Search Results

Search found 21098 results on 844 pages for 'model import'.

Page 336/844 | < Previous Page | 332 333 334 335 336 337 338 339 340 341 342 343  | Next Page >

  • Python class design - Splitting up big classes into multiple ones to group functionality

    - by Ivo Wetzel
    OK I've got 2 really big classes 1k lines each that I currently have split up into multiple ones. They then get recombined using multiple inheritance. Now I'm wondering, if there is any cleaner/better more pythonic way of doing this. Completely factoring them out would result in endless amounts of self.otherself.do_something calls, which I don't think is the way it should be done. To make things clear here's what it currently looks like: from gui_events import GUIEvents # event handlers from gui_helpers import GUIHelpers # helper methods that don't directly modify the GUI # GUI.py class GUI(gtk.Window, GUIEvents, GUIHelpers): # general stuff here stuff here One problem that is result of this is Pylint complaining giving me trillions of "init not called" / "undefined attribute" / "attribute accessed before definition" warnings.

    Read the article

  • Filtering a dropdown in Angular IE11 issue

    - by Brian S.
    I have a requirement for a select html element that can be duplicated multiple times on a page. The options for these select elements all come from a master list. All of the select elements can only show all of the items in the master list that have not been selected in any of the other select elements unless they just were duplicated. So I wrote a custom filter to do this in Angular and it seems to work just fine provided you are not using IE11. In IE when you select a new item from a duplicated select element, it seems to select the option after the one you selected even though the model still has the correct one set. I realize this sounds convoluted, so I created a jFiddle example. Using IE 11 try these steps: Select Bender Click the duplicate link Select Fry Notice that the one that is selected is Leela but the model still has Fry (id:2) as the one selected Now if you do the same thing in Chrome everything works as expected. Can anyone tell me how I might get around this or what I might be doing wrong? Here is the relevant Angular code: myapp.controller('Ctrl', function ($scope) { $scope.selectedIds = [{}]; $scope.allIds = [{ name: 'Bender', value: 1}, {name: 'Fry', value: 2}, {name: 'Leela', value: 3 }]; $scope.dupDropDown = function(currentDD) { var newDD = angular.copy(currentDD); $scope.selectedIds.push(newDD); } }); angular.module('appFilters',[]).filter('ddlFilter', function () { return function (allIds, currentItem, selectedIds) { //console.log(currentItem); var listToReturn = allIds.filter(function (anIdFromMasterList) { if (currentItem.id == anIdFromMasterList.value) return true; var areThereAny = selectedIds.some(function (aSelectedId) { return aSelectedId.id == anIdFromMasterList.value; }); return !areThereAny; }); return listToReturn; } }); And here is the relevant HTML <div ng-repeat="aSelection in selectedIds "> <a href="#" ng-click="dupDropDown(aSelection)">Duplicate</a> <select ng-model="aSelection.id" ng-options="a.value as a.name for a in allIds | ddlFilter:aSelection:selectedIds"> <option value="">--Select--</option> </select> </div>

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • Having trouble with binding

    - by Tam
    I'm not sure if I'm misunderstanding the binding in Flex. I'm using Cairngorm framework. I have the following component with code like: [Bindable] var _model:LalModelLocator = LalModelLocator.getInstance(); .... <s:DataGroup dataProvider="{_model.friendsSearchResults}" includeIn="find" itemRenderer="com.lal.renderers.SingleFriendDisplayRenderer"> <s:layout> <s:TileLayout orientation="columns" requestedColumnCount="2" /> </s:layout> </s:DataGroup> in the model locator: [Bindable] public var friendsSearchResults:ArrayCollection = new ArrayCollection(); Inside the item renderer there is a button that calls a command and inside the command results there is a line like this: model.friendsSearchResults = friendsSearchResults; Putting break points and stepping through the code I confirmed that this like gets called and the friendsSearchResults gets updated. To my understanding if I update a bindable variable it should automatically re-render the s:DataGroup which has a dataProvider of that variable.

    Read the article

  • Django Managers

    - by owca
    I have the following models code : from django.db import models from categories.models import Category class MusicManager(models.Manager): def get_query_set(self): return super(MusicManager, self).get_query_set().filter(category='Music') def count_music(self): return self.all().count() class SportManager(models.Manager): def get_query_set(self): return super(MusicManager, self).get_query_set().filter(category='Sport') class Event(models.Model): title = models.CharField(max_length=120) category = models.ForeignKey(Category) objects = models.Manager() music = MusicManager() sport = SportManager() Now by registering MusicManager() and SportManager() I am able to call Event.music.all() and Event.sport.all() queries. But how can I create Event.music.count() ? Should I call self.all() in count_music() function of MusicManager to query only on elements with 'Music' category or do I still need to filter through them in search for category first ?

    Read the article

  • Is this a good way to do a game loop for an iPhone game?

    - by Danny Tuppeny
    Hi all, I'm new to iPhone dev, but trying to build a 2D game. I was following a book, but the game loop it created basically said: function gameLoop update() render() sleep(1/30th second) gameLoop The reasoning was that this would run at 30fps. However, this seemed a little mental, because if my frame took 1/30th second, then it would run at 15fps (since it'll spend as much time sleeping as updating). So, I did some digging and found the CADisplayLink class which would sync calls to my gameLoop function to the refresh rate (or a fraction of it). I can't find many samples of it, so I'm posting here for a code review :-) It seems to work as expected, and it includes passing the elapsed (frame) time into the Update method so my logic can be framerate-independant (however I can't actually find in the docs what CADisplayLink would do if my frame took more than its allowed time to run - I'm hoping it just does its best to catch up, and doesn't crash!). // // GameAppDelegate.m // // Created by Danny Tuppeny on 10/03/2010. // Copyright Danny Tuppeny 2010. All rights reserved. // #import "GameAppDelegate.h" #import "GameViewController.h" #import "GameStates/gsSplash.h" @implementation GameAppDelegate @synthesize window; @synthesize viewController; - (void) applicationDidFinishLaunching:(UIApplication *)application { // Create an instance of the first GameState (Splash Screen) [self doStateChange:[gsSplash class]]; // Set up the game loop displayLink = [CADisplayLink displayLinkWithTarget:self selector:@selector(gameLoop)]; [displayLink setFrameInterval:2]; [displayLink addToRunLoop:[NSRunLoop currentRunLoop] forMode:NSDefaultRunLoopMode]; } - (void) gameLoop { // Calculate how long has passed since the previous frame CFTimeInterval currentFrameTime = [displayLink timestamp]; CFTimeInterval elapsed = 0; // For the first frame, we want to pass 0 (since we haven't elapsed any time), so only // calculate this in the case where we're not the first frame if (lastFrameTime != 0) { elapsed = currentFrameTime - lastFrameTime; } // Keep track of this frames time (so we can calculate this next time) lastFrameTime = currentFrameTime; NSLog([NSString stringWithFormat:@"%f", elapsed]); // Call update, passing the elapsed time in [((GameState*)viewController.view) Update:elapsed]; } - (void) doStateChange:(Class)state { // Remove the previous GameState if (viewController.view != nil) { [viewController.view removeFromSuperview]; [viewController.view release]; } // Create the new GameState viewController.view = [[state alloc] initWithFrame:CGRectMake(0, 0, IPHONE_WIDTH, IPHONE_HEIGHT) andManager:self]; // Now set as visible [window addSubview:viewController.view]; [window makeKeyAndVisible]; } - (void) dealloc { [viewController release]; [window release]; [super dealloc]; } @end Any feedback would be appreciated :-) PS. Bonus points if you can tell me why all the books use "viewController.view" but for everything else seem to use "[object name]" format. Why not [viewController view]?

    Read the article

  • ASP.NET MVC 2 generation of the List/Index view

    - by Klas Mellbourn
    ASP.NET MVC 2 has powerful features for generating the model-dependent content of the Edit view (using EditorForModel) and Details view (using DisplayForModel) that automatically utilizes metadata and editor (or display) templates: <% using (Html.BeginForm()) {%> <%= Html.ValidationSummary(true) %> <fieldset> <legend><%= Html.LabelForModel() %></legend> <%= Html.EditorForModel() %> <p> <input type="submit" value="Save" /> </p> </fieldset> <% } %> However, I cannot find any comparable tools for the "last" step of generating the Index view (a.k.a. the List view). There I have to hard code the columns first in the row representing the headers and then inside the foreach loop: <h2>Index</h2> <table> <tr> <th></th> <th> ID </th> <th> Foo </th> <th> Bar </th> </tr> <% foreach (var item in Model) { %> <tr> <td> <%= Html.ActionLink("Edit", "Edit", new { id=item.ID }) %> | <%= Html.ActionLink("Details", "Details", new { id=item.ID })%> | <%= Html.ActionLink("Delete", "Delete", new { id=item.ID })%> </td> <td> <%= Html.Encode(item.ID) %> </td> <td> <%= Html.Encode(item.Foo) %> </td> <td> <%= Html.Encode(String.Format("{0:g}", item.Bar)) %> </td> </tr> <% } %> </table> What would be the best way to generate the columns (utlizing metadata such as HiddenInput), with the aim of making the Index view as free of model particulars as Edit and Details?

    Read the article

  • Parsing Json Feeds with google Gson

    - by mnml
    I would like to know how to parse a json feed by items, eg. url / title / description for each item. I have had a look to the doc / api but, it didn't help me. This is what I got so far import com.google.gson.Gson; import com.google.gson.JsonObject; public class ImportSources extends Job { public void doJob() throws IOException { String json = stringOfUrl("http://feed.test/all.json"); JsonObject jobj = new Gson().fromJson(json, JsonObject.class); Logger.info(jobj.get("responseData").toString()); } public static String stringOfUrl(String addr) throws IOException { ByteArrayOutputStream output = new ByteArrayOutputStream(); URL url = new URL(addr); IOUtils.copy(url.openStream(), output); return output.toString(); } }

    Read the article

  • Rails & ActiveRecord: Appending methods to models that inherit from ActiveRecord::Base

    - by PlankTon
    I have a standard ActiveRecord model with the following: class MyModel < ActiveRecord::Base custom_method :first_field, :second_field end At the moment, that custom_method is picked up by a module sent to ActiveRecord::Base. The functionality basically works, but of course, it attaches itself to every model class, not just MyModel. So if I have MyModel and MyOtherModel in the same action, it'll assume MyOtherModel has custom_method :first_field, :second_field as well. So, my question is: How do I attach a method (eg: def custom_method(*args)) to every class that inherits from ActiveRecord::Base, but not by attaching it to ActiveRecord::Base itself? Any ideas appreciated.

    Read the article

  • JavaScript/Dojo Module Pattern - how to debug?

    - by djna
    I'm working with Dojo and using the "Module Pattern" as described in Mastering Dojo. So far as I can see this pattern is a general, and widely used, JavaScript pattern. My question is: How do we debug our modules? So far I've not been able to persuade Firebug to show me the source of my module. Firebug seems to show only the dojo eval statement used to execute the factory method. Hence I'm not able to step through my module source. I've tried putting "debugger" statements in my module code, and Firebug seems to halt correctly, but does not show the source. Contrived example code below. This is just an example of sufficient complexity to make the need for debugging plausible, it's not intended to be useful code. The page <!-- Experiments with Debugging --> <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01//EN" "http://www.w3.org/TR/html4/strict.dtd"> <html> <head> <title>console me</title> <style type="text/css"> @import "../dojoroot/dojo/resources/dojo.css"; @import "../dojoroot/dijit/themes/tundra/tundra.css"; @import "edf.css"; </style> <script type="text/javascript" src="../dojoroot/dojo/dojo.js"> </script> <script type="text/javascript" > dojo.registerModulePath("mytest", "../../mytest"); dojo.require("mytest.example"); dojo.addOnLoad(function(){ mytest.example.greet(); }); </script> </head> <body class="tundra"> <div id="bulletin"> <p>Just Testing</p> </div> </body> </html> <!-- END: snip1 --> The java script I'd like to debug dojo.provide("mytest.example"); dojo.require("dijit.layout.ContentPane"); /** * define module */ (function(){ //define the main program functions... var example= mytest.example; example.greet= function(args) { var bulletin = dojo.byId("bulletin"); console.log("bulletin:" + bulletin); if ( bulletin) { var content = new dijit.layout.ContentPane({ id: "dummy", region: "center" }); content.setContent('Greetings!'); dojo._destroyElement(bulletin); dojo.place(content.domNode, dojo.body(), "first"); console.log("greeting done"); } else { console.error("no bulletin board"); } } })();

    Read the article

  • Django: Summing values of records grouped by foreign key

    - by Dan0
    Hi there In django, given the following models (slightly simplified), I'm struggling to work out how I would get a view including sums of groups class Client(models.Model): api_key = models.CharField(unique=True, max_length=250, primary_key=True) name = models.CharField(unique=True, max_length=250) class Purchase(models.Model): purchase_date = models.DateTimeField() client = models.ForeignKey(SavedClient, to_field='api_key') amount_to_invoice = models.FloatField(null=True) For a given month, I'd like to see e.g. April 2010 For Each Client that purchased this month: * CLient: Name * Total amount of Purchases for this month * Total cost of purchases for this month For each Purchase made by client: * Date * Amount * Etc I've been looking into django annotation, but can't get my head around how to sum values of a field for a particular group over a particular month and send the information to a template as a variable/tag. Any info would be appreciated

    Read the article

  • How to stop a QDialog from executing while still in the __init__ statement(or immediatly after)?

    - by Jonathan
    I am wondering how I can go about stopping a dialog from opening if certain conditions are met in its __init__ statement. The following code tries to call the 'self.close()' function and it does, but (I'm assuming) since the dialog has not yet started its event loop, that it doesn't trigger the close event? So is there another way to close and/or stop the dialog from opening without triggering an event? Example code: from PyQt4 import QtCore, QtGui class dlg_closeInit(QtGui.QDialog): ''' Close the dialog if a certain condition is met in the __init__ statement ''' def __init__(self): QtGui.QDialog.__init__(self) self.txt_mytext = QtGui.QLineEdit('some text') self.btn_accept = QtGui.QPushButton('Accept') self.myLayout = QtGui.QVBoxLayout(self) self.myLayout.addWidget(self.txt_mytext) self.myLayout.addWidget(self.btn_accept) self.setLayout(self.myLayout) # Connect the button self.connect(self.btn_accept,QtCore.SIGNAL('clicked()'), self.on_accept) self.close() def on_accept(self): # Get the data... self.mydata = self.txt_mytext.text() self.accept() def get_data(self): return self.mydata def closeEvent(self, event): print 'Closing...' if __name__ == '__main__': import sys app = QtGui.QApplication(sys.argv) dialog = dlg_closeInit() if dialog.exec_(): print dialog.get_data() else: print "Failed"

    Read the article

  • ASP.Net MVC view unable to see HtmlHelper extension method

    - by larryq
    Hi everyone, We're going through an ASP.Net MVC book and are having trouble with using an extenstion method within our view. The Extension method looks like this: using System; using System.Runtime.CompilerServices; using System.Web.Mvc; namespace MvcBookApplication { public static class HtmlHelperExtensions { public static string JQueryGenerator(this HtmlHelper htmlHelper, string formName, object model); } } We use the extension method in our view like this: <%=Html.JQueryGenerator("createmessage", ViewData.Model)%> The problem is, that line of code says JQueryGenerator isn't a recognized method of HtmlHelper. I believe we've got the correct references set in the web project, but are there other things we can check? There's no using statement for views, is there?

    Read the article

  • GWT and java.io.Serializable

    - by Ethan Leroy
    Hello, In my GWT app I have the following model class: import com.google.gwt.user.client.rpc.IsSerializable; public class TestEntity implements IsSerializable { public String testString; } This class implements the GWT custom IsSerializable marker interface - which I really don't like, because I use my model classes not only for GWT. So I prefer java.io.Serializable. But if I modify the class to implement Serializable instead of IsSerializable, the GWT RPC mechanism doesn't work anymore. I don't get an error on the server side, but on the client AsyncCallback.onFailure is invoked. I am using... GWT 1.7.0. Spring 2.5.6.SEC01 Spring and GWT are configured as described here.

    Read the article

  • How to perform insert and update with Ado.net dataservices (EF and Inheritance)

    - by Thurein
    Hi, I have an entity model, in which I have a table per type inheritance. There are 3 types, first, Contact, which I defined as abstract in my EF model and the rest are Company and person types which are derived from contact type. Is it possible to perform an insert using ado.net dataservice and asp.net ajax library? I was trying the following client code : dataContext.insertEntity(person, "Contacts"); I was getting this response from server : Error processing request stream. Type information must be specified for types that take part in inheritance. Thanks.

    Read the article

  • Convert Wordpress.com Hosted Blog to BlogEngine.NET

    - by Chris Marisic
    I'm looking at what is needed to move from wordpress.com to a BlogEngine.NET or similar blog. I've seen a tool for replacing export.php so that it will export your wordpress site in BlogML format so it can easily be imported into BlogEngine.NET, however I'd really not want to have to setup php/wordpress just so I can import a back up from wordpress.com and then use the export from my local wordpress to have a BlogML file. Are there any tools that will convert the wordpress file? Is there a different blog that will natively import the wordpress file? Edit: For the question about other blog providers, I am open to them as long as they are .NET based, preferably C#.

    Read the article

  • How to use HTML-5 data-* attributes in ASP.NET MVC

    - by sleepy
    I am trying to use HTML5 data- attributes in my ASP.NET MVC 1 project. (I am a C# and ASP.NET MVC newbie.) <%= Html.ActionLink("« Previous", "Search", new { keyword = Model.Keyword, page = Model.currPage - 1}, new { @class = "prev", data-details = "Some Details" })%> The "data-details" in the above htmlAttributes give the following error: CS0746: Invalid anonymous type member declarator. Anonymous type members must be declared with a member assignment, simple name or member access. It works when I use data_details, but I guess it need to be starting with "data-" as per the spec. My questions: Is there any way to get this working and use HTML5 data attributes with Html.ActionLink or similar Html helpers ? Is there any other alternative mechanism to attach custom data to an element? This data is to be processed later by JS.

    Read the article

  • Python Ephem calculation

    - by dassouki
    the output should process the first date as "day" and second as "night". I've been playing with this for a few hours now and can't figure out what I'm doing wrong. Any ideas? Output: $ python time_of_day.py * should be day: event date: 2010/4/6 16:00:59 prev rising: 2010/4/6 09:24:24 prev setting: 2010/4/5 23:33:03 next rise: 2010/4/7 09:22:27 next set: 2010/4/6 23:34:27 day * should be night: event date: 2010/4/6 00:01:00 prev rising: 2010/4/5 09:26:22 prev setting: 2010/4/5 23:33:03 next rise: 2010/4/6 09:24:24 next set: 2010/4/6 23:34:27 day time_of_day.py import datetime import ephem # install from http://pypi.python.org/pypi/pyephem/ #event_time is just a date time corresponding to an sql timestamp def type_of_light(latitude, longitude, event_time, utc_time, horizon): o = ephem.Observer() o.lat, o.long, o.date, o.horizon = latitude, longitude, event_time, horizon print "event date ", o.date print "prev rising: ", o.previous_rising(ephem.Sun()) print "prev setting: ", o.previous_setting(ephem.Sun()) print "next rise: ", o.next_rising(ephem.Sun()) print "next set: ", o.next_setting(ephem.Sun()) if o.previous_rising(ephem.Sun()) <= o.date <= o.next_setting(ephem.Sun()): return "day" elif o.previous_setting(ephem.Sun()) <= o.date <= o.next_rising(ephem.Sun()): return "night" else: return "error" print "should be day: ", type_of_light('45.959','-66.6405','2010/4/6 16:01','-4', '-6') print "should be night: ", type_of_light('45.959','-66.6405','2010/4/6 00:01','-4', '-6')

    Read the article

  • IronPython and Nodebox in C#

    - by proxylittle
    My plan: I'm trying to setup my C# project to communicate with Nodebox to call a certain function which populates a graph and draws it in a new window. Current situation: [fixed... see Update2] I have already included all python-modules needed, but im still getting a Library 'GL' not found it seems that the pyglet module needs a reference to GL/gl.h, but can't find it due to IronPython behaviour. Requirement: The project needs to stay as small as possible without installing new packages. Thats why i have copied all my modules into the project-folder and would like to keep it that or a similar way. My question: Is there a certain workaround for my problem or a fix for the library-folder missmatch. Have read some articles about Tao-Opengl and OpenTK but can't find a good solution. Update1: Updated my sourcecode with a small pyglet window-rendering example. Problem is in pyglet and referenced c-Objects. How do i include them in my c# project to be called? No idea so far... experimenting alittle now. Keeping you updated. SampleCode C#: ScriptRuntimeSetup setup = Python.CreateRuntimeSetup(null); ScriptRuntime runtime = new ScriptRuntime(setup); ScriptEngine engine = Python.GetEngine(runtime); ScriptSource source = engine.CreateScriptSourceFromFile("test.py"); ScriptScope scope = engine.CreateScope(); source.Execute(scope); SampleCode Python (test.py): from nodebox.graphics import * from nodebox.graphics.physics import Vector, Boid, Flock, Obstacle flock = Flock(50, x=-50, y=-50, width=700, height=400) flock.sight(80) def draw(canvas): canvas.clear() flock.update(separation=0.4, cohesion=0.6, alignment=0.1, teleport=True) for boid in flock: push() translate(boid.x, boid.y) scale(0.5 + boid.depth) rotate(boid.heading) arrow(0, 0, 15) pop() canvas.size = 600, 300 def main(canvas): canvas.run(draw) Update2: Line 139 [pyglet/lib.py] sys.platform is not win32... there was the error. Fixed it by just using the line: from pyglet.gl.lib_wgl import link_GL, link_GLU, link_WGL Now the following Error: 'module' object has no attribute '_getframe' Kind of a pain to fix it. Updating with results... Update3: Fixed by adding following line right after first line in C#-Code: setup.Options["Frames"] = true; Current Problem: No module named unicodedata, but in Python26/DLLs is only a *.pyd file`. So.. how do i implement it now?!

    Read the article

  • undefined symbol: PyUnicodeUCS2_Decode whilst trying to install psycopg2

    - by Marco Fucci
    I'm getting an error whilst trying to install psycopg2 on ubuntu 9.10 64 bit. The error is: >>> import psycopg2 Traceback (most recent call last): File "<stdin>", line 1, in <module> File "psycopg2/__init__.py", line 69, in <module> from _psycopg import BINARY, NUMBER, STRING, DATETIME, ROWID ImportError: psycopg2/_psycopg.so: undefined symbol: PyUnicodeUCS2_Decode I've tried downloading the package from http://initd.org/pub/software/psycopg/ and installing it. I've tried by using easy_install too. No error during the installation. It's quite weird as my python (2.6.2) has been compiled with UCS4 and so the installation should just work without problems. Any help would be appreciated. Cheers

    Read the article

  • Classes / instances in Ontology

    - by SODA
    Hi, I'm trying to comprehend ontology basics. Here's an example: car (class) 2009 VW CC (sub-class or instance?) My neighbor's 2009 VW CC (instance) My issue is understanding what is "2009 VW CC" (as a car model). If you're making product model a sub-class in the ontology - all of a sudden your ontology becomes bloated with thousands of subclasses of a "car". That's redundant. At the same time we can't say "2009 VW CC" is an instance, at least it's not material instance of a class. Does it make sense to distinguish between regular instances and material (distinct physical objects)? At the other hand, if both are instances (of different nature so to say), then how can instance inherit properties / relations of a non-class?

    Read the article

  • Django Admin interface with pickled set

    - by Rosarch
    I have a model that has a pickled set of strings. (It has to be pickled, because Django has no built in set field, right?) class Foo(models.Model): __bar = models.TextField(default=lambda: cPickle.dumps(set()), primary_key=True) def get_bar(self): return cPickle.loads(str(self.__bar)) def set_bar(self, values): self.__bar = cPickle.dumps(values) bar = property(get_bar, set_bar) I would like the set to be editable in the admin interface. Obviously the user won't be working with the pickled string directly. Also, the interface would need a widget for adding/removing strings from a set. What is the best way to go about doing this? I'm not super familiar with Django's admin system. Do I need to build a custom admin widget or something? Update: If I do need a custom widget, this looks helpful: http://www.fictitiousnonsense.com/archives/22

    Read the article

  • C#: Object reference not set to an instance of an object.

    - by Vinzcent
    Hey, I get the following error: Object reference not set to an instance of an object This is my C Sharp code: DataTable tableAcces = dsAcces.Tables["dsPrinterAcces"]; DataTable tableMDF = dsAcces.Tables["dsPrinterMDF"]; DataRow newrow = null; foreach(DataRow dr in tableAcces.Rows) { newrow = tableMDF.NewRow(); newrow["PRINTER_ID"] = dr["PRINTER_ID"]; newrow["MERK"] = dr["MERK"]; newrow["MODEL"] = dr["MODEL"]; newrow["LOKAAL_ID"] = dr["LOKAAL_ID"]; tableMDF.Rows.Add(newrow); } daMDF.Update(dsMDF, "dsPrinterMDF"); lblSucces.Text = "Gelukt. De tabel printers is overgezet."; } In this line, he throws the error: newrow = tableMDF.NewRow(); Thanks a lot, Vincent

    Read the article

  • django-admin formfield_for_* change default value per/depending on instance

    - by Nick Ma.
    Hi, I'm trying to change the default value of a foreignkey-formfield to set a Value of an other model depending on the logged in user. But I'm racking my brain on it... This: Changing ForeignKey’s defaults in admin site would an option to change the empty_label, but I need the default_value. #Now I tried the following without errors but it didn't had the desired effect: class EmployeeAdmin(admin.ModelAdmin): ... def formfield_for_foreignkey(self, db_field, request=None, **kwargs): formfields= super(EmployeeAdmin, self).formfield_for_foreignkey(db_field, request, **kwargs) if request.user.is_superuser: return formfields if db_field.name == "company": #This is the RELEVANT LINE kwargs["initial"] = request.user.default_company return db_field.formfield(**kwargs) admin.site.register(Employee, EmployeeAdmin) ################################################################## # REMAINING Setups if someone would like to know it but i think # irrelevant concerning the problem ################################################################## from django.contrib.auth.models import User, UserManager class CompanyUser(User): ... objects = UserManager() company = models.ManyToManyField(Company) default_company= models.ForeignKey(Company, related_name='default_company') #I registered the CompanyUser instead of the standard User, # thats all up and working ... class Employee(models.Model): company = models.ForeignKey(Company) ... Hint: kwargs["default"] ... doesn't exist. Thanks in advance, Nick

    Read the article

  • How to get a value of a textarea using markitup in ASP.NET MVC ?

    - by VJ
    I want to get the value of the text area that is basically the free Markitup rich text editor <textarea id="markItUp"></textarea> and store it in my variable so how can i do this in asp.net mvc. Also is there any way I can use the HtmlHelper to use the markitup editor, since I can easily do something like this - <%= Html.TextAreaFor((model => model.Description)) %> I want to just get the value in the markitup editor and store in my sql server db in a string variable. Also further I would like to get these text which I assume will be storing html tags and display or render it with the html tags...I know HttpUtility.HttpDecode() method but are there any more suggestions on this...Thanks.

    Read the article

< Previous Page | 332 333 334 335 336 337 338 339 340 341 342 343  | Next Page >