Search Results

Search found 12019 results on 481 pages for 'stop execution'.

Page 337/481 | < Previous Page | 333 334 335 336 337 338 339 340 341 342 343 344  | Next Page >

• Long to timestamp for historic data (pre-1900s)

  - by Mike

  I have a database of start and stop times that have previously all had fairly recent data (1960s through present day) which i've been able to store as long integers. This is very simialr to unix timestamps, only with millisecond precision, so a function like java.util.Date.getTime() would be the value of the current time. This has worked well so far, but we recently got data from the 1860s, and the following code no longer works: to_timestamp('1-JAN-1970 00:00:00', 'dd-mon-yyyy hh24:mi:ss') + numtodsinterval(int_to_convert/(1000),'SECOND' ); This wraps the date and we get timestamps in the year 2038. Is there a way around this issue? All of the documentation i've looked at the documentation and timestamps should be able to handle years all the way back to the -4000 (BC), so i'm suspecting an issue with the numtodsinterval. Any ideas suggestions would be greatly appreciated.

  Read the article

• Why can't i call Contains method from my array?

  - by xbnevan

  Arrrg!I am running into what i feel is a dumb issue with a simple script i'm writing in powershell. I am invoking a sql command that is calling a stored proc, with the results i put it a array. The results look something like this: Status ProcessStartTime ProcessEndTime ------ ---------------- -------------- Expired May 22 2010 8:31PM May 22 2010 8:32PM What i'm trying to do is if($s.Contains("Expired")) , report failed. Simple...? :( Problem i'm running into is it looks like Contains method is not being loaded as i get an error like this: Method invocation failed because [System.Object[]] doesn't contain a method named 'Contains'. At line:1 char:12 + $s.Contains <<<< ("Expired") + CategoryInfo : InvalidOperation: (Contains:String) [], RuntimeException + FullyQualifiedErrorId : MethodNotFound So, what can i do to stop powershell from unrolling it to string? Actual ps script below - $s = @(Invoke-Sqlcmd -Query "USE DB GO exec Monitor_TEST_ps 'EXPORT_RUN',NULL,20 " ` -ServerInstance "testdb002\testdb_002") if ($s.Contains("Expired")) { Write-Host "Expired found, FAIL." } else { Write-Host "Not found, OK." }

  Read the article

• How to make a service not receive messages at certain times

  - by miker169

  I'm currently learning wcf for an up and coming project. The service I am creating is using MSMQ to update the database, but the database can't accept messages at certain times. The service is going to be a windows service. The one thing I am coming up against at the moment is how I can get the service to stop reading messages from the queue at these times, for instance lets say I don't want to read messages from the queue on sundays. How would I go about implementing this. So that the client can send messages to the queue that update the database but the service doesn't read the messages until monday, so that the database gets all the updates on the monday? I have started looking at creating a customhost, but I'm not sure if I'm heading in the right direction with this. Thanks in advance.

  Read the article

• How to run a progress-bar through an insert query?

  - by Gold

  I have this insert query: try { Cmd.CommandText = @"INSERT INTO BarcodTbl SELECT * FROM [Text;DATABASE=" + PathI + @"\].[Tmp.txt];"; Cmd.ExecuteNonQuery(); Cmd.Dispose(); } catch (Exception ex) { MessageBox.Show(ex.Message); } I have two questions: How can I run a progress-bar from the beginning to the end of the insert? If there is an error, I got the error exception and the action will stop - the query stops and the BarcodTbl is empty. How I can see the error and allow the query to continue filling the table?

  Read the article

• IE7 preventDefault() not working on skip links

  - by josh

  I currently have skip links that jump to the div ids and was using e.preventDefault() to stop the url from changing when jumping to the element but in IE7 and IE8 it doesn't work at all using e.preventDefault() and if I take it out the url changes to the div the anchor tag contains reference to. Is their any fix or way around this? Here is the code $('body').delegate('a.skiplink-accessible-text', 'click', function (e) { //e.preventDefault(); if (!$.browser.msie) { e.preventDefault(); } var jumpTo = $(this).attr('href'); $('body').find(jumpTo).attr('tabindex', - 1).focus(); }); EDIT: heres a little jsbin example for testing purposes http://jsbin.com/welcome/20846/edit

  Read the article

• Artificial Intelligence - What to put in, or leave out, and what can be inferred?

  - by D Scott

  I was having a discussion with a coworker (while we were programming) about AI. We were talking about emotions/feelings and if you should choose to leave any out. I asked him, "Would you leave out racism or hate?" and if you did leave those out, what, if any, other emotions might lead to the AI learning the left out emotions or feelings. Should you PROGRAM in measures to stop the AI from learning those feelings? If you teach Love, does it need to know hurt? Or would it learn hurt? If it then knew Hurt would it connect it with Dislike, Hurt and Dislike could that then lead to some other non-programmed emotion? Such as hate? All while tele-commuting from home.

  Read the article

• WP7 How to use a Storyboard

  - by Subby

  I wish to stop using the DispatcherTimer to show animations as that is extremely unpredictable. Instead, I want to start using a Storyboard as that is apparently the best and efficient way to animate controls. I have tried searching for Tutorials but have not, unfortunately, stumbled on one yet. Can anyone please advice me where I can begin? For example, "moving an image across the screen" and then "moving many images at the same time whilst rotating them". Any help is highly appreciated.

  Read the article

• Location inheritInChildApplications kill debugger?

  - by chobo2

  Hi I am wondering is this normal when you add this into your web.config <location path="." inheritInChildApplications="false"> </location> The debugger should stop working. Like when I add this to my site and try to run in debug mode it won't activate any of my debug points nor will it lock up Visual studios 2008. I can have it running and still make edits to my C# code. I take the line away and I get the debug mode back and it locks up VS2008.

  Read the article

• Basic iphone timer example

  - by Rob

  Okay, I have searched online and even looked in a couple of books for the answer because I can't understand the apple documentation for the NSTimer. I am trying to implement 2 timers on the same view that each have 3 buttons (START - STOP - RESET). The first timer counts down from 2 minutes and then beeps. The second timer counts up from 00:00 indefinitely. I am assuming that all of the code will be written in the methods behind the 3 different buttons but I am completely lost trying to read the apple documentation. Any help would be greatly appreciated.

  Read the article

• Impressing Potential Employers

  - by superfly123

  Where I am, I can't afford to get certification. I'm definitely not the best programmer, but I do know my junk. I've been writing software in C++ for over 8 years now and have a very good knowledge of the Win32 API. But when applying for jobs, I get rejected every time I send a resume. I've given my resume to recruitment firms and asked them what they think's wrong with it and they said the only thing they could think of is the fact that I don't have certifications to prove that I know my stuff. But in my resume, I explain my previous work and projects, and also note that upon request they can actually see what I've done. Is there anything that you would suggest that might help others to stop ignoring my resumes? Thank you

  Read the article

• Where does Eclipse save the list of files to open on startup?

  - by Grundlefleck

  Question: where does Eclipse store the list of files it opens on startup? Background: Having installed a plugin into Eclipse which promptly crashed, my Eclipse workspace is in a bit of a state. When started, the building workspace task pauses indefinitely at 20%. Before I uninstall the plugin I want to give it another chance. I have a feeling that the reason Eclipse is pausing is because of a file which was opened when it crashed, which it tries to reopen on startup. If I can stop this file from opening on startup there's a chance I may be able to coax the plugin to behave. The problem is I have no idea where that list of files is persisted between runs of Eclipse. ...a second before I posted this question, I realised I could just delete the file causing the problem (duh). However, the search has frustrated me enough to want to find the answer.

  Read the article

• Reboot windows machines at a certain time of day and automatically login with Python

  - by Tom

  I know how to reboot machines remotely, so that's the easy part. However, the complexity of the issue is trying to setup the following. I'd like to control machines on a network for after-hours use such that when users logoff and go home, or shutdown their computers, whatever, python or some combination of python + windows could restart their machines (for cleanliness) and automatically login, running a process for the night, then in the morning, stop said process and restart the machine so the user could easily login like normal. I've looked around, haven't had too terribly much luck, though it looks like one could do it with a changing of the registry. That sounds like a rough idea though, modifying the registry on a per-day basis. Is there an easier way?

  Read the article

• NSString inheritance

  - by Stef

  Hi, I'm doing an useless thing for my first step in Obj-C @interface String : NSString { int m_isnull; } - (id) init; - (int) isNull; @end @implementation String - (id) init { self = [super init]; m_isnull=1; return self; } - (int) isNull { return m_isnull; } @end test : String *a; a=@"ok"; Works fine, but just 2 little questions 1) When I'm compiling I have this warning warning: incompatible Objective-C types assigning 'struct NSString *', expected 'struct String *' I don't know how to avoid it !? 2) a=@"ok" is a fastest way to initialize a string, but when I'm debugging, I don't stop by at my init constructor why ?

  Read the article

• emacs debugger: how can I step-out, step-over ?

  - by Cheeso

  I don't know why I'm having so much trouble groking the documentation for the elisp debugger. I see it has a commands to "step-into" (d). But for the life of me, I cannot see a step-out or step-over. Can anyone help? If I have this in the Backtrace buffer: Debugger entered--returning value: 5047 line-beginning-position() * c-parse-state() * byte-code("...") * c-guess-basic-syntax() c-show-syntactic-information(nil) call-interactively(c-show-syntactic-information) ...where do I put the cursor, and what key do I type, to step out of the parse-state() fn ? by that I mean, run until that fn returns, and then stop in the debugger again.

  Read the article

• Sending some byte at time

  - by user1417815

  I'm trying to figure out way to send some amount of text from the string ech time until it reach the end of the string, example: const char* the_string = "hello world, i'm happy to meet you all. Let be friends or maybe more, but nothing less" Output: hello world Output: , i'm happy to meet you all. Output: Let be friends or maybe more Output: , but nothing less stop: no more bytes to send. the problem i have searched google, but didn't understand the examples, i spent 4 days trying find a good way, also that sendt 5 bytes at time, but in case there is less, then send them until you are at the end of the string. please help me out guys, i will accept a C or C++ way, as long it works and well explained.

  Read the article

• problem in playing next song in the avaudioplayer

  - by Rajashekar

  Hello friends my delegate method looks like this. after the first song is played it goes into this method and plays the second song , however when the second song is done playing it stops. it does not go into the delegate method.i need to play all the songs continuously. i am not sure, why. can someone help me. (void)audioPlayerDidFinishPlaying:(AVAudioPlayer *)p successfully:(BOOL)flag { if (flag == NO) NSLog(@"Playback finished unsuccessfully"); else { //[player stop]; index++; NSLog(@"%d",index); path=[[NSBundle mainBundle] pathForResource:[songlist objectAtIndex:index] ofType:@"mp3"]; [player initWithContentsOfURL:[NSURL fileURLWithPath:path] error:NULL]; [songlabel2 setTitle:[songlist objectAtIndex:index]]; [endtime setText:[NSString stringWithFormat:@"%.2f",[player duration]/100]]; [player play]; } }

  Read the article

• twisted .loseConnection does not immediately lose connection?

  - by Claudiu

  I have a server with a few clients connected to it. When CTRL+C is hit (that is, reactor starts shutting down), I want to close all my connections, wait until they are cleanly closed, and then stop. I do this by going through the connected clients' transports and calling .loseConnection(). On the ones that are connected locally, they immediately disconnect. However, on one that is connected through the internet, the connection is not immediately lost. Communication stops - and closing the client program no longer even tells the server that the connection has died, although it does before calling .loseConnection() - but the connection is not deemed 'lost' until a few minutes later after I send a few heartbeat requests from the server. I understand that if a connection dies, there's no way for the server to know unless it tries to send some data. But if I specifically ask for a connection to be closed, why does it not just close/disconnect immediately? Am I calling the wrong function?

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• SQL: Interrupting a query

  - by NoozNooz42

  I've worked on a project using a proprietary non-SQL DB where queries could be interrupted and in the codebase there were quite some spots where that functionnality was used and made perfect sense (for example to stop a long running query that gets cancelled by the user, or when a more recent query takes place and renders the previous query obsolete, etc.) and I realized I never really saw that kind of "interrupted queries" previously and thought it could make a good SO question (several questions, but they're all related to exactly the same thing): can SQL queries be interrupted? is this part of the SQL standard? if it's not part of the SQL standard, which SQL DBs allow queries to be interrupted (any example most welcome)? is it common to interrupt a DB query (SQL or not) which you'll know you won't care about the result anymore? (in the codebase I've worked on, it sure helps lighten the server's load)

  Read the article

• how to deal with async calls in Ajax 4.0(using jquery?)

  - by dexter

  in my code i have done something like this. $.get('/Home/Module/Submit', { moduleName: ModName, moduleParameters: moduleParameters }, function(result) { $("#" + target).html(result); }); when i put alert in the function(result) {..} it shows html perfectly(both in alert and at the 'target'-on the .aspx page) BUT when i remove the alert.. on the page the 'html' don't appear or appear randomly (this method is called multiple times) i think that the 'result' comes to function asynchronously thats why it is not bind with the respective 'div' however in the last iteration it gets bind every time. can we make process stop until data gets bind? or is there any functionality (like alert) which can make data bind.. without disturbing UI (unlike alert)?

  Read the article

• DAQ Triggers in Matlab

  - by RidePlanet

  I'm writing a program that detects the speed of a object by hall effect sensors that are run into MATLAB through a DAQ (MCC USB-1408FS) The problem that has arisen is that I'm using a non-stop scan technique to detect the state of one of 3 sensors. Unfortunately this means that unless the object is rotating past each sensor at the exact rate the program runs, I will see an instantaneous speed (done by comparing the time between two sensors) of zero. I need the sensors to signal the program to count when they are hit, instead of constantly scanning for the signal. How can this be done?

  Read the article

• Embedded quicktime video pause on click how to prevent?

  - by Marek

  I embedded a quicktime video in firefox. It works, but i would like to prevent the users to stop the video by clicking on it with the left mouse button. Reading the apple documentation i didn't find any answear. I came up with a workaround, i just put an almost invisible div over the whole video. The workaround works in firefox for os X, but oddly does not for the same version of firefox in windows. I would appreciate a way, workaround or not, to achive this at least in the windows/firefox environment. Thanks!

  Read the article

• How to have a javascript callback executed after an update panel postback?

  - by TNunes

  I'm using a jQuery tip plugin to show help tips when the user hovers certain elements of the page. I need to register the plugin events after the page is loaded using css selectors. The problem is I'm using an ASP.NET Update Panel and after the first postback, the tips stop working because the update panel replaces the page content but doesn't rebind the javascript events. I need a way to execute a javascript callback after the Update Panel refreshes its content, so I can rebind the javascript events to have the tips working again. Is there any way to do this?

  Read the article

• [ASP.NET MVC] Problem with View - it does not refresh after db update

  - by crocodillez

  Hi, I am working with small ASP.NET MVC project - online store. I have addToCart method which adds selected product to cart - it updates cart table in my db and showing cart view with its content. But I have problems. while db is updating correctly the view does not. I see that quantity of the product in my db is incremented correctly but quantity in view is not changed. I have to stop debugging my app in visual studia and restart it - then my view is showing correct data. What can be wrong?

  Read the article

• Java Pack No Resize

  - by ikurtz

  i am learning Java at the moment and have the following question: i am adding my controls to JFrame and then pack() before displaying. this runs the application and all is very nice. i was wondering is there a way to stop the user from resizing the application window? also is there a way to for the image in JLabel to expand as the user changes the application window? at the moment i have it as: constraints.fill = GridBagConstraints.BOTH; constraints.anchor = GridBagConstraints.CENTER; and it only centers the image, i would like to be able to expand/shrink the image. thanks.

  Read the article

< Previous Page | 333 334 335 336 337 338 339 340 341 342 343 344  | Next Page >