures so I can't pass those directly. I could potentially write a wrapper, but again, it would need to handle any structure passed in in a backwards compatible manner. I'm tempted to just pass the file as is in as a string (as in the prototype above) and convert all the fscanf's to sscanf's but then I have to handle incrementing the pointer along (and potentially dealing with buffer overrun errors) manually. This has to remain in C, so no C++ functionality like streams can help here Am I missing a better option? Is there some way to create a FILE * that actually just points to a location in memory instead of on disk? Any pointers, suggestions or other help is greatly appreciated.

  Read the article

• How to select and crop an image in android?

  - by Guy

  Hey, I am currently working on a live wallpaper and I allow the user to select an image which will go behind my effects. Currently I have: Intent i = new Intent(Intent.ACTION_PICK, android.provider.MediaStore.Images.Media.EXTERNAL_CONTENT_URI); i.putExtra("crop", "true"); startActivityForResult(i, 1); And slightly under that: @Override public void onActivityResult(int requestCode, int resultCode, Intent data) { super.onActivityResult(requestCode, resultCode, data); if (requestCode == 1) if (resultCode == Activity.RESULT_OK) { Uri selectedImage = data.getData(); Log.d("IMAGE SEL", "" + selectedImage); // TODO Do something with the select image URI SharedPreferences customSharedPreference = getSharedPreferences("imagePref", Activity.MODE_PRIVATE); SharedPreferences.Editor editor = customSharedPreference.edit(); Log.d("HO", "" + selectedImage); editor.putString("imagePref", getRealPathFromURI(selectedImage)); Log.d("IMAGE SEL", getRealPathFromURI(selectedImage)); editor.commit(); } } When my code is ran, Logcat tells me that selectedImage is null. If I comment out the i.putExtra("crop", "true"): Logcat does not give me the null pointer exception, and I am able to do what I want with the image. So, what is the problem here? Does any one have any idea how I can fix this? Thanks, for your time.

  Read the article

• Hooking thread exit

  - by mackenir

  Is there a way for me to hook the exit of managed threads (i.e. run some code on a thread, just before it exits?) I've developed a mechanism for hooking thread exit that works for some threads. Step 1: develop a 'hook' STA COM class that takes a callback function and calls it in its destructor. Step 2: create a ThreadStatic instance of this object on the thread I want to hook, and pass the object a managed delegate converted to an unmanaged function pointer. The delegate then gets called on thread exit (since the CLR calls IUnknown::Release on all STA COM RCWs as part of thread exit). This mechanism works on, for example, worker threads that I create in code using the Thread class. However, it doesn't seem to work for the application's main thread (be it a console or windows app). The 'hook' COM object seems to be deleted too late in the shutdown process and the attempt to call the delegate fails. (The reason I want to implement this facility is so I can run some native COM code on the exiting thread that works with STA COM objects that were created on the thread, before it's 'too late' (i.e. before the thread has exited, and it's no longer possible to work with STA COM objects on that thread.))

  Read the article

• Replacing/Extending Visual Studio's Generate Stub in Visual Studio 2010

  - by devoured elysium

  When we write the name of a method that doesn't exist, Visual Studio 2010 asks us if we'd like to generate a method stub with that name. What I'd like to know if is it possible to replace that same code stub generating command with one made by myself. I never did any kind of extensibility programming for Visual Studio so I have a couple of questions: How hard is it? Is it something I can learn in a couple of nights, or is it something that'll make me "lose" a lot of time? It seems to me that there isn't a lot of support for that kind of programming, as generally people are not that interested in developing solutions that extend the Visual Studio IDE. I searched on SO and it doesn't appear to have many threads about extending Visual Studio. I don't know how the generate method stub thing works in Visual Studio, but I just wanted to turn it into something a bit more flexible and useful. Has anyone dealt with these kind of things before, that can give me a pointer to where to start? I know of MS VSX site but that has a lot of resources and can be overwhelming for someone new to the subject as I am. What technology will I need to use? T4? Maybe I'll need to know a lot about the code, like Visual Studio does, so I can know other method's type arguments, names, etc. Is that what T4 is for? Thanks

  Read the article

• My button background seems stretched.

  - by Kyle Sevenoaks

  Hi, I have a button as made for you to see here. Looks fine,right? Well on the live site, euroworker.no/shipping it seems stretched. Renders fine in Chrome, IE and Safari, I thought it might have been a FF issue, but loaded the fiddle into FF and seems fine. Quick ref CSS and html: #fortsett_btn { background-image: url(http://euroworker.no/public/upload/fortsett.png?1269434047); background-repeat:no-repeat; background-position:left; background-color:none; border:none; outline;none; visibility: visible; position: relative; z-index: 2; width: 106px; height: 25px; cursor:pointer; }? And HTML <button type="submit" class="submit" id="fortsett_btn" title="Fortsett" value="">&nbsp;</button>? I wonder what's up with it.

  Read the article

• Programmatically talking to a Serial Port in OS X or Linux

  - by deadprogrammer

  I have a Prolite LED sign that I like to set up to show scrolling search queries from a apache logs and other fun statistics. The problem is, my G5 does not have a serial port, so I have to use a usb to serial dongle. It shows up as /dev/cu.usbserial and /dev/tty.usbserial . When i do this everything seems to be hunky-dory: stty -f /dev/cu.usbserial speed 9600 baud; lflags: -icanon -isig -iexten -echo iflags: -icrnl -ixon -ixany -imaxbel -brkint oflags: -opost -onlcr -oxtabs cflags: cs8 -parenb Everything also works when I use the serial port tool to talk to it. If I run this piece of code while the above mentioned serial port tool, everthing also works. But as soon as I disconnect the tool the connection gets lost. #!/usr/bin/python import serial ser = serial.Serial('/dev/cu.usbserial', 9600, timeout=10) ser.write("<ID01><PA> \r\n") read_chars = ser.read(20) print read_chars ser.close() So the question is, what magicks do I need to perform to start talking to the serial port without the serial port tool? Is that a permissions problem? Also, what's the difference between /dev/cu.usbserial and /dev/tty.usbserial?

  Read the article

• How to mmap the stack for the clone() system call on linux?

  - by Joseph Garvin

  The clone() system call on Linux takes a parameter pointing to the stack for the new created thread to use. The obvious way to do this is to simply malloc some space and pass that, but then you have to be sure you've malloc'd as much stack space as that thread will ever use (hard to predict). I remembered that when using pthreads I didn't have to do this, so I was curious what it did instead. I came across this site which explains, "The best solution, used by the Linux pthreads implementation, is to use mmap to allocate memory, with flags specifying a region of memory which is allocated as it is used. This way, memory is allocated for the stack as it is needed, and a segmentation violation will occur if the system is unable to allocate additional memory." The only context I've ever heard mmap used in is for mapping files into memory, and indeed reading the mmap man page it takes a file descriptor. How can this be used for allocating a stack of dynamic length to give to clone()? Is that site just crazy? ;) In either case, doesn't the kernel need to know how to find a free bunch of memory for a new stack anyway, since that's something it has to do all the time as the user launches new processes? Why does a stack pointer even need to be specified in the first place if the kernel can already figure this out?

  Read the article

< Previous Page | 318 319 320 321 322 323 324 325 326 327 328 329  | Next Page >