Search Results

Search found 37088 results on 1484 pages for 'object element'.

Page 328/1484 | < Previous Page | 324 325 326 327 328 329 330 331 332 333 334 335  | Next Page >

  • How to encapsulate a third party complex object structure?

    - by tangens
    Motivation Currently I'm using the java parser japa to create an abstract syntax tree (AST) of a java file. With this AST I'm doing some code generation (e.g.: if there's an annotation on a method, create some other source files, ...) Problem When my code generation becomes more complex, I've to dive deeper into the structure of the AST (e.g. I have to use visitors to extract some type information of method parameters). But I'm not sure if I want to stay with japa or if I will change the parser library later. Because my code generator uses freemarker (which isn't good at automatic refactoring) I want the interface that it uses to access the AST information to be stable, even if I decide to change the java parser. Question What's the best way to encapsulate complex datastructures of third party libraries? I could create my own datatypes and copy the parts of the AST that I need into these. I could create lots of specialized access methods that work with the AST and create exactly the infos I need (e.g. the fully qualified return type of a method as one string, or the first template parameter of a class). I could create wrapper classes for the japa datastructures I currently need and embed the japa types inside, so that I can delegate requests to the japa types and transform the resulting japa types to my wrapper classes again. Which solution should I take? Are there other (better) solutions to this problem?

    Read the article

  • How to convert this procedural programming to object-oriented programming?

    - by manus91
    I have a source code that is needed to be converted by creating classes, objects and methods. So far, I've just done by converting the initial main into a separate class. But I don't know what to do with constructor and which variables are supposed to be private. This is the code : import java.util.*; public class Card{ private static void shuffle(int[][] cards){ List<Integer> randoms = new ArrayList<Integer>(); Random randomizer = new Random(); for(int i = 0; i < 8;) { int r = randomizer.nextInt(8)+1; if(!randoms.contains(r)) { randoms.add(r); i++; } } List<Integer> clonedList = new ArrayList<Integer>(); clonedList.addAll(randoms); Collections.shuffle(clonedList); randoms.addAll(clonedList); Collections.shuffle(randoms); int i=0; for(int r=0; r < 4; r++){ for(int c=0; c < 4; c++){ cards[r][c] = randoms.get(i); i++; } } } public static void play() throws InterruptedException { int ans = 1; int preview; int r1,c1,r2,c2; int[][] cards = new int[4][4]; boolean[][] cardstatus = new boolean[4][4]; boolean gameover = false; int moves; Scanner input = new Scanner(System.in); do{ moves = 0; shuffle(cards); System.out.print("Enter the time(0 to 5) in seconds for the preview of the answer : "); preview = input.nextInt(); while((preview<0) || (preview>5)){ System.out.print("Invalid time!! Re-enter time(0 - 5) : "); preview = input.nextInt(); } preview = 1000*preview; System.out.println(" "); for (int i =0; i<4;i++){ for (int j=0;j<4;j++){ System.out.print(cards[i][j]); System.out.print(" "); } System.out.println(""); System.out.println(""); } Thread.sleep(preview); for(int b=0;b<25;b++){ System.out.println(" "); } for(int r=0;r<4;r++){ for(int c=0;c<4;c++){ System.out.print("*"); System.out.print(" "); cardstatus[r][c] = false; } System.out.println(""); System.out.println(" "); } System.out.println(""); do{ do{ System.out.print("Please insert the first card row : "); r1 = input.nextInt(); while((r1<1) || (r1>4)){ System.out.print("Invalid coordinate!! Re-enter first card row : "); r1 = input.nextInt(); } System.out.print("Please insert the first card column : "); c1 = input.nextInt(); while((c1<1) || (c1>4)){ System.out.print("Invalid coordinate!! Re-enter first card column : "); c1 = input.nextInt(); } if(cardstatus[r1-1][c1-1] == true){ System.out.println("The card is already flipped!! Select another card."); System.out.println(""); } }while(cardstatus[r1-1][c1-1] != false); do{ System.out.print("Please insert the second card row : "); r2 = input.nextInt(); while((r2<1) || (r2>4)){ System.out.print("Invalid coordinate!! Re-enter second card row : "); r2 = input.nextInt(); } System.out.print("Please insert the second card column : "); c2 = input.nextInt(); while((c2<1) || (c2>4)){ System.out.print("Invalid coordinate!! Re-enter second card column : "); c2 = input.nextInt(); } if(cardstatus[r2-1][c2-1] == true){ System.out.println("The card is already flipped!! Select another card."); } if((r1==r2)&&(c1==c2)){ System.out.println("You can't select the same card twice!!"); continue; } }while(cardstatus[r2-1][c2-1] != false); r1--; c1--; r2--; c2--; System.out.println(""); System.out.println(""); System.out.println(""); for(int r=0;r<4;r++){ for(int c=0;c<4;c++){ if((r==r1)&&(c==c1)){ System.out.print(cards[r][c]); System.out.print(" "); } else if((r==r2)&&(c==c2)){ System.out.print(cards[r][c]); System.out.print(" "); } else if(cardstatus[r][c] == true){ System.out.print(cards[r][c]); System.out.print(" "); } else{ System.out.print("*"); System.out.print(" "); } } System.out.println(" "); System.out.println(" "); } System.out.println(""); if(cards[r1][c1] == cards[r2][c2]){ System.out.println("Cards Matched!!"); cardstatus[r1][c1] = true; cardstatus[r2][c2] = true; } else{ System.out.println("No cards match!!"); } Thread.sleep(2000); for(int b=0;b<25;b++){ System.out.println(""); } for(int r=0;r<4;r++){ for(int c=0;c<4;c++){ if(cardstatus[r][c] == true){ System.out.print(cards[r][c]); System.out.print(" "); } else{ System.out.print("*"); System.out.print(" "); } } System.out.println(""); System.out.println(" "); } System.out.println(""); System.out.println(""); System.out.println(""); gameover = true; for(int r=0;r<4;r++){ for( int c=0;c<4;c++){ if(cardstatus[r][c]==false){ gameover = false; break; } } if(gameover==false){ break; } } moves++; }while(gameover != true); System.out.println("Congratulations, you won!!"); System.out.println("It required " + moves + " moves to finish it."); System.out.println(""); System.out.print("Would you like to play again? (1=Yes / 0=No) : "); ans = input.nextInt(); }while(ans == 1); } } The main class is: import java.util.*; public class PlayCard{ public static void main(String[] args) throws InterruptedException{ Card game = new Card(); game.play(); } } Should I simplify the Card class by creating other classes? Through this code, my javadoc has no constructtor. So i need help on this!

    Read the article

  • Pass in the object a java class is embedded in as a parameter.

    - by Leif Andersen
    I'm building an android application, which has a list view, and in the list view, a click listener, containing an onItemClick method. So I have something like this: public class myList extends ListActivity { @Override public void onCreate(Bundle savedInstanceState) { getListView().setOnItemClickListener(new OnItemClickListener() { public void onItemClick(AdapterView<?> parent, View view, int position, long id) { /* Do something*/ } } } Normally, this works fine. However, many times I find myself needing too preform an application using the outer class as a context. thusfar, I've used: parent.getContext(); to do this, but I would like to know, is that a bad idea? I can't really call: super because it's not really a subclass, just an embedded one. So is there any better way, or is that considered cosure? Also, if it is the right way, what should I do if the embedded method doesn't have a parameter to get the outside class? Thank you.

    Read the article

  • How can I add a field with an array value to my Perl object?

    - by superstar
    What's the difference between these two constructors in perl? 1) sub new { my $class = shift; my $self = {}; $self->{firstName} = undef; $self->{lastName} = undef; $self->{PEERS} = []; bless ($self, $class); return $self; } 2) sub new { my $class = shift; my $self = { _firstName => shift, _lastName => shift, _ssn => shift, }; bless $self, $class; return $self; } I am using the second one so far, but I need to implement the PEERS array in the second one? How do I do it with the second constructor and how can we use get and set methods on those array variables?

    Read the article

  • Load XML file into object. Best method?

    - by Cypher
    Hello, We are receiving an XML file from our client. I want to load the data from this file into a class, but am unsure about which way to go about it. I have an XSD to defining what is expected in the XML file, so therefore i can easily validate the XML file. Can i use the XSD file to load the data into a POCO, using some sort of serialization? The other way i was thinking was to load the xml into a XMLDocument and use XPath to populate each property in my class. Cheers for any advice

    Read the article

  • Objective-C Basic class related question, retaining the value of a specific object using a class fil

    - by von steiner
    Members, scholars, code gurus. My background is far from any computer programming thus my question may seems basic and somewhat trivial to you. Nevertheless it seems that I can't put my head around it. I have googled and searched for the answer, just to get myself confused even more. With that, I would kindly ask for a simple explanation suitable for a non technical person such as myself and for other alike arriving to this thread. I have left a comment with the text "Here is the issue" below, referring to my question. // character.h #import <Foundation/Foundation.h> @interface character : NSObject { NSString *name; int hitPoints; int armorClass; } @property (nonatomic,retain) NSString *name; @property int hitPoints,armorClass; -(void)giveCharacterInfo; @end // character.m #import "character.h" @implementation character @synthesize name,hitPoints,armorClass; -(void)giveCharacterInfo{ NSLog(@"name:%@ HP:%i AC:%i",name,hitPoints,armorClass); } @end // ClassAtLastViewController.h #import <UIKit/UIKit.h> @interface ClassAtLastViewController : UIViewController { } -(void)callAgain; @end // ClassAtLastViewController.m #import "ClassAtLastViewController.h" #import "character.h" @implementation ClassAtLastViewController - (void)viewDidLoad { //[super viewDidLoad]; character *player = [[character alloc]init]; player.name = @"Minsc"; player.hitPoints = 140; player.armorClass = 10; [player giveCharacterInfo]; [player release]; // Up until here, All peachy! [self performSelector:@selector(callAgain) withObject:nil afterDelay:2.0]; } -(void)callAgain{ // Here is the issue, I assume that since I init the player again I loss everything // Q1. I loss all the data I set above, where is it than? // Q2. What is the proper way to implement this character *player = [[character alloc]init]; [player giveCharacterInfo]; } Many thanks in advance, Kindly remember that my background is more related to Salmons breeding than to computer code, try and lower your answer to my level if it's all the same to you.

    Read the article

  • [C#] Finding the index of a queue that holds a member of a containing object for a given value

    - by Luke Mcneice
    I have a Queue that contains a collection of objects, one of these objects is a class called GlobalMarker that has a member called GlobalIndex. What I want to be able to do is find the index of the queue where the GlobalIndex contains a given value (this will always be unique). Simply using the .contains function shown bellow returns a bool. How can I obtain the queue index of this match? RealTimeBuffer.OfType<GlobalMarker>().Select(o => o.GlobalIndex).Contains(INT_VALUE);

    Read the article

  • Google App Engine JDO error could be caused by Serializable object ?

    - by Frank
    I got the following error mesage : java.lang.UnsupportedOperationException org.datanucleus.store.appengine.EntityUtils.getPropertyName(EntityUtils.java:62) org.datanucleus.store.appengine.DatastoreFieldManager.storeObjectField(DatastoreFieldManager.java:839) org.datanucleus.state.AbstractStateManager.providedObjectField(AbstractStateManager.java:1037) PayPal_Monitor.Contact_Info_Entry.jdoProvideField(Contact_Info_Entry.java) PayPal_Monitor.Contact_Info_Entry.jdoProvideFields(Contact_Info_Entry.java) org.datanucleus.state.JDOStateManagerImpl.provideFields(JDOStateManagerImpl.java:2715) Could it be caused by my Contact_Info_Entry.java ? It looks like this : @PersistenceCapable(identityType=IdentityType.APPLICATION) public class Contact_Info_Entry implements Serializable { @PrimaryKey @Persistent(valueStrategy=IdGeneratorStrategy.IDENTITY) Long Id; public static final long serialVersionUID=26362862L; @Persistent String Contact_Id=""; ... }

    Read the article

  • In flex how do I pass data retrieved from a remote object service to a modules interface?

    - by Dan G
    I found at this Adobe tutorial a nice "RemoteService" class that creates a RemoteObject and contains the functions for handling the result and fault events. If I wanted to use this approach, how could I pass the data from the result handler to interfaces that modules from the main application could use? I could put the RemoteService/RemoteObject in the modules, but (in my opinion- and I could be wrong) the best design seems to be using the remote calls in the main app and passing the data along to the modules.

    Read the article

  • Using the Loader display object to load X jpegs, then resize each of the images differently while th

    - by Supernovah
    Hey there, I was wondering if this is possible to do I am able to load the image in and have it displayed easily enough by using addChild(myLoader); where myLoader is in the classWide private scope. The problem is, whenever I call my function inside that class which adds the loader to the stage, it clears the old one and puts this new one in even if I add a bit where I change myLoader.name to something related to how many images it has completed. This is a serious hinderance as I can't do anything besides KNOW how many images I will need to load and write the code X times. The problem being is that the urls are read from an XML file. My main desire was to have a classWide private Array which contained my loaders and I would assign them using myArray.push(myLoader) each time the load had completed. There is a problem which is that it compiles but they never get displayed it would work as this is written public class Images extends Sprite { private var imagesLoaded = 0; private var myLoader:Loader; ... public function Images():Void { myLoader = new Loader; //loop calling a myLoader.load(imageURL) for a bunch of urls myLoader.contentLoaderInfo.addEventListener(Event.COMPLETE, imageLoaded); } public function imageLoaded { myArray[imagesLoaded] = myLoader; trace("does\'nt get to here!!"); addChild(myArray[imagesLoaded]); imagesLoaded++; } }

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • How can a Delphi TPersistent object calculate its own deserialization time?

    - by mjustin
    For performance tests I need a way to measure the time needed for a form to load its definition from the DFM. All existing forms inherit a custom form class. To capture the current time, this base class needs overriden methods as "extension points": start of the deserialization process after the deserialization (can be implemented by overriding the Loaded procedure) the moment just before the execution of the OnFormCreate event So the log for TMyForm.Create(nil) could look like: - 00.000 instance created - 00.010 before deserialization - 01.823 after deserialization - 02.340 before OnFormCreate Which TObject (or TComponent) methods are best suited? Maybe there are other extension points in the form creation process, please feel free to make suggestions.

    Read the article

  • Is there a way to enforce/preserve order of XML elements in an XML Schema?

    - by MarcoS
    Let's consider the following XML Schema: <?xml version="1.0" encoding="UTF-8"?> <schema targetNamespace="http://www.example.org/library" elementFormDefault="qualified" xmlns="http://www.w3.org/2001/XMLSchema" xmlns:lib="http://www.example.org/library"> <element name="library" type="lib:libraryType"></element> <complexType name="libraryType"> <sequence> <element name="books" type="lib:booksType"></element> </sequence> </complexType> <complexType name="booksType"> <sequence> <element name="book" type="lib:bookType" maxOccurs="unbounded" minOccurs="1"></element> </sequence> </complexType> <complexType name="bookType"> <attribute name="title" type="string"></attribute> </complexType> </schema> and a corresponding XML example: <?xml version="1.0" encoding="UTF-8"?> <lib:library xmlns:lib="http://www.example.org/library" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://www.example.org/library src/library.xsd "> <lib:books> <lib:book title="t1"/> <lib:book title="t2"/> <lib:book title="t3"/> </lib:books> </lib:library> Is there a way to guarantee that the order of <lib:book .../> elements is preserved? I want to be sure that any parser reading the XML will return books in the specified oder, that is first the book with title="t1", then the book with title="t2", and finally the book with title="t3". As far as I know XML parsers are not required to preserve order. I wonder whether one can enforce this through XML Schema? One quick solution for me would be adding an index attribute to the <lib:book .../> element, and delegate order preservation to the application reading the XML. Comments? Suggestions?

    Read the article

  • AS3: Removing EventListeners without knowing amount or names

    - by DevEight
    Hello! First shortly about how my site works: When a link is clicked it checks if something is already displayed in either the Left or Right side of the screen (the website looks like a book, so I have a left page I want to display information on and a right page). If there is already something showing it hides it and displays the new object, together with this it enables all the buttons within that object (I have separate functions to set up each object). An example of such an EventListener would be: pathTo.Button1.addEventListener(MouseEvent.CLICK, function():void {showText(side, object)}); What I'm trying to do is to remove all the previous set EventListeners without having to create separate functions for removing the links inside every object as well. Shorter version: How do I remove all EventListeners on all objects inside another object? The only variable I want to store is the object containing everything. There are however not always EventListeners within the objects.

    Read the article

  • How do you determine when an object is drawn on-screen in OpenGL?

    - by Harry
    I'm extremely new to OpenGL. I'm writing a program that displays flying text on screen. I need to know when certain text string appears (drawn) onto the screen and are visible to the user. The program needs to identify which text strings are displayed. At first, I started to think that I could use OpenGL's picking mechanism, but so far I've only seen examples where the selection area is focused on some sort of user interaction. I want to know what objects are displayed on the entire window area. This leads me to think I'm on the wrong track... Am I missing something? Any suggestions are welcome.

    Read the article

  • What's the best way of accessing a DRb object (e.g. Ruby Queue) from Scala (and Java)?

    - by Tom Morris
    I have built a variety of little scripts using Ruby's very simple Queue class, and share the Queue between Ruby and JRuby processes using DRb. It would be nice to be able to access these from Scala (and maybe Java) using JRuby. I've put together something Scala and the JSR-223 interface to access jruby-complete.jar. import javax.script._ class DRbQueue(host: String, port: Int) { private var engine = DRbQueue.factory.getEngineByName("jruby") private var invoker = engine.asInstanceOf[Invocable] engine.eval("require \"drb\" ") private var queue = engine.eval("DRbObject.new(nil, \"druby://" + host + ":" + port.toString + "\")") def isEmpty(): Boolean = invoker.invokeMethod(this.queue, "empty?").asInstanceOf[Boolean] def size(): Long = invoker.invokeMethod(this.queue, "length").asInstanceOf[Long] def threadsWaiting: Long = invoker.invokeMethod(this.queue, "num_waiting").asInstanceOf[Long] def offer(obj: Any) = invoker.invokeMethod(this.queue, "push", obj.asInstanceOf[java.lang.Object]) def poll(): Any = invoker.invokeMethod(this.queue, "pop") def clear(): Unit = { invoker.invokeMethod(this.queue, "clear") } } object DRbQueue { var factory = new ScriptEngineManager() } (It conforms roughly to java.util.Queue interface, but I haven't declared the interface because it doesn't implement the element and peek methods because the Ruby class doesn't offer them.) The problem with this is the type conversion. JRuby is fine with Scala's Strings - because they are Java strings. But if I give it a Scala Int or Long, or one of the other Scala types (List, Set, RichString, Array, Symbol) or some other custom type. This seems unnecessarily hacky: surely there has got to be a better way of doing RMI/DRb interop without having to use JSR-223 API. I could either make it so that the offer method serializes the object to, say, a JSON string and takes a structural type of only objects that have a toJson method. I could then write a Ruby wrapper class (or just monkeypatch Queue) to would parse the JSON. Is there any point in carrying on with trying to access DRb from Java/Scala? Might it just be easier to install a real message queue? (If so, any suggestions for a lightweight JVM-based MQ?)

    Read the article

  • How to force inclusion of an object file in a static library when linking into executable?

    - by Brian Bassett
    I have a C++ project that due to its directory structure is set up as a static library A, which is linked into shared library B, which is linked into executable C. (This is a cross-platform project using CMake, so on Windows we get A.lib, B.dll, and C.exe, and on Linux we get libA.a, libB.so, and C.) Library A has an init function (A_init, defined in A/initA.cpp), that is called from library B's init function (B_init, defined in B/initB.cpp), which is called from C's main. Thus, when linking B, A_init (and all symbols defined in initA.cpp) is linked into B (which is our desired behavior). The problem comes in that the A library also defines a function (Af, defined in A/Afort.f) that is intended to by dynamically loaded (i.e. LoadLibrary/GetProcAddress on Windows and dlopen/dlsym on Linux). Since there are no references to Af from library B, symbols from A/Afort.o are not included into B. On Windows, we can artifically create a reference by using the pragma: #pragma comment (linker, "/export:_Af") Since this is a pragma, it only works on Windows (using Visual Studio 2008). To get it working on Linux, we've tried adding the following to A/initA.cpp: extern void Af(void); static void (*Af_fp)(void) = &Af; This does not cause the symbol Af to be included in the final link of B. How can we force the symbol Af to be linked into B?

    Read the article

  • jQuery Click event on object added with JavaScript not working.

    - by Hultner
    I'm work on a quiz for school but I've bumped into a problem. I got a javascript file for custom radio buttons (CUSTOM FORM ELEMNTS by Ryan Fait if it's helping). The script hides the input buttons and adds custom styled spans instead. Now what I want, when I click one of these JavaScript added spans I want to remove disabled for a button called "Next Question" which when pressed takes you to the next question. The reason for this is that I don't want people to accidently got to the next question without choosing a answer. The problem is when I press the added spans nothing happens but when I press another identical span which I have added in the html it works just as intended. The span got the class radio which is the class I'm looking for in the jQuery. Here's the test page with the error on: http://hultner.se/graphicsquiz/livetest/livetest.php Short: Can't get jQuery .click() functions to work with spans added using JavaScript earlier in the document.

    Read the article

  • Using the MongoDB Ruby driver in Rails? (without an object mapper)

    - by Mark L
    I have recently been getting my feet wet in MongoDB using Mongoid w/ Rails 3, but I'm now interested in learning the low level MongoDB features using only the Ruby driver, and trying some map/reduce that would not be possible through Mongoid (afaik) I'm not entirely sure where in Rails I should be setting up the db connections etc, and any pointers would be much appreciated!

    Read the article

< Previous Page | 324 325 326 327 328 329 330 331 332 333 334 335  | Next Page >