Search Results

Search found 9872 results on 395 pages for 'preg replace callback'.

Page 333/395 | < Previous Page | 329 330 331 332 333 334 335 336 337 338 339 340  | Next Page >

  • Showing latex commands in text string using mathjax

    - by robezy
    I have a text string, for ex. 'A vehicle travels from A to B, distance {$d} km at constant speed. While returning back to A on same path it {$variation} its speed by {$v} km/hr. The total time of journey is {$t} hours. Find the original speed of vehicle.' The variables in the curly brackets are to be replaced by appropriate latex equation. I'm using php's preg_replace to replace the variables with latex commands. Unfortunately, my latex commands are coming as it is. It is not processed by mathjax. For ex, above text becomes A vehicle travels from A to B, distance 1 km at constant speed. While returning back to A on same path it increased its speed by (\frac{3}{2}) km/hr. The total time of journey is 1 hours. Find the original speed of vehicle. The frac is show as it is. What is wrong here? Please ask me if you need any more info. Thanks

    Read the article

  • Is a call to the following method considered late binding?

    - by AspOnMyNet
    1) Assume: • B1 defines methods virtualM() and nonvirtualM(), where former method is virtual while the latter is non-virtual • B2 derives from B1 • B2 overrides virtualM() • B2 is defined inside assembly A • Application app doesn’t have a reference to assembly A In the following code application app dynamically loads an assembly A, creates an instance of a type B2 and calls methods virtualM() and nonvirtualM(): Assembly a=Assembly.Load(“A”); Type t= a.GetType(“B2”); B1 a = ( B1 ) Activator.CreateInstance ( “t” ); a.virtualM(); a.nonvirtualM(); a) Is call to a.virtualM() considered early binding or late binding? b) I assume a call to a.nonvirtualM() is resolved during compilation time? 2) Does the term late binding refer only to looking up the target method at run time or does it also refer to creating an instance of given type at runtime? thanx EDIT: 1) A a=new A(); a.M(); As far as I know, it is not known at compile time where on the heap (thus at which memory address ) will instance a be created during runtime. Now, with early binding the function calls are replaced with memory addresses during compilation process. But how can compiler replace function call with memory address, if it doesn’t know where on the heap will object a be created during runtime ( here I’m assuming the address of method a.M will also be at same memory location as a )? 2) The method slot is determined at compile time I assume that by method slot you’re referring to the entry point in V-table?

    Read the article

  • Really cool way to create custom UITabBar for iPhone app?

    - by ludicco
    Hi, I am doing a lot of researching lately about how to get a different looking with nice effects UITabBar on my iPhone app, but unfortunately I am only finding things on how to replace background color etc. Well, I've checked out this app called Momento which is pretty cool and presents a very slick tabBar: So there are a couple of elements here I would like to ask you guys if you could help me by giving me the right directions on how to get a similar effect :) Arrow above items: as you can see this app has this animated arrow that runs above the selected item with a very smooth animation. Selected Stated of the item's image is not that blue-ish default one neither the default state which displays in a different shade of brown and gray version. nice Items separators with beveled vertical lines. diferrent background image for the tabBar different height for the tabBar At this point after some research I am able to set the height and background image by subclassing UITabBarController but I'm still not sure on how to accomplish the other items specially the first one related to the nice arrow effect. If someone knows about a very good tutorial on how to do this it would be great for clarifying what can or can't be done by subclassing the UITabBarController and specially if can be done in Interface Builder :) I am just starting on this world off app development for iOS so if you could help me on that it would be really appreciated Thanks a lot in advance

    Read the article

  • Hibernate 3.5.0 causes extreme performance problems

    - by user303396
    I've recently updated from hibernate 3.3.1.GA to hibernate 3.5.0 and I'm having a lot of performance issues. As a test, I added around 8000 entities to my DB (which in turn cause other entities to be saved). These entities are saved in batches of 20 so that the transactions aren't too large for performance reasons. When using hibernate 3.3.1.GA all 8000 entities get saved in about 3 minutes. When using hibernate 3.5.0 it starts out slower than with hibernate 3.3.1. But it gets slower and slower. At around 4,000 entities, it sometimes takes 5 minutes just to save a batch of 20. If I then go to a mysql console and manually type in an insert statement from the mysql general query log, half of them run perfect in 0.00 seconds. And half of them take a long time (maybe 40 seconds) or timeout with "ERROR 1205 (HY000): Lock wait timeout exceeded; try restarting transaction" from MySQL. Has something changed in hibernate's transaction management in version 3.5.0 that I should be aware of? The ONLY thing I changed to experience these unusable performance issues is replace the following hibernate 3.3.1.GA jar files: com.springsource.org.hibernate-3.3.1.GA.jar, com.springsource.org.hibernate.annotations-3.4.0.GA.jar, com.springsource.org.hibernate.annotations.common-3.3.0.ga.jar, com.springsource.javassist-3.3.0.ga.jar with the new hibernate 3.5.0 release hibernate3.jar and javassist-3.9.0.GA.jar. Thanks.

    Read the article

  • What VC++ compiler/linker does when building a C++ project with Managed Extension

    - by ???
    The initial problem is that I tried to rebuild a C++ project with debug symbols and copied it to test machine, The output of the project is external COM server(.exe file). When calling the COM interface function, there's a RPC call failre: COMException(0x800706BE): The remote procedure call failed. According to the COM HRESULT design, if the FACILITY code is 7, it's actually a WIN32 error, and the win32 error code is 0x6BE, which is the above mentioned "remote procedure call failed". All I do is replace the COM server .exe file, the origin file works well. When I checked into the project, I found it's a C++ project with Managed Extension. When I checking the DLL with reflector, it shows there's 2 additional .NET assembly reference. Then I checked the project setting and found nothing about the extra 2 assembly reference. I turned on the show includes option of compiler and verbose library of linker, and try to analyze whether the assembly is indirectly referenced via .h file. I've collect all the .h file and grep all the files with '#using' '#import' and the assembly file itself. There really is a '#using ' in one of the .h file but not-relevant to the referenced assembly. And about the linked .lib library files, only one of the .lib file is a side-product of another managed-extension-enabled C++ project, all others are produced by a pure, traditional C++ project. For the managed-extension-enabled C++ project, I checked the output DLL assembly, it did NOT reference to the 2 assembly. I even try to capture the access of the additional assembly file via sysinternal's filemon and procmon, but the rebuild process does NOT access these file. I'm very confused about the compile and linking process model of a VC++/CLI project, where the additional assembly reference slipped into the final assembly? Thanks in advance for any of your help.

    Read the article

  • Free solution for automatic updates with .NET/C#?

    - by a2h
    Yes, from searching I can see this has been asked time and time again. Here's a backstory. I'm an individual hobbyist developer with zero budget. A program I've been developing has been in need of constant bugfixes, and me and users are getting tired of having to manually update. Me, because my current solution of Manually FTP to my website Update a file "newest.txt" with the newest version Update index.html with a link to the newest version Hope for people to see the "there's an update" message Have them manually download the update sucks, and whenever I screw up an update, I get pitchforks. Users, because, well, "Are you ever going to implement auto-update?" "Will there ever be an auto-update feature?" Over the past few hours I have looked into: http://windowsclient.net/articles/appupdater.aspx - I can't comprehend the documentation http://www.codeproject.com/KB/vb/Auto_Update_Revisited.aspx - Doesn't appear to support anything other than working with files that aren't in use http://wyday.com/wyupdate/ - wyBuild isn't free, and the file specification is simply too complex. Maybe if I was under a company paying me I could spend the time, but then I may as well pay for wyBuild. http://www.kineticjump.com/update/default.aspx - Ditto. ClickOnce - Workarounds for implementing launching on startup are massive, horrendous and not worth it for such a simple feature. Publishing is a pain; manual FTP and replace of all files is required for servers without FrontPage Extensions. I'm pretty much ready to throw in the towel right now and strangle myself. And then I think about Sparkle...

    Read the article

  • Unit Testing a rails 2.3.5 plugin

    - by brad
    I'm writing a new plugin for a rails 2.3.5 app. I've included an app directory (which makes it an engine) so i can easily load some extra routes. Not sure if that affects anything. Anyway, in the test directory i have two files: test_helper.rb and my_plugin_test.rb These files were generated automatically using script/generate plugin my_plugin When I go to vendor/plugins/my_plugin directory and run rake test they don't seem to run. I get the following console output: (in /Users/me/Repos/my_app/source/trunk/vendor/plugins/my_plugin) /Users/me/.rvm/rubies/jruby-1.4.0/bin/jruby -I"lib:lib:test" "/Users/me/.rvm/gems/jruby-1.4.0/gems/rake-0.8.7/lib/rake/rake_test_loader.rb" "test/my_plugin_test.rb" So it obviously sees my test file, but none of the tests inside get run, I just get back to my console prompt. What am I missing here? I figured the generated code would work out of the box Here are the two files test_helper.rb require 'rubygems' require 'active_support' require 'active_support/test_case' my_plugin_test.rb require 'test_helper' class MyPluginTest < ActiveSupport::TestCase # Replace this with your real tests. test "the truth" do assert true end test "Factories are supported" do assert_not_nil Factory end end File structure vendor - plugins - my_plugin - app - config - routes.rb - generators - my_plugin - some generator files.rb - lib - my_plugin.rb - my_plugin - my_plugin_lib_file.rb - rails - init.rb - Rakefile - tasks - my_plugin_tasks.rake - test - test_helper.rb - my_plugin_test.rb

    Read the article

  • problems with async jquery and loops

    - by Seth Vargo
    I am so confused. I am trying to append portals to a page by looping through an array and calling a method I wrote called addModule(). The method gets called the right number of times (checked via an alert statement), in the correct order, but only one or two of the portals actually populate. I have a feeling its something with the loop and async, but it's easier explained with the code: moduleList = [['weather','test'],['test']]; for(i in moduleList) { $('#content').append(''); for(j in moduleList[i]) { addModule(i,moduleList[i][j]); //column,name } } function addModule(column,name) { alert('adding module ' + name); $.get('/modules/' + name.replace(' ','-') + '.php',function(data){ $('#'+column).append(data); }); } for each array in the main array, I append a new column, since that's what each sub-array is - a column of portals. Then I loop through that sub array and call addModule on that column and the name of that module (which works correctly). Something buggy happens in my addModule method that it only adds the first and last modules, or sometimes a middle one, or sometimes none at all... im so confused!

    Read the article

  • Is there any way to filter certain things in pages served by IIS?

    - by Ruslan
    Hello, This is my first time posting here so please keep that in mind... I'll try to be short and get right to defining the problem. We have an ASP.NET 2 application (eCommerce package) running on IIS (Windows Server 2003). The main site's page(s) are using plain HTTP (no SSL), but the whole checkout process and the shopping cart page is using SSL (HTTPS). Now, the problem is that the site's header is located in a template file, and inside it it has a plain HTML 'img' tag calling an image with the "http://" portion hard-coded into it... This header appears on absolutely every page (including the https pages), and due to its insecure image tag, a warning box pops up in IE on every stage of the checkout process... Now, the problem: The live application cannot be touched in any way (no changes can be made to the template (so simply changing "http://" to "//" is not an option), IIS cannot be restarted, and the website/app pool cannot be restarted). Is there any way in the world (maybe plugin for IIS or a setting somewhere) that I can filter the pages right before they are served to replace the '<img src="http://example.com/image.jpg">' with '<img src="//example.com/image.jpg">' in the final HTML? Possibly via a regular expression or something? Thanks to everybody in advance.

    Read the article

  • using ini file in vb6, problem with path to file

    - by DrPut
    I have read many articles about how to use an INI file within my VB6 project. I don't have a problem with the methods, my problem is how to make the EXE file find the INI file. I don't want to hard code the path in the program. I simply want the EXE to expect the INI file to be present in the same folder the EXE is executed from. When I run the program from inside VB6 IDE, the INI is found and processed. When I compile the program and run the EXE, nothing is found. My code looks like: gServer = sGetINI(sINIFile, "TOOLBOM", "ServerName", "?") where TOOLBOM is the [Section] and "ServerName" is the key for the value. I obtained the following code for the API: Rem API DECLARATIONS Declare Function GetPrivateProfileString Lib "kernel32" Alias _ "GetPrivateProfileStringA" (ByVal lpApplicationName _ As String, ByVal lpKeyName As Any, ByVal lpDefault _ As String, ByVal lpReturnedString As String, ByVal _ nSize As Long, ByVal lpFileName As String) As Long Declare Function WritePrivateProfileString Lib "kernel32" Alias _ "WritePrivateProfileStringA" (ByVal lpApplicationName _ As String, ByVal lpKeyName As Any, ByVal lpString As Any, _ ByVal lpFileName As String) As Long Public Function sGetINI(sINIFile As String, sSection As String, sKey _ As String, sDefault As String) As String Dim sTemp As String * 256 Dim nLength As Integer sTemp = Space$(256) nLength = GetPrivateProfileString(sSection, sKey, sDefault, sTemp, _ 255, sINIFile) sGetINI = Left$(sTemp, nLength) End Function Public Sub writeINI(sINIFile As String, sSection As String, sKey _ As String, sValue As String) Dim n As Integer Dim sTemp As String sTemp = sValue Rem Replace any CR/LF characters with spaces For n = 1 To Len(sValue) If Mid$(sValue, n, 1) = vbCr Or Mid$(sValue, n, 1) = vbLf _ Then Mid$(sValue, n) = " " Next n n = WritePrivateProfileString(sSection, sKey, sTemp, sINIFile) End Sub

    Read the article

  • Asp.Net MVC - Binding of parameter to model value!

    - by Pino
    This seems like the model binding is causing me issues. Essentially I have a model called ProductOption and for the purpose of this question it has 2 fields ID (Int) PK ProductID (Int) FK I have a standard route set-up context.MapRoute( "Product_default", "Product/{controller}/{action}/{id}", new { controller = "Product", action = "Index", id = UrlParameter.Optional } ); and if the user wants to add an option the URL is, /Product/Options/Add/1 in the above URL 1 is the ProductID, I have the following code to return a blank model the the view, [HttpGet] public ActionResult Add(int id) { return View("Manage", new ProductOptionModel() { ProductID = id }); } Now in my view I keep a hidden field <%= Html.HiddenFor(x=>x.ID) %> This is used to determine (on submit) if we are editing or adding a new option. However the Model binder in .net seems to replace .ID (Which was 0 when leaving the above get actionresult) with 1 (or the value of the id parameter in the URL) How can I stop or work around this? ViewModel public class ProductExtraModel { //Database public int ID { get; set; } public string Name { get; set; } public int ProductID { get; set; } public ProductModel Product { get; set; } }

    Read the article

  • Problem with UPDATE statement in stored-procedure in Oracle Database

    - by MKP
    Hello, I have stored-procedure in Oracle database like this: create or replace PROCEDURE EDYTUJ_PRACOWNIKA (PR_IMIE IN VARCHAR2, PR_NAZWISKO IN VARCHAR2, PR_PENSJA IN FLOAT, PR_PRZELOZONY IN NUMBER, PR_ODDZIAL IN NUMBER, PRAC_ID IN NUMBER) AS tmpPensja FLOAT := 0; tmpPrzel NUMBER := 0; BEGIN select przelozony into tmpPrzel from pracownik where id = PRAC_ID; IF(tmpPrzel IS NOT NULL) THEN select pensja into tmpPensja from pracownik where id = tmpPrzel; IF(tmpPensja < 1150) THEN UPDATE PRACOWNIK SET pensja = 1000 WHERE id = tmpPrzel; ELSE UPDATE PRACOWNIK SET pensja = pensja - 150 WHERE id = tmpPrzel; (4) END IF; END IF; IF(PR_PRZELOZONY > 0) THEN UPDATE PRACOWNIK SET imie = PR_IMIE, nazwisko = PR_NAZWISKO, pensja = PR_PENSJA, przelozony = PR_PRZELOZONY, oddzial = PR_ODDZIAL WHERE id = PRAC_ID; (2) select pensja into tmpPensja from pracownik where id = PR_PRZELOZONY; IF(tmpPensja > 4850) THEN UPDATE PRACOWNIK SET pensja = 5000 WHERE id = PR_PRZELOZONY; ELSE UPDATE PRACOWNIK SET pensja = pensja + 150 WHERE id = PR_PRZELOZONY; (1) END IF; ELSE UPDATE PRACOWNIK SET imie = PR_IMIE, nazwisko = PR_NAZWISKO, pensja = PR_PENSJA, przelozony = NULL, oddzial = PR_ODDZIAL WHERE ID = PRAC_ID; (3) END IF; END; where przelozony and pensja are columns in pracownik table. And I have problem that when running procedure with parameters that provide that line marked with "(1)" (there is the same problem with line marked with "(4)") should be executed that update statement don't have any effect. What's more statements in lines marked with "(2)" and "(3)" works fine. I have no ideas how to fix it. Thank you in advance for your help.

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • converting numbers into alphabets.

    - by Nina
    Hi! i want to convert number into alphabets using javascript e.g. 01=n, 02=i 03=n,04=a and when someone enters the numbers:01020304 in the form he will get like this: nina. or whatever he enters it get replace with equivalent alphabets including spaces. i will be really thankful if you can provide full code including html form code as i am beginner. Thank you all for quick response. I have found this code in one site it converts alphabets into numbers, but code for converting numbers into alphabets isn't working. here is a code for converting alphabets into numbers: var i,j; var getc; var len; var num,alpha; num=new Array("01","02","03","04","05","06","07","08","09","10","11","12","13","14","15","16","17", "18","19","20","21","22","23","24","25","26","00","##","$$"); alpha=new Array("a","b","c","d","e","f","g","h","i","j","k","l","m","n","o","p","q","r","s","t","u"," v","w","x","y","z"," ",".",","); function encode() { len=document.f1.ta1.value.length; document.f1.ta2.value=""; for(i=0;i

    Read the article

  • Are function-local typedefs visible inside C++0x lambdas?

    - by GMan - Save the Unicorns
    I've run into a strange problem. The following simplified code reproduces the problem in MSVC 2010 Beta 2: template <typename T> struct dummy { static T foo(void) { return T(); } }; int main(void) { typedef dummy<bool> dummy_type; auto x = [](void){ bool b = dummy_type::foo(); }; // auto x = [](void){ bool b = dummy<bool>::foo(); }; // works } The typedef I created locally in the function doesn't seem to be visible in the lambda. If I replace the typedef with the actual type, it works as expected. Here are some other test cases: // crashes the compiler, credit to Tarydon int main(void) { struct dummy {}; auto x = [](void){ dummy d; }; } // works as expected int main(void) { typedef int integer; auto x = [](void){ integer i = 0; }; } I don't have g++ 4.5 available to test it, right now. Is this some strange rule in C++0x, or just a bug in the compiler? From the results above, I'm leaning towards bug. Though the crash is definitely a bug. For now, I have filed two bug reports. All code snippets above should compile. The error has to do with using the scope resolution on locally defined scopes. (Spotted by dvide.) And the crash bug has to do with... who knows. :) Update According to the bug reports, they have both been fixed for the next release of Visual Studio 2010.

    Read the article

  • array of structures, or structure of arrays?

    - by Jason S
    Hmmm. I have a table which is an array of structures I need to store in Java. The naive don't-worry-about-memory approach says do this: public class Record { final private int field1; final private int field2; final private long field3; /* constructor & accessors here */ } List<Record> records = new ArrayList<Record>(); If I end up using a large number ( 106 ) of records, where individual records are accessed occasionally, one at a time, how would I figure out how the preceding approach (an ArrayList) would compare with an optimized approach for storage costs: public class OptimizedRecordStore { final private int[] field1; final private int[] field2; final private long[] field3; Record getRecord(int i) { return new Record(field1[i],field2[i],field3[i]); } /* constructor and other accessors & methods */ } edit: assume the # of records is something that is changed infrequently or never I'm probably not going to use the OptimizedRecordStore approach, but I want to understand the storage cost issue so I can make that decision with confidence. obviously if I add/change the # of records in the OptimizedRecordStore approach above, I either have to replace the whole object with a new one, or remove the "final" keyword. kd304 brings up a good point that was in the back of my mind. In other situations similar to this, I need column access on the records, e.g. if field1 and field2 are "time" and "position", and it's important for me to get those values as an array for use with MATLAB, so I can graph/analyze them efficiently.

    Read the article

  • Compilation errors calling find_if using a functor

    - by Jim Wong
    We are having a bit of trouble using find_if to search a vector of pairs for an entry in which the first element of the pair matches a particular value. To make this work, we have defined a trivial functor whose operator() takes a pair as input and compares the first entry against a string. Unfortunately, when we actually add a call to find_if using an instance of our functor constructed using a temporary string value, the compiler produces a raft of error messages. Oddly (to me, anyway), if we replace the temporary with a string that we've created on the stack, things seem to work. Here's what the code (including both versions) looks like: typedef std::pair<std::string, std::string> MyPair; typedef std::vector<MyPair> MyVector; struct MyFunctor: std::unary_function <const MyPair&, bool> { explicit MyFunctor(const std::string& val) : m_val(val) {} bool operator() (const MyPair& p) { return p.first == m_val; } const std::string m_val; }; bool f(const char* s) { MyFunctor f(std::string(s)); // ERROR // std::string str(s); // MyFunctor f(str); // OK MyVector vec; MyVector::const_iterator i = std::find_if(vec.begin(), vec.end(), f); return i != vec.end(); } And here's what the most interesting error message looks like: /usr/include/c++/4.2.1/bits/stl_algo.h:260: error: conversion from ‘std::pair, std::allocator , std::basic_string, std::allocator ’ to non-scalar type ‘std::string’ requested Because we have a workaround, we're mostly curious as to why the first form causes problems. I'm sure we're missing something, but we haven't been able to figure out what it is.

    Read the article

  • Dice Emulation - ImageView

    - by Michelle Harris
    I am trying to emulate dice using ImageView. When I click the button, nothing seems to happen. I have hard coded this example to replace the image with imageView4 for debugging purposes (I was making sure the random wasn't fail). Can anyone point out what I am doing wrong? I am new to Java, Eclipse and Android so I'm sure I've probably made more than one mistake. Java: import java.util.Random; import android.app.Activity; import android.os.Bundle; import android.view.View; import android.widget.ArrayAdapter; import android.widget.ImageView; import android.widget.Spinner; import android.widget.Toast; public class Yahtzee4Activity extends Activity { /** Called when the activity is first created. */ @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); Spinner s = (Spinner) findViewById(R.id.spinner); ArrayAdapter adapter = ArrayAdapter.createFromResource( this, R.array.score_types, android.R.layout.simple_spinner_dropdown_item); adapter.setDropDownViewResource(android.R.layout.simple_spinner_dropdown_item); s.setAdapter(adapter); } public void onMyButtonClick(View view) { ImageView imageView1 = new ImageView(this); Random rand = new Random(); int rndInt = 4; //rand.nextInt(6) + 1; // n = the number of images, that start at index 1 String imgName = "die" + rndInt; int id = getResources().getIdentifier(imgName, "drawable", getPackageName()); imageView1.setImageResource(id); } } XML for the button: <Button android:id="@+id/button_roll" android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="@string/roll" android:onClick="onMyButtonClick" />

    Read the article

  • Silverlight Socket Constantly Returns With Empty Buffer

    - by Benny
    I am using Silverlight to interact with a proxy application that I have developed but, without the proxy sending a message to the Silverlight application, it executes the receive completed handler with an empty buffer ('\0's). Is there something I'm doing wrong? It is causing a major memory leak. this._rawBuffer = new Byte[this.BUFFER_SIZE]; SocketAsyncEventArgs receiveArgs = new SocketAsyncEventArgs(); receiveArgs.SetBuffer(_rawBuffer, 0, _rawBuffer.Length); receiveArgs.Completed += new EventHandler<SocketAsyncEventArgs>(ReceiveComplete); this._client.ReceiveAsync(receiveArgs); if (args.SocketError == SocketError.Success && args.LastOperation == SocketAsyncOperation.Receive) { // Read the current bytes from the stream buffer int bytesRecieved = this._client.ReceiveBufferSize; // If there are bytes to process else the connection is lost if (bytesRecieved > 0) { try { //Find out what we just received string messagePart = UTF8Encoding.UTF8.GetString(_rawBuffer, 0, _rawBuffer.GetLength(0)); //Take out any trailing empty characters from the message messagePart = messagePart.Replace('\0'.ToString(), ""); //Concatenate our current message with any leftovers from previous receipts string fullMessage = _theRest + messagePart; int seperator; //While the index of the seperator (LINE_END defined & initiated as private member) while ((seperator = fullMessage.IndexOf((char)Messages.MessageSeperator.Terminator)) > 0) { //Pull out the first message available (up to the seperator index string message = fullMessage.Substring(0, seperator); //Queue up our new message _messageQueue.Enqueue(message); //Take out our line end character fullMessage = fullMessage.Remove(0, seperator + 1); } //Save whatever was NOT a full message to the private variable used to store the rest _theRest = fullMessage; //Empty the queue of messages if there are any while (this._messageQueue.Count > 0) { ... } } catch (Exception e) { throw e; } // Wait for a new message if (this._isClosing != true) Receive(); } } Thanks in advance.

    Read the article

  • Trigger ad-hoc activity within a workflow

    - by Chris Taylor
    I am looking to use WF 4 to replace an existing workflow solution we have. One feature that is currently used in the existing workflow engine is the ability to cancel a current activity and loopback to a FlowSwitch type activity. So given the following crude workflow where we start at 'O' and base in the input data the workflow follows the path to 'A2' which is currently blocking on s bookmark waiting for input. ---------A1--\ | \ /\ \ O------- ---->--(A2)-------| ^ \/ / | | | / | | ---------A3--/ | | | |----------------------| However in the meantime some out of band data comes in that means we should cancel 'A2' and return to the FlowSwitch to re-evaluate based on the new data. The question is what is the best way to handle the out of band data that arrived? My initial guess is to have a Parallel activity with one branch waiting for out of band data and the other branch containing the workflow sequence described above. If data came in on the brach waiting for the out of band data, how would I cancel the current activity in the workflow and force it to return to the FlowSwitch. Or of course is there a better way to handle this. I have not actually done any work with the WF4 stuff for WF3 for that matter so I might be missing something obvious here.

    Read the article

  • Assign Multiple Custom User Roles to a Custom Post Type

    - by OUHSD Webmaster
    Okay here's the situation.... I'm working on a my business website. There will be a work/portfolio area. "Work" is a custom post type. "Designer" is a custom user role. "Client" is a custom user role. In creating a new "Work" post I would like to be able to select both a "designer" and "Client" to assign to the piece of work, as I would assign an author to a regular ol' post. I tried the method from this answer but it did not work for me. ) I placed it in my functions.php file. ` add_filter('wp_dropdown_users', 'test'); function test($output) { global $post; //Doing it only for the custom post type if($post->post_type == 'work') { $users = get_users(array('role'=>'designer')); //We're forming a new select with our values, you can add an option //with value 1, and text as 'admin' if you want the admin to be listed as well, //optionally you can use a simple string replace trick to insert your options, //if you don't want to override the defaults $output .= "<select id='post_author_override' name='post_author_override' class=''>"; foreach($users as $user) { $output .= "<option value='".$user->id."'>".$user->user_login."</option>"; } $output .= "</select>"; } return $output; } ` Any help would be extremely appreciated!

    Read the article

  • Phonegap jqm mixing local and server html files

    - by DavidVdd
    I would like to add some online pages to an application keep them up to date without releasing a new store version. For this I taught I could use jqm ajax navigation to load the external page. (I'm aware that might not be allowed for all platforms.) I have set: $.mobile.allowCrossDomainPages = true; $.mobile.pushStateEnabled = false; This seems to work but the problem is that all my href's and $.mobile.ChangePages would have to be changed to <a href='http://mydomain.com/mypage.html'>link</a> $.mobile.changePage('http://mydomain.com/mypage.html'); in stead of <a href='mypage.html'>link</a> $.mobile.changePage('http://mydomain.com/mypage.html'); I was thinking about overriding the changepage method(found this somewhere) to add a domain when the user is online, but the problem is that this method get's called more then once. var originalChangePage = $.mobile.changePage; $.mobile.changePage = function(to, options) { var o = JSON.stringify(o); try { to = to.replace('file:///android_asset/www/', 'http://mydomain.com/'); } catch (err) { //to isn't always filled in. } originalChangePage(to, options); }; Is there a better way to load html pages locally and online using jqm ajax navigation? Extra info: Phonegap/Cordova version 3.5.0 jqm 1.3.2

    Read the article

  • jQuery AJAX Redirection problem

    - by meosoft
    Hello please consider this: On page A I have a link that takes you to page B when JS is off, but when JS is on, I want to replace content on current page with content from the page B. Pages A and B are in fact the same script that is able to tell AJAX calls from regular ones and serve the content appropriately. Everything works fine, as long as there are no redirects involved. But, sometimes there is a 301 redirect and what seems to be happening is that client browser then makes a second request, which will return with a 200 OK. Only the second request is sent without a X-Requested-With header, therefore I cannot tell within my script wether it came from AJAX or not, and will send a complete page instead of just the content. I have tried checking for 301 status code in my error, success, and complete handlers but none of them worked. It seems to be handling the 301 behind the scenes. Could anyone help me with this? jQuery 1.4, PHP 5 Edit: People requested the code to this, which I didn't think was necessary but here goes: // hook up menu ajax loading $('#menu a').live("click", function(){ // update menu highlight if($(this).parents('#menu').size() > 0){ $("#menu>li").removeClass("current_page_item"); $(this).parent().addClass("current_page_item"); } // get the URL where we will be retrieving content from var url = $(this).attr('href'); window.location.hash = hash = url; $.ajax({ type: "GET", url: url, success: function(data){ // search for an ID that is only present if page is requested directly if($(data).find('#maincontent').size() > 0){ data = $(data).find('#maincontent .content-slide *').get(); } // the rest is just animating the content into view $("#scroller").html(data); $('.content-slide').each(setHeight); $('.content-slide').animate({ left: "0px" }, 1000, 'easeOutQuart', function(){ $('#home').css("left", "-760px").html(data); $('#scroller').css("left", "-760px"); $('.content-slide').each(setHeight); } ); } }); return false; });

    Read the article

  • radio input replacement using jquery

    - by altvali
    It may seem a bit odd to ask this since there are several solutions out there but the fact is that all of them look pretty and none of what i've seem save the input value for form submission the right way. I'm looking for something that will replace all radio inputs with divs that get special classes when they are hovered or clicked, and an input type hidden for every group of radio inputs with the same name, hidden input that will be updated with the value corresponding to the div the user clicks on. Long sentence, i know. Here's what i've come up with: $('input:radio').each(function(){ if (this.style.display!='none') { var inputName = $(this).attr('name'); var inputValue = $(this).attr('value'); var isChecked = $(this).attr('checked'); if (!$('input:hidden[name='+inputName+']').length) // if the hidden input wasn't already created $(this).replaceWith('<div class="inputRadioButton" id="'+inputName+'X'+inputValue+'"></div><input type="hidden" name="'+inputName+'" value="'+inputValue+'" />'); else{ $(this).replaceWith('<div class="inputRadioButton" id="'+inputName+'X'+inputValue+'"></div>'); if (isChecked) $('input:hidden[name='+inputName+']').attr({'value':inputValue}); } //this bind doesn't work $("#"+inputName+"X"+inputValue).click(function(){ if($('input:hidden[name='+inputName+']').val()!=inputValue){ $('input:hidden[name='+inputName+']').attr({'value':inputValue}); $('div[id*='+inputName+'].inputRadioButton').removeClass('inputRadioButtonSelected'); } if (!$("#"+inputName+"X"+inputValue).hasClass('inputRadioButtonSelected')) $("#"+inputName+"X"+inputValue).addClass('inputRadioButtonSelected'); }); } }); Please tell me how to fix it. Thank you. Edit I've found the reason. It should normally work but some of my radio inputs generated by an e-commerce software had brackets in them (e.g. id[12] ) and jQuery was parsing that. The fix is adding var inputButton = document.getElementById(inputName+"X"+inputValue); before the bind and replacing $("#"+inputName+"X"+inputValue) with $(inputButton).

    Read the article

  • Which templating languages output HTML *as a tree of nodes*?

    - by alamar
    HTML is a tree of nodes, before all. It's not just a text. However, most templating engines handle their input and output as it was just a text; they don't care what happens around their tags, their {$foo}'s and <% bar() %>'s; also they don't care about what are they outputting. Sometimes they happen to produce a correct html, but that's just a coincidence; they didn't aim for that, all they wanted is to replace some funny marks in the text stream with their evaluation. There are a few templating engines which do treat their output as a set of nodes; XSLT and Haml come to mind. For some tasks, this has advantages: for example, you can automatically reformat (like, delete all empty text nodes; auto-indent; word-wrap). The result is guaranteed to be a correct xml/sgml unless you use a strict subset of operations that can break that. Also, such templating engine would automatically quote strings, differently in text nodes and in attributes, because it strictly knows whether you're writing an attribute or a text node. Moreover, it can conditionally remove a node from output because it knows where it does begin and end, which is useful, and do other non-trivial node operations. You might not like XSLT for its verbosiness or functionalness, but it's damn helps that your template is xmllint-able XML, and your output is a good sgml/xml. So the question is: Which template engines do you know that treat their output as a set of correct nodes, not just an unstructured text? I know XSLT, Haml and some obscure python-based one. Moar!

    Read the article

< Previous Page | 329 330 331 332 333 334 335 336 337 338 339 340  | Next Page >