Search Results

Search found 12019 results on 481 pages for 'stop execution'.

Page 337/481 | < Previous Page | 333 334 335 336 337 338 339 340 341 342 343 344  | Next Page >

  • Can EventMachine recognize all threads are completed?

    - by philipjkim
    I'm an EM newbie and writing two codes to compare synchronous and asynchronous IO. I'm using Ruby 1.8.7. The example for sync IO is: def pause_then_print(str) sleep 2 puts str end 5.times { |i| pause_then_print(i) } puts "Done" This works as expected, taking 10+ seconds until termination. On the other hand, the example for async IO is: require 'rubygems' require 'eventmachine' def pause_then_print(str) Thread.new do EM.run do sleep 2 puts str end end end EventMachine.run do EM.add_timer(2.5) do puts "Done" EM.stop_event_loop end EM.defer(proc do 5.times { |i| pause_then_print(i) } end) end 5 numbers are shown in 2.x seconds. Now I explicitly wrote code that EM event loop to be stopped after 2.5 seconds. But what I want is that the program terminates right after printing out 5 numbers. For doing that, I think EventMachine should recognize all 5 threads are done, and then stop the event loop. How can I do that? Also, please correct the async IO example if it can be more natural and expressive. Thanks in advance.

    Read the article

  • Next Identity Key LINQ + SQL Server

    - by user569347
    To represent our course tree structure in our Linq Dataclasses we have 2 columns that could potentially be the same as the PK. My problem is that if I want to Insert a new record and populate 2 other columns with the PK that was generated there is no way I can get the next identity and stop conflict with other administrators who might be doing the same insert at the same time. Case: A Leaf node has right_id and left_id = itself (prereq_id) **dbo.pre_req:** prereq_id left_id right_id op_id course_id is_head is_coreq is_enforced parent_course_id and I basically want to do this: pre_req rec = new pre_req { left_id = prereq_id, right_id = prereq_id, op_id = 3, course_id = query.course_id, is_head = true, is_coreq = false, parent_course_id = curCourse.course_id }; db.courses.InsertOnSubmit(rec); try { db.SubmitChanges(); } Any way to solve my dilemma? Thanks!

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Serialization problem

    - by sandhya
    Hi Is it possible to break the serialization in following scenario? GetObjectValue(StreamingInfo info, ....) { info.AddValue("string1", subobject1); info.AddValue("string2", Subobject2); . . } Now my scenario is after serializing subobject1, if the size of the stream exceeds some size limit, can i stop serializing remaining subobjects? if yes, how? how can i check the size of the stream into which i am serializing in the middle of serialization process?

    Read the article

  • Where does Eclipse save the list of files to open on startup?

    - by Grundlefleck
    Question: where does Eclipse store the list of files it opens on startup? Background: Having installed a plugin into Eclipse which promptly crashed, my Eclipse workspace is in a bit of a state. When started, the building workspace task pauses indefinitely at 20%. Before I uninstall the plugin I want to give it another chance. I have a feeling that the reason Eclipse is pausing is because of a file which was opened when it crashed, which it tries to reopen on startup. If I can stop this file from opening on startup there's a chance I may be able to coax the plugin to behave. The problem is I have no idea where that list of files is persisted between runs of Eclipse. ...a second before I posted this question, I realised I could just delete the file causing the problem (duh). However, the search has frustrated me enough to want to find the answer.

    Read the article

  • How to run a progress-bar through an insert query?

    - by Gold
    I have this insert query: try { Cmd.CommandText = @"INSERT INTO BarcodTbl SELECT * FROM [Text;DATABASE=" + PathI + @"\].[Tmp.txt];"; Cmd.ExecuteNonQuery(); Cmd.Dispose(); } catch (Exception ex) { MessageBox.Show(ex.Message); } I have two questions: How can I run a progress-bar from the beginning to the end of the insert? If there is an error, I got the error exception and the action will stop - the query stops and the BarcodTbl is empty. How I can see the error and allow the query to continue filling the table?

    Read the article

  • Actionscript 2.0 element.text always outputs "00"

    - by Mbarry
    Hi everybody, I'm fighting against a strange behaviour with my actionscript! After setting the four integer variables from the MovieTimer sprite (hour, minute, second, mili-sec) and concate them i got always double zero: 00 stop (); delete this.onEnterFrame; var str1; var str2; var mili; var second; var minute; var hour; var timer; mili = _root.MovieTimer.txt_mili.text; second = _root.MovieTimer.txt_sec.text; minute = _root.MovieTimer.txt_min.text; hour = _root.MovieTimer.txt_heures.text; timer = hour+' : '+minute+' : '+second+' : '+mili; _root.MovieSpellFinish.TextTime.text = timer; _root.MovieSpellFinish.TextTime.text outputs: 00 is there any solutions for this??

    Read the article

  • VC++ - Asynchronous Thread

    - by JVNR
    I am working on VC++ project, in that my application process a file from input path and generates 3 output "*.DAT" files in the destination path. I will FTP these DAT file to the destination server. After FTP, I need to delete only two output .DAT files the folder. I am able to delete those files, because there one Asynchronous thread running behind the process. Since the thread is running, while deleting it says, "Cannot delete, the file is used by another person". I need to stop that thread and delete the files. Multiple files can also be taken from the input path to process. Please help me in resolving this issue. Its very high priority issue for me. Please help me ASAP.

    Read the article

  • emacs debugger: how can I step-out, step-over ?

    - by Cheeso
    I don't know why I'm having so much trouble groking the documentation for the elisp debugger. I see it has a commands to "step-into" (d). But for the life of me, I cannot see a step-out or step-over. Can anyone help? If I have this in the Backtrace buffer: Debugger entered--returning value: 5047 line-beginning-position() * c-parse-state() * byte-code("...") * c-guess-basic-syntax() c-show-syntactic-information(nil) call-interactively(c-show-syntactic-information) ...where do I put the cursor, and what key do I type, to step out of the parse-state() fn ? by that I mean, run until that fn returns, and then stop in the debugger again.

    Read the article

  • Embedded quicktime video pause on click how to prevent?

    - by Marek
    I embedded a quicktime video in firefox. It works, but i would like to prevent the users to stop the video by clicking on it with the left mouse button. Reading the apple documentation i didn't find any answear. I came up with a workaround, i just put an almost invisible div over the whole video. The workaround works in firefox for os X, but oddly does not for the same version of firefox in windows. I would appreciate a way, workaround or not, to achive this at least in the windows/firefox environment. Thanks!

    Read the article

  • Impressing Potential Employers

    - by superfly123
    Where I am, I can't afford to get certification. I'm definitely not the best programmer, but I do know my junk. I've been writing software in C++ for over 8 years now and have a very good knowledge of the Win32 API. But when applying for jobs, I get rejected every time I send a resume. I've given my resume to recruitment firms and asked them what they think's wrong with it and they said the only thing they could think of is the fact that I don't have certifications to prove that I know my stuff. But in my resume, I explain my previous work and projects, and also note that upon request they can actually see what I've done. Is there anything that you would suggest that might help others to stop ignoring my resumes? Thank you

    Read the article

  • Why can't i call Contains method from my array?

    - by xbnevan
    Arrrg!I am running into what i feel is a dumb issue with a simple script i'm writing in powershell. I am invoking a sql command that is calling a stored proc, with the results i put it a array. The results look something like this: Status ProcessStartTime ProcessEndTime ------ ---------------- -------------- Expired May 22 2010 8:31PM May 22 2010 8:32PM What i'm trying to do is if($s.Contains("Expired")) , report failed. Simple...? :( Problem i'm running into is it looks like Contains method is not being loaded as i get an error like this: Method invocation failed because [System.Object[]] doesn't contain a method named 'Contains'. At line:1 char:12 + $s.Contains <<<< ("Expired") + CategoryInfo : InvalidOperation: (Contains:String) [], RuntimeException + FullyQualifiedErrorId : MethodNotFound So, what can i do to stop powershell from unrolling it to string? Actual ps script below - $s = @(Invoke-Sqlcmd -Query "USE DB GO exec Monitor_TEST_ps 'EXPORT_RUN',NULL,20 " ` -ServerInstance "testdb002\testdb_002") if ($s.Contains("Expired")) { Write-Host "Expired found, FAIL." } else { Write-Host "Not found, OK." }

    Read the article

  • NSString inheritance

    - by Stef
    Hi, I'm doing an useless thing for my first step in Obj-C @interface String : NSString { int m_isnull; } - (id) init; - (int) isNull; @end @implementation String - (id) init { self = [super init]; m_isnull=1; return self; } - (int) isNull { return m_isnull; } @end test : String *a; a=@"ok"; Works fine, but just 2 little questions 1) When I'm compiling I have this warning warning: incompatible Objective-C types assigning 'struct NSString *', expected 'struct String *' I don't know how to avoid it !? 2) a=@"ok" is a fastest way to initialize a string, but when I'm debugging, I don't stop by at my init constructor why ?

    Read the article

  • twisted .loseConnection does not immediately lose connection?

    - by Claudiu
    I have a server with a few clients connected to it. When CTRL+C is hit (that is, reactor starts shutting down), I want to close all my connections, wait until they are cleanly closed, and then stop. I do this by going through the connected clients' transports and calling .loseConnection(). On the ones that are connected locally, they immediately disconnect. However, on one that is connected through the internet, the connection is not immediately lost. Communication stops - and closing the client program no longer even tells the server that the connection has died, although it does before calling .loseConnection() - but the connection is not deemed 'lost' until a few minutes later after I send a few heartbeat requests from the server. I understand that if a connection dies, there's no way for the server to know unless it tries to send some data. But if I specifically ask for a connection to be closed, why does it not just close/disconnect immediately? Am I calling the wrong function?

    Read the article

  • DAQ Triggers in Matlab

    - by RidePlanet
    I'm writing a program that detects the speed of a object by hall effect sensors that are run into MATLAB through a DAQ (MCC USB-1408FS) The problem that has arisen is that I'm using a non-stop scan technique to detect the state of one of 3 sensors. Unfortunately this means that unless the object is rotating past each sensor at the exact rate the program runs, I will see an instantaneous speed (done by comparing the time between two sensors) of zero. I need the sensors to signal the program to count when they are hit, instead of constantly scanning for the signal. How can this be done?

    Read the article

  • how to deal with async calls in Ajax 4.0(using jquery?)

    - by dexter
    in my code i have done something like this. $.get('/Home/Module/Submit', { moduleName: ModName, moduleParameters: moduleParameters }, function(result) { $("#" + target).html(result); }); when i put alert in the function(result) {..} it shows html perfectly(both in alert and at the 'target'-on the .aspx page) BUT when i remove the alert.. on the page the 'html' don't appear or appear randomly (this method is called multiple times) i think that the 'result' comes to function asynchronously thats why it is not bind with the respective 'div' however in the last iteration it gets bind every time. can we make process stop until data gets bind? or is there any functionality (like alert) which can make data bind.. without disturbing UI (unlike alert)?

    Read the article

  • Artificial Intelligence - What to put in, or leave out, and what can be inferred?

    - by D Scott
    I was having a discussion with a coworker (while we were programming) about AI. We were talking about emotions/feelings and if you should choose to leave any out. I asked him, "Would you leave out racism or hate?" and if you did leave those out, what, if any, other emotions might lead to the AI learning the left out emotions or feelings. Should you PROGRAM in measures to stop the AI from learning those feelings? If you teach Love, does it need to know hurt? Or would it learn hurt? If it then knew Hurt would it connect it with Dislike, Hurt and Dislike could that then lead to some other non-programmed emotion? Such as hate? All while tele-commuting from home.

    Read the article

  • Basic iphone timer example

    - by Rob
    Okay, I have searched online and even looked in a couple of books for the answer because I can't understand the apple documentation for the NSTimer. I am trying to implement 2 timers on the same view that each have 3 buttons (START - STOP - RESET). The first timer counts down from 2 minutes and then beeps. The second timer counts up from 00:00 indefinitely. I am assuming that all of the code will be written in the methods behind the 3 different buttons but I am completely lost trying to read the apple documentation. Any help would be greatly appreciated.

    Read the article

  • How to have a javascript callback executed after an update panel postback?

    - by TNunes
    I'm using a jQuery tip plugin to show help tips when the user hovers certain elements of the page. I need to register the plugin events after the page is loaded using css selectors. The problem is I'm using an ASP.NET Update Panel and after the first postback, the tips stop working because the update panel replaces the page content but doesn't rebind the javascript events. I need a way to execute a javascript callback after the Update Panel refreshes its content, so I can rebind the javascript events to have the tips working again. Is there any way to do this?

    Read the article

  • Sending some byte at time

    - by user1417815
    I'm trying to figure out way to send some amount of text from the string ech time until it reach the end of the string, example: const char* the_string = "hello world, i'm happy to meet you all. Let be friends or maybe more, but nothing less" Output: hello world Output: , i'm happy to meet you all. Output: Let be friends or maybe more Output: , but nothing less stop: no more bytes to send. the problem i have searched google, but didn't understand the examples, i spent 4 days trying find a good way, also that sendt 5 bytes at time, but in case there is less, then send them until you are at the end of the string. please help me out guys, i will accept a C or C++ way, as long it works and well explained.

    Read the article

  • SQL: Interrupting a query

    - by NoozNooz42
    I've worked on a project using a proprietary non-SQL DB where queries could be interrupted and in the codebase there were quite some spots where that functionnality was used and made perfect sense (for example to stop a long running query that gets cancelled by the user, or when a more recent query takes place and renders the previous query obsolete, etc.) and I realized I never really saw that kind of "interrupted queries" previously and thought it could make a good SO question (several questions, but they're all related to exactly the same thing): can SQL queries be interrupted? is this part of the SQL standard? if it's not part of the SQL standard, which SQL DBs allow queries to be interrupted (any example most welcome)? is it common to interrupt a DB query (SQL or not) which you'll know you won't care about the result anymore? (in the codebase I've worked on, it sure helps lighten the server's load)

    Read the article

  • problem in playing next song in the avaudioplayer

    - by Rajashekar
    Hello friends my delegate method looks like this. after the first song is played it goes into this method and plays the second song , however when the second song is done playing it stops. it does not go into the delegate method.i need to play all the songs continuously. i am not sure, why. can someone help me. (void)audioPlayerDidFinishPlaying:(AVAudioPlayer *)p successfully:(BOOL)flag { if (flag == NO) NSLog(@"Playback finished unsuccessfully"); else { //[player stop]; index++; NSLog(@"%d",index); path=[[NSBundle mainBundle] pathForResource:[songlist objectAtIndex:index] ofType:@"mp3"]; [player initWithContentsOfURL:[NSURL fileURLWithPath:path] error:NULL]; [songlabel2 setTitle:[songlist objectAtIndex:index]]; [endtime setText:[NSString stringWithFormat:@"%.2f",[player duration]/100]]; [player play]; } }

    Read the article

  • Alert Box Running First?

    - by corymathews
    I have some jQuery/JS below. The first thing to run is the alert box at the end. $(document).ready(function() { $("#id1 img , .msg").stop().animate( { width: '300px', height: '300px'}, { duration: 'slow', easing: 'easeInSine' }).pause(3000); $(".msg").animate( { width: '50px', height: '50px' }, { duration: 498, easing: 'easeOutSine' }); $("#id1 img").animate( { width: '50px', height: '50px' }, { duration: 500, easing: 'easeOutSine' }); $("#id1 img , .msg").animate( { width: '300px',height: '300px'}, { duration: 'slow', easing: 'easeInSine' }).pause(3000); alert('eh?'); }); I do have a easing plugin. If I run this the alert will show, and then the first animate will happen in the background but not be shown. It will just appear at the final size. Shouldn't the alert run at the end of all the animation? Can anyone explain why this is happening?

    Read the article

  • Using Session to limit form submission by time

    - by user1733850
    I have spent over 2 hours scouring the net trying to figure this out. I am trying to stop multiple form submission any faster than 60 seconds. Here is what I am using. session_start(); if (!isset($_SESSION['last_submit'])) $_SESSION['last_submit'] = time(); if (time()-$_SESSION['last_submit'] < 60) die('Post limit exceeded. Please wait at least 60 seconds'); else $_SESION['last_submit'] = time(); I found this bit here on the site but haven't been able to figure anything else out as far as getting it to work. I have this bit of code on my page at the beginning that does the DB query with the previous pages POST results. Do I need to set $last_submit to a certain value? Any help is appreciated.

    Read the article

  • Location inheritInChildApplications kill debugger?

    - by chobo2
    Hi I am wondering is this normal when you add this into your web.config <location path="." inheritInChildApplications="false"> </location> The debugger should stop working. Like when I add this to my site and try to run in debug mode it won't activate any of my debug points nor will it lock up Visual studios 2008. I can have it running and still make edits to my C# code. I take the line away and I get the debug mode back and it locks up VS2008.

    Read the article

< Previous Page | 333 334 335 336 337 338 339 340 341 342 343 344  | Next Page >