Search Results

Search found 46009 results on 1841 pages for 'first timer'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 336/1841 | < Previous Page | 332 333 334 335 336 337 338 339 340 341 342 343  | Next Page >

  • Can I do this in only one query ?

    - by Paté
    Merry christmas everyone, I Know my way around SQL but I'm having a hard time figuring this one out. First here are my tables (examples) User id name friend from //userid to //userid If user 1 is friend with user 10 then you a row with 1,10. User 1 cannot be friend with user 10 if user 10 is not friend with user 1 so you have 1,10 10,1 It may look weird but I need those two rows per relations. Now I'm trying to make a query to select the users that have the most mutual friend with a given user. For example User 1 is friend with user 10,9 and 7 and user 8 is friend with 10,9 and 7 too ,I want to suggest user 1 to invite him (like facebook). I want to get like the 10 first people with the most mutual friend. The output would be like User,NumOfMutualFriends I dont know if that can be done in a single query ? Thanks in advance for any help.

    Read the article

  • How do i resolve method Overlapping in java/Processing [duplicate]

    - by user3718913
    This question already has an answer here: How do I compare strings in Java? 24 answers I have two methods/function in a class, called, Qestion1 and Question2, i want it in such a way that after the user has answered Question one correctly, the Question 2 method is called. Whenever i call the method 2, it displays both of them together instead exiting the first method first. Here's a dummy code to illustrate what i'm saying: void Question1() { String question="What is the capital of England?"; String Answer="London"; if(Answer=='London') { Question2(); } } void Question2() { String question="What is the capital of California?"; String Answer="Sacramento"; if(Answer=='Sacramento') { Question3(); } } Pls, this question is in no way related to that other question. Pls peruse the thread again.

    Read the article

  • Qt hide QLayout (switch between two layouts)

    - by Lodhart
    I didn't find solution for my problem with two QLayouts. I need app with QHBoxLayout with possible expandind when I will add new widgets, push buttons, .... So what I have: One QDialog and two layouts. Now I know that I can't hide the layout. So I tray just : layout()->removeItem(firstlayout); layout()->addLayout(secondLayout); But when I did this, I saw all items in first layout on possition [0,0]. So next step I try: for (all items in first layout) if (widget) widget->hide(); But this is working only with QWidget and I have many different items in layouts. Simply way is use the widget, because there is possibole to use hide/show, but I need auto expanding window when I add new items.

    Read the article

  • Is using a DataSet's column Expression works in background same as manual calculation?

    - by Harikrishna
    I have one datatable which is not bindided and records are coming from the file by parsing it in the datatable dynamically every time. Now there is three columns in the datatable Marks1,Marks2 and FinalMarks. And their types is decimal. Now for making addition of columns Marks1 and Marks2 's records and store it into FinalMarks column,For that what I do is : datatableResult.Columns["FinalMarks"].Expression="Marks1+Marks2"; It's works properly. It can be done in other way also is foreach (DataRow r in datatableResult.Rows) { r["FinalMarks"]=Convert.ToDecimal(r["Marks1"])+Convert.ToDecimal(r["Marks2"]); } Is first approach same as second approach in background means is both approach same or what? EDIT: I want to know that first approach works in background as second approach.

    Read the article

  • Is this the correct way to build a Perl hash that utilizes arrays?

    - by Structure
    This is the first time I have manipulated hashes and arrays in this way -- and it is working. Basically, for every key there are multiple values that I want to record and then print out in the form "key -- value -- value -- val..." My code is as follows. I am surprised that it works, so concerned that it works "by mistake". Is this the correct way to accomplish this task, or is there a more efficient or appropriate method? while ($source =~ m/(regex)/g) { #Get all key names from source $listkey = $1; #Set current list key to the current regex result. $list{$listkey} = ++$i unless $list{$listkey}; #Add the key to the hash unless it already exists. $list{$listkey} = [] unless exists $list{$listkey}; #Add an array for the hash unless the hash already exists. while ($loopcount==0) { if ($ifcount==0) { $listvalue=result_of_some_function_using_list_key; #Get the first list value from the list key. $ifcount++; #Increment so we only get the first list value once. } else { $listvalue=result_of_some_function_using_list_value; #Update the last list value. } if ($listvalue) { #If the function returned a value... push @{$list{$listkey}}, $listvalue; #...then add the value to the hash array for the key. } else { #There are no more values and we need a new key. $listkey=0; #Reset variable. $domain=0; #Reset variable. $loopcount++; #Increment loop counter to exit loop. } } $ifcount=0; #Reset count variable so the next listvalue can be generated from the new key. $loopcount=0; #Reset count variable so another loop can begin for a new key. } foreach $listkey (keys %list) { #For each key in the hash. print "$listkey --> "; #Print the key. @values = @{$list{$listkey}}; #Reference the arrays of the hash. print join ' --> ', @values; #Print the values. print "\n"; #Print new line. }

    Read the article

  • Why is it when I set "closeOnEscape" to false and then "closeOnEscape" to true jquery dialog escape

    - by chobo2
    Hi I am using jquery ui 1.8 and I have a model dialog that popups up and if a user clicks on a checkbox another one comes up. This requires them to say "yes" or "no" so I removed the "X" on the dialog and put closeOnEscape to false. However I noticed when I did that the model dialog underneath it would close when they hit escape. So now when the one that pops up when the checkbox is checked I disable closeOnEscape on the first dialog box. When they close it I enable again yet it does not work. I am not sure why $("#Dialog").dialog( "option", "closeOnEscape", true); I even do this in firebug. I just open my first dialog up Do this in firebugs console $("#Dialog").dialog( "option", "closeOnEscape", false); Then verify that escape is now disabled. I then try to enable it again $("#Dialog").dialog( "option", "closeOnEscape", true); Yet it never enables.

    Read the article

  • Passing parameters among views in a navigation frame INSIDE a custom control

    - by NetWriter
    I created a silverlight 3 application with a navigation frame and 3 views: search, add and edit. I used the app file to pass parameters among the 3 pages, eg: ((App)Application.Current).SNIPSELECTED = currentSnip; Then in the receiving page: currentSnip = ((App)Application.Current).SNIPSELECTED; currentSnip is a SnipItem object: public class SnipItem { public string itemID {get;set;} public string category {get;set;} public string itemDescription {get;set;} public string codeSnip {get;set;} } This worked fine until I decided to make this entire application into a user control and put that inside a second silverlight application with its own navigation frame and app file. The app files are getting confused. The first app file with all my parameter passing is not being read. I know how to pass a simple parameter between views in the first application without the app file (in a query string), but how about these custom types like my currentSnip above?

    Read the article

  • css of pagination links

    - by fusion
    i'd like a basic idea of how to go about formatting the following paging of the search result. this is the paging code: //Create and print the Navigation bar $nav=""; $next = $page+1; $prev = $page-1; if($page > 1) { $nav .= "<div class=\"search_mainpg\"><div class=\"searchpage\" style=\"width:5%;\"><a onclick=\"showPage('','$prev'); return false;\" href=\"$self?page=" . $prev . "&q=" .urlencode($search_result) . "\">< Prev</a></div>"; $first = "<div class=\"searchpage\" style=\"width:2%;\"><a onclick=\"showPage('','1'); return false;\" href=\"$self?page=1&q=" .urlencode($search_result) . "\"> << </a></div>" ; } else { $nav .= "&nbsp;"; $first = "&nbsp;"; } for($i = 1 ; $i <= $numpages ; $i++) { if($i == $page) { $nav .= "<b>$i</b>"; }else{ $nav .= "<div class=\"searchpage\" style=\"width:2%;\"><a onclick=\"showPage('',$i); return false;\" href=\"$self?page=" . $i . "&q=" .urlencode($search_result) . "\">$i</a></div>"; } } if($page < $numpages) { $nav .= "<div class=\"searchpage\" style=\"width:5%;\"><a onclick=\"showPage('','$next'); return false;\" href=\"$self?page=" . $next . "&q=" .urlencode($search_result) . "\">Next ></a></div>"; $last = "<div class=\"searchpage\" style=\"width:2%;\"><a onclick=\"showPage('','$numpages'); return false;\" href=\"$self?page=$numpages&q=" .urlencode($search_result) . "\"> >> </a></div></div>"; } else { $nav .= "&nbsp;"; $last = "&nbsp;"; } echo $first . $nav . $last; currently, it displays like this:

    Read the article

  • Prolem with if function

    - by Ryan
    Hi, something seems to be wrong with the first line of this if function, seems alright to me though. if ($count1 == sizeof($map) && $count2 == sizeof($map[0])){ echo ";"; }else{ echo ","; } This is the error I get (line 36 is the first line of the above line.) Parse error: parse error in C:\wamp\www\game\mapArrayConvertor.php on line 36 EDIT: The OP notes in an answer below that the error was a missing semi-colon on line 35 and not the code included in the question.

    Read the article

  • Multible jquery .load() methods not running concurrently in MVC 2

    - by Boob
    In one of my aspx pages i have something like this in the head: <script type="text/javascript"> $(function() { // Jquery stuff loadStuff(); }); function loadStuff() { $('#result1').load({ source: url }); $('#result2').load({ source: url }); $('#result3').load({ source: url }); }; </script> The idea being that as the page is being displayed these loads will populate the specified divs with results from different webservices as and when the info becomes available. My problem is that this requests are being queued and being sent one at a time. However I want these to be sent at the same time and whichever returns first gets displayed first! Also if I try to kick off another request while these divs are loading the request seems to get queued after the others. How do I make these requests concurrent instead of queued? Thanks

    Read the article

  • How do I link (dependency) properties in my ViewModel?

    - by mos
    Simplified example: I have an object that models a user. Users have a first name and a last name. The UserViewModel has a dependency property for my Models.User object. In the declaration of the UserView's xaml, I want to bind a couple of TextBlocks to the first and last name properties. What is the correct way to do this? Should I have readonly DependencyProperties for the name fields, and when the dependency property User is set, update them? Can the name fields be regular C# properties instead? Or, should I bind like this: <TextBlock Text="{Binding User.FirstName}" />

    Read the article

  • Why doesn't list.get(0).equals(null) work?

    - by Jessy
    The first index is set to null (empty), but it doesn't print the right output, why? //set the first index as null and the rest as "High" String a []= {null,"High","High","High","High","High"}; //add array to arraylist ArrayList<Object> choice = new ArrayList<Object>(Arrays.asList(a)); for(int i=0; i<choice.size(); i++){ if(i==0){ if(choice.get(0).equals(null)) System.out.println("I am empty"); //it doesn't print this output } }

    Read the article

  • Portrait vs Landscape Launch Images

    - by andrewx
    An iPad app can support inclusion of launch images in both orientations; presumably, if your app supports auto-rotation, then this would suggest to me that if the user launches an app while the device is in Landscape mode, then the Landscape launch image is used. But in all the apps I've built and released, this has never been the case. Never once has the Landscape launch image appeared, only the Portrait. After loading, the app will auto-rotate to whatever orientation the device is in, but at launch, it assumes you are in Portrait. Always. Why? I have seen many other apps in the store that behave this way, but then there are some seem to always automatically know immediately at first launch, from that first launch image, that you are in Landscape, if that's the case. How is this done?

    Read the article

  • Mercurial: Recommended way of sending a whole repository to someone

    - by Svish
    I have done some programming and I have used Mercurial for source control. I now need to send all of my code to someone else (because they are going to take over). Since all copies of a mercurial repository is a full and real repository my first thought is to first do a clone of my repository without an update and then zipping and emailing that clone. Is this a good way, or is there a better way? For example when using the TortoiseHg Repository Explorer I can right-click on a changeset and under Export there are various options that looks like they could be doing something interesting, but I don't quite understand them or know which one to use.

    Read the article

  • Perform tasks with delay, without delaying web response (ASP.NET)

    - by Tomas Lycken
    I'm working on a feature that needs to send two text messages with a 30 second delay, and it is crucial that both text messages are sent. Currently, this feature is built with ajax requests, that are sent with a 30 second javascript delay, but since this requires the user to have his browser open and left on the same page for at least 30 seconds, it is not a method I like. Instead, I have tried to solve this with threading. This is what I've done: Public Shared Sub Larma() Dim thread As New System.Threading.Thread(AddressOf Larma_Thread) thread.Start() End Sub Private Shared Sub Larma_Thread() StartaLarm() Thread.Sleep(1000 * 30) StoppaLarm() End Sub A web handler calls Larma(), and StartaLarm() and StoppaLarm() are the methods that send the first and second text messages respectively. However, I only get the first text message delivered - the second is never sent. Am I doing something wrong here? I have no deep understanding of how threading works in ASP.NET, so please let me know how to accomplish this.

    Read the article

  • Delegate Example From C# In Depth Confusion

    - by ChloeRadshaw
    I am looking at this example: List<Product> products = Product. GetSampleProducts() ; products.Sort( (first, second) => first.Name.CompareTo(second. Name) ) ; foreach (Product product in products) { Console. WriteLine(product) ; } What function is actually called in the API when you do that? Does the compiler create a class which implemnents the IComparer interface? I thought delegates were anonymous methods - Here it seems to be an anonymous interface implementation which is casuing confusion

    Read the article

  • C# Same DataSource + Multiple DataGridViews = Data Binding Issues?

    - by C. Griffin
    Here's what I'm doing: I have (2) DataGridView controls DGV #1 is bound to the DataSet, DGV #2 is bound to a DataView of the SAME DataSet Now, what I'm needing to accomplish here is this: When a user checks a boolean column on the original DGV, the second DGV should now display the newly checked row also. The context is that the first DGV is a master list, and the second one is a "favorite" view of the first. When I check the rows, the favorite column does NOT update. Do I need to use a DataAdapter to actually update the database, or can I operate directly on the DataSet (DataTable) -- or even with the Rows in the original DataGridView?

    Read the article

  • How does linq decide between inner & outer joins

    - by user287795
    Hi Usually linq is using an left outer join for its queries but on some cases it decides to use inner join instead. I have a situation where that decision results in wrong results since the second table doesn't always have suitable records and that removes the records from the first table. I'm using a linqdatasource over a dbml where the relevant tables are identical but one holds historical records removed from the first. both have the same primary key. and I'm using a dataloadoption to load both tables at once with out round trips. Would you explain why linq decided to use an inner join here? Thanks

    Read the article

  • How to hang up (disconnect, terminate,..) incomings call???

    - by Cesar Valiente
    "How do you hang up incoming calls (in Android of course)?" First, I know this question has been asked and answered several times, and the response is always "you can't". But if we look in the market we get a few applications (all private software, no access to the source code... :-( ) that do this action, such as CallFilter, Panda firewall and others... So... does somebody know how these apps do the hang up action, (or terminate, or disconnect or whatever you call it..)? And other question, if the first don't get a response.. does somebody know how send an incoming call to the voice mail? Of course, all questions are about how to do it programmatically. So with the voicemail question I know there's a flag in contacts that is used for that, but like I said, I'd like to know the programmatical way. Thanks all!

    Read the article

  • Shared memory of same DLL in different 32 bit processes is sometimes different in a terminal session

    - by KBrusing
    We have an 32 bit application consisting of some processes. They communicate with shared memory of a DLL used by every process. Shared memory is build with global variables in C++ by "#pragma data_seg ("Shared")". When running this application sometime during starting a new process in addition to an existing (first) process we observe that the shared memory of both processes is not the same. All new started processes cannot communicate with the first process. After stopping all of our processes and restarting the application (with some processes) everything works fine. But sometime or other after successfully starting and finishing new processes the problem occurs again. Running on all other Windows versions or terminal sessions on Windows server 2003 our application never got this problem. Is there any new "feature" on Windows server 2008 that might disturb the hamony of our application?

    Read the article

  • Calculating color shades

    - by matejv
    I have the next problem. I have a base color with couple of different shades of that color. Example: Base color: #4085c5 Shade: #005cb1 Now, I have a different color (let's say #d60620), but no shades of it. From the color I would like to calculate shades, that have similar difference as colors mentioned in first paragraph. First I tried calculating difference of RGB elements and applying them to second color, but the result was not like I expected to be. Than I tried with converting color to HSV, reading saturation value and applying the difference to second color, but again the resulting color was still weird. The formula was something like: (HSV(BaseColor)[S] - HSV(Shade)[S]) + HSV(SecondColor)[H] Does anyone know how this problem could be solved? I know I am doing something wrong, but I don't know what. :)

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 332 333 334 335 336 337 338 339 340 341 342 343  | Next Page >