Search Results

Search found 37088 results on 1484 pages for 'object element'.

Page 327/1484 | < Previous Page | 323 324 325 326 327 328 329 330 331 332 333 334  | Next Page >

  • How to get a reference to a method's caller object from within the method in Objective-C

    - by shakeelw
    Hi guys. I have a few text fields and text views on my application's view. The keyboard comes up when I click in anyone of them. I have a method that gets called when any one of these objects is tapped in. However, I would like the method to execute its code only if the a certain Text Field(s) or a certain Text View(s) is tapped in. I would therefore like to have something like this in the method body: { if(currentField != mySpecialField) {return;} //Rest of the method code... } Now, my question is, how do I get a reference to the currently tapped in field so that I can perform the if-check. Thanks guys. I'm a total noobee in Objective-C. :(

    Read the article

  • How do I connect from an XPCOM object to a GStreamer plugin in a Songbird addon?

    - by utnapistim
    Hi all, I am writing a Songbird addon, with three parts: XUL (javascript), a GStreamer filter and an XPCOM addon. I am interested in accessing the GStreamer layer from my XPCOM component. If anyone knows any resources on how to do that I'd be grateful. Specifically, I need documentation or examples on accessing the GStreamer functionality from within my addon (building a GST pipeline and running a file through it, from my XPCOM component (C++). Thanks :)

    Read the article

  • Access Violation When Accessing an STL Object Through A Pointer or Reference In A Different DLL or E

    - by Yan Cheng CHEOK
    I experience the following problem while using legacy VC6. I just cann't switch to modern compiler, as I am working on a legacy code base. http://support.microsoft.com/kb/172396 Since there are no way to export map, my planned workaround is using static linking instead of dynamic linking. I was wondering whether you all had encountered the similar situation? What is your workaround for this? Another workaround is to create wrapper class around the stl map, to ensure creation and accessing stl map, are within the same DLL space. Note that, fun0, which uses wrapper class will just work fine. fun1 will crash. Here is the code example : // main.cpp. Compiled it as exe. #pragma warning (disable : 4786) #include <map> #include <string> template <class K, class V> class __declspec(dllimport) map_wrapper { public: map_wrapper(); ~map_wrapper(); map_wrapper(const map_wrapper&); map_wrapper& operator=(const map_wrapper&); V& operator[](const K&); const V& operator[](const K&) const; const V& get(const K&) const; void put(const K&, const V&); int size() const; private: std::map<K, V> *m; }; __declspec(dllimport) void fun0(map_wrapper<std::string, int>& m); __declspec(dllimport) void fun1(std::map<std::string, int>& m); int main () { map_wrapper<std::string, int> m0; std::map<std::string, int> m1; m0["hello"] = 888; m1["hello"] = 888; // Safe. The we create std::map and access map both in dll space. fun0(m0); // Crash! The we create std::map in exe space, and access map in dll space. fun1(m1); return 0; } // dll.cpp. Compiled it as dynamic dll. #pragma warning (disable : 4786) #include <map> #include <string> #include <iostream> /* In map_wrapper.h */ template <class K, class V> class __declspec(dllexport) map_wrapper { public: map_wrapper(); ~map_wrapper(); map_wrapper(const map_wrapper&); map_wrapper& operator=(const map_wrapper&); V& operator[](const K&); const V& operator[](const K&) const; const V& get(const K&) const; void put(const K&, const V&); int size() const; private: std::map<K, V> *m; }; /* End */ /* In map_wrapper.cpp */ template <class K, class V> map_wrapper<K, V>::map_wrapper() : m(new std::map<K, V>()) { } template <class K, class V> map_wrapper<K, V>::~map_wrapper() { delete m; } template <class K, class V> map_wrapper<K, V>::map_wrapper(const map_wrapper<K, V>& map) : m(new std::map<K, V>(*(map.m))) { } template <class K, class V> map_wrapper<K, V>& map_wrapper<K, V>::operator=(const map_wrapper<K, V>& map) { std::map<K, V>* tmp = this->m; this->m = new std::map<K, V>(*(map.m)); delete tmp; return *this; } template <class K, class V> V& map_wrapper<K, V>::operator[](const K& key) { return (*this->m)[key]; } template <class K, class V> const V& map_wrapper<K, V>::operator[](const K& key) const { return (*this->m)[key]; } template <class K, class V> const V& map_wrapper<K, V>::get(const K& key) const { return (*this->m)[key]; } template <class K, class V> void map_wrapper<K, V>::put(const K& key, const V& value) { (*this->m)[key] = value; } template <class K, class V> int map_wrapper<K, V>::size() const { return this->m->size(); } // See : http://www.parashift.com/c++-faq-lite/templates.html#faq-35.15 // [35.15] How can I avoid linker errors with my template classes? template class __declspec(dllexport) map_wrapper<std::string, int>; /* End */ __declspec(dllexport) void fun0(map_wrapper<std::string, int>& m) { std::cout << m["hello"] << std::endl; } __declspec(dllexport) void fun1(std::map<std::string, int>& m) { std::cout << m["hello"] << std::endl; }

    Read the article

  • How extensive is an Object in CakePHP model linkage?

    - by Andre
    I was hoping someone with an understanding on CakePHP could shed some light on a question I've been having. Here's my scenario, I have a User this User has a Company which in turn has many Department and many Address. If I were to get a User could I expect to have access to the Company and all models associated with that Company? So would $user['Company']['Department'][0] or $user['Company']['Address'][0] be possible? Which brings me back to the original question, how extensive is the linkage between models?

    Read the article

  • "Temporary object" warning - is it me or the compiler?

    - by Roddy
    The following snippet gives the warning: [C++ Warning] foo.cpp(70): W8030 Temporary used for parameter '_Val' in call to 'std::vector<Base *,std::allocator<Base *> >::push_back(Base * const &)' .. on the indicated line. class Base { }; class Derived: public Base { public: Derived() // << warning disappears if constructor is removed! { }; }; std::vector<Base*> list1; list1.push_back(new Base); list1.push_back(new Derived); // << Warning on this line! Compiler is Codegear C++Builder 2007. Oddly, if the constructor for Derived is deleted, the warning goes away... Is it me or the compiler?

    Read the article

  • How do I draw a filled circle onto a graphics object in a hexadecimal colour?

    - by George Powell
    I need to draw a circle onto a bitmap in a specific colour given in Hex. The "Brushes" class only gives specific colours with names. Bitmap bitmap = new Bitmap(20, 20); Graphics g = Graphics.FromImage(bitmap); g.FillEllipse(Brushes.AliceBlue, 0, 0, 19, 19); //The input parameter is not a Hex //g.FillEllipse(new Brush("#ff00ffff"), 0, 0, 19, 19); <<This is the kind of think I need. Is there a way of doing this? The exact problem: I am generating KML (for Google earth) and I am generating lots of lines with different Hex colours. The colours are generated mathematically and I need to keep it that way so I can make as many colours as I want. I need to generate a PNG icon for each of the lines that is the same colour exactly.

    Read the article

  • Pass in the object a java class is embedded in as a parameter.

    - by Leif Andersen
    I'm building an android application, which has a list view, and in the list view, a click listener, containing an onItemClick method. So I have something like this: public class myList extends ListActivity { @Override public void onCreate(Bundle savedInstanceState) { getListView().setOnItemClickListener(new OnItemClickListener() { public void onItemClick(AdapterView<?> parent, View view, int position, long id) { /* Do something*/ } } } Normally, this works fine. However, many times I find myself needing too preform an application using the outer class as a context. thusfar, I've used: parent.getContext(); to do this, but I would like to know, is that a bad idea? I can't really call: super because it's not really a subclass, just an embedded one. So is there any better way, or is that considered cosure? Also, if it is the right way, what should I do if the embedded method doesn't have a parameter to get the outside class? Thank you.

    Read the article

  • [C#]How to change the class of an object dynamically?

    - by codemonkie
    Suppose I have a base class named Visitor, and it has 2 subclass Subscriber and NonSubscriber. At first a visitor is start off from a NonSubscriber, i.e. NonSubscriber mary = new NonSubscriber(); Then later on this "mary" subscribed to some services, and I want to change the type of "mary" to Subscriber. What is the conventional way to do that?

    Read the article

  • Is there a built-in .NET method for getting all of the properties and values for an object?

    - by Ben McCormack
    Let's say I have: public class Item { public string SKU {get; set; } public string Description {get; set; } } .... Is there a built-in method in .NET that will let me get the properties and values for variable i of type Item that might look like this: {SKU: "123-4556", Description: "Millennial Radio Classic"} I know that .ToString() can be overloaded to provide this functionaility, but I couldn't remember if this was already provided in .NET.

    Read the article

  • JPA DAO integration test not throwing exception when duplicate object saved?

    - by HDave
    I am in the process of unit testing a DAO built with Spring/JPA and Hibernate as the provider. Prior to running the test, DBUnit inserted a User record with username "poweruser" -- username is the primary key in the users table. Here is the integration test method: @Test @ExpectedException(EntityExistsException.class) public void save_UserTestDataSaveUserWithPreExistingId_EntityExistsException() { User newUser = new UserImpl("poweruser"); newUser.setEmail("[email protected]"); newUser.setFirstName("New"); newUser.setLastName("User"); newUser.setPassword("secret"); dao.persist(newUser); } I have verified that the record is in the database at the start of this method. Not sure if this is relevant, but if I do a dao.flush() at the end of this method I get the following exception: javax.persistence.PersistenceException: org.hibernate.exception.ConstraintViolationException: Could not execute JDBC batch update

    Read the article

  • Is there a way to transfrom a list of key/value pairs into a data transfer object

    - by weevie
    ...apart from the obvious looping through the list and a dirty great case statement! I've turned over a few Linq queries in my head but nothing seems to get anywhere close. Here's the an example DTO if it helps: class ClientCompany { public string Title { get; private set; } public string Forenames { get; private set; } public string Surname { get; private set; } public string EmailAddress { get; private set; } public string TelephoneNumber { get; private set; } public string AlternativeTelephoneNumber { get; private set; } public string Address1 { get; private set; } public string Address2 { get; private set; } public string TownOrDistrict { get; private set; } public string CountyOrState { get; private set; } public string PostCode { get; private set; } } We have no control over the fact that we're getting the data in as KV pairs, I'm afraid.

    Read the article

  • How to add new object to an IList mapped as a one-to-many with NHibernate?

    - by Jørn Schou-Rode
    My model contains a class Section which has an ordered list of Statics that are part of this section. Leaving all the other properties out, the implementation of the model looks like this: public class Section { public virtual int Id { get; private set; } public virtual IList<Static> Statics { get; private set; } } public class Static { public virtual int Id { get; private set; } } In the database, the relationship is implemented as a one-to-many, where the table Static has a foreign key pointing to Section and an integer column Position to store its index position in the list it is part of. The mapping is done in Fluent NHibernate like this: public SectionMap() { Id(x => x.Id); HasMany(x => x.Statics).Cascade.All().LazyLoad() .AsList(x => x.WithColumn("Position")); } public StaticMap() { Id(x => x.Id); References(x => x.Section); } Now I am able to load existing Statics, and I am also able to update the details of those. However, I cannot seem to find a way to add new Statics to a Section, and have this change persisted to the database. I have tried several combinations of: mySection.Statics.Add(myStatic) session.Update(mySection) session.Save(myStatic) but the closest I have gotten (using the first two statements), is to an SQL exception reading: "Cannot insert the value NULL into column 'Position'". Clearly an INSERT is attempted here, but NHibernate does not seem to automatically append the index position to the SQL statement. What am I doing wrong? Am I missing something in my mappings? Do I need to expose the Position column as a property and assign a value to it myself? EDIT: Apparently everything works as expected, if I remove the NOT NULL constraint on the Static.Position column in the database. I guess NHibernate makes the insert and immediatly after updates the row with a Position value. While this is an anwers to the question, I am not sure if it is the best one. I would prefer the Position column to be not nullable, so I still hope there is some way to make NHibernate provide a value for that column directly in the INSERT statement. Thus, the question is still open. Any other solutions?

    Read the article

  • How to encapsulate a third party complex object structure?

    - by tangens
    Motivation Currently I'm using the java parser japa to create an abstract syntax tree (AST) of a java file. With this AST I'm doing some code generation (e.g.: if there's an annotation on a method, create some other source files, ...) Problem When my code generation becomes more complex, I've to dive deeper into the structure of the AST (e.g. I have to use visitors to extract some type information of method parameters). But I'm not sure if I want to stay with japa or if I will change the parser library later. Because my code generator uses freemarker (which isn't good at automatic refactoring) I want the interface that it uses to access the AST information to be stable, even if I decide to change the java parser. Question What's the best way to encapsulate complex datastructures of third party libraries? I could create my own datatypes and copy the parts of the AST that I need into these. I could create lots of specialized access methods that work with the AST and create exactly the infos I need (e.g. the fully qualified return type of a method as one string, or the first template parameter of a class). I could create wrapper classes for the japa datastructures I currently need and embed the japa types inside, so that I can delegate requests to the japa types and transform the resulting japa types to my wrapper classes again. Which solution should I take? Are there other (better) solutions to this problem?

    Read the article

  • Using the Loader display object to load X jpegs, then resize each of the images differently while th

    - by Supernovah
    Hey there, I was wondering if this is possible to do I am able to load the image in and have it displayed easily enough by using addChild(myLoader); where myLoader is in the classWide private scope. The problem is, whenever I call my function inside that class which adds the loader to the stage, it clears the old one and puts this new one in even if I add a bit where I change myLoader.name to something related to how many images it has completed. This is a serious hinderance as I can't do anything besides KNOW how many images I will need to load and write the code X times. The problem being is that the urls are read from an XML file. My main desire was to have a classWide private Array which contained my loaders and I would assign them using myArray.push(myLoader) each time the load had completed. There is a problem which is that it compiles but they never get displayed it would work as this is written public class Images extends Sprite { private var imagesLoaded = 0; private var myLoader:Loader; ... public function Images():Void { myLoader = new Loader; //loop calling a myLoader.load(imageURL) for a bunch of urls myLoader.contentLoaderInfo.addEventListener(Event.COMPLETE, imageLoaded); } public function imageLoaded { myArray[imagesLoaded] = myLoader; trace("does\'nt get to here!!"); addChild(myArray[imagesLoaded]); imagesLoaded++; } }

    Read the article

  • Can you open an SPSite object while being within a different site collection?

    - by Chris Stewart
    I'm working on creating a common navigation experience across two site collections in MOSS 2007. I've looked around for various solutions and haven't found anything that fits. Our navigation is dynamic and driven by a number of factors, including audience targeting. Most of what I've found relates to having static XML and that just won't work for our requirements. What I'm down to at the moment is just getting a navigation item from site collection A while in the context of site collection B. Are there reasons I shouldn't be able to just open a navigation item from site collection A and gets its audience? Certainly there could be permissions problems on my end, or code related issues, or things that are in my control. What I'm wondering is if there's something inherent to SharePoint that would not allow this. Something I don't have control over which would force me to travel a different path.

    Read the article

  • Loading table sections when using headers

    - by Luis Tovar
    I cant seem to wrap my head around this. I have googled, and overstacked for hours now looking for examples that i can relate to. What I have is two arrays. The name of my first NSMutableArray is "showDates". I have 3 objects in here. Object 0: "Today, May 20th" Object 1: "Tomorrow, May 21st" Object 2: "Saturday, May 22nd" Then I have my second NSMutableArray named "showTimes" I have about 15 objects in there with strings in each object. ( i hope that makes sense? ) Each object is structured like this: Object 0: showID @"98022" eventID @"833" showTime @"1:30pm" showDate @"Today, May 20th" auditorium @"9" venue @"2991" Object 1: showID @"98222" eventID @"813" showTime @"2:30pm" showDate @"Tomorrow, May 21st" auditorium @"9" venue @"2991" Etc, etc, .... I have the headers working great in my tableView, but I cant seem to figure out how to add the objects in my "showTimes" array under the correct header. Any help would be greatly appreciated.

    Read the article

  • How can I dispose of an object (say a Bitmap) when it becomes orphaned ?

    - by Jelly Amma
    I have a class A providing Bitmaps to other classes B, C, etc. Now class A holds its bitmaps in a ring queue so after a while it will lose reference to the bitmap. While it's still in the queue, the same Bitmap can be checked out by several classes so that, say, B and C can both hold a reference to this same Bitmap. But it can also happen that only one of them checked out the Bitmap or even none of them. I would like to dispose of the bitmap when it's not being needed any more by either A, B or C. I suppose I have to make B and C responsible for somehow signaling when they're finished using it but I'm not sure about the overall logic. Should it be a call to something like DisposeIfNowOrphan() that would be called : 1 - when the Bitmap gets kicked out of the queue in class A 2 - when B is finished with it 3 - when C is finished with it If that's the best strategy, how can I evaluate the orphan state ? Any advice would be most welcome.

    Read the article

  • How do I use an array as an object attribute in Perl?

    - by superstar
    Hello guys, I need some help regarding the arrays in Perl This is the constructor i have. sub new { my $class = shift; my @includeobjects = (); my @excludeobjects = (); my $Packet = { _PacketName => shift, _Platform => shift, _Version => shift, @_IncludePath => @includeobjects, }; bless $Packet, $class; return $Packet; } sub SetPacketName { my ( $Packet, $PacketName ) = @_; $Packet->{_PacketName} = $PacketName if defined($PacketName); return $Packet->{_PacketName}; } sub SetIncludePath { my ( $Packet, @IncludePath ) = @_; $Packet->{@_IncludePath} = @IncludePath; return $Packet->{@_IncludePath}; } sub GetPacketName { my( $Packet ) = @_; return $Packet->{_PacketName}; } sub GetIncludePath { my( $Packet ) = @_; return $Packet->{@_IncludePath}; } The get and set methods work fine for PacketName. But since IncludePath is an array, I could not get it work. The declaration is what I am not able to get right.

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Weak reference and Strong reference

    - by theband
    package uk.co.bigroom.utils { import flash.utils.Dictionary; /** * Class to create a weak reference to an object. A weak reference * is a reference that does not prevent the object from being * garbage collected. If the object has been garbage collected * then the get method will return null. */ public class WeakRef { private var dic:Dictionary; /** * The constructor - creates a weak reference. * * @param obj the object to create a weak reference to */ public function WeakRef( obj:* ) { dic = new Dictionary( true ); dic[obj] = 1; } /** * To get a strong reference to the object. * * @return a strong reference to the object or null if the * object has been garbage collected */ public function get():* { for ( var item:* in dic ) { return item; } return null; } } } In this Class, how they denote one as Weak Reference and one as Strong reference.

    Read the article

< Previous Page | 323 324 325 326 327 328 329 330 331 332 333 334  | Next Page >