Search Results

Search found 9501 results on 381 pages for 'dynamic invoke'.

Page 341/381 | < Previous Page | 337 338 339 340 341 342 343 344 345 346 347 348  | Next Page >

• android app crashes if keyboard was shown

  - by Jaume

  I have an activity that I force keyboard to appears using, InputMethodManager inputMethodManager=(InputMethodManager)getSystemService(Context.INPUT_METHOD_SERVICE); inputMethodManager.toggleSoftInput(InputMethodManager.SHOW_FORCED, 0); keyboard appears properly and also obscured when needed. Problem is when I finish the activity, app crashes. If the activity never shows keyboard or shows it without start editing text, it is finished with no errors but if you just write one single character or more, app will crash. How to solve it? thank you. method used to finish activity, boto_back.setOnClickListener(new OnClickListener() { @Override public void onClick(View arg0) { InputMethodManager inputMethodManager=(InputMethodManager)getSystemService(Context.INPUT_METHOD_SERVICE); inputMethodManager.toggleSoftInput(InputMethodManager.HIDE_IMPLICIT_ONLY, 0); finish(); } }); @Override public void onDestroy() { if (adMob != null) { // Destroy the AdView. adMob.destroy(); } super.onDestroy(); } logcat, 07-07 19:04:25.191: E/AndroidRuntime(8443): FATAL EXCEPTION: main 07-07 19:04:25.191: E/AndroidRuntime(8443): java.lang.RuntimeException: Unable to destroy activity {com.xxxx.xxxx/com.xxxx.projecte1.TabBar_iOSActivity}: java.lang.RuntimeException: Unable to destroy activity {com.xxxx.xxxx/com.xxxx.projecte1.webPush}: java.lang.NullPointerException 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.app.ActivityThread.performDestroyActivity(ActivityThread.java:2693) 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.app.ActivityThread.handleDestroyActivity(ActivityThread.java:2711) 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.app.ActivityThread.access$2100(ActivityThread.java:121) 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.app.ActivityThread$H.handleMessage(ActivityThread.java:976) 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.os.Handler.dispatchMessage(Handler.java:99) 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.os.Looper.loop(Looper.java:130) 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.app.ActivityThread.main(ActivityThread.java:3701) 07-07 19:04:25.191: E/AndroidRuntime(8443): at java.lang.reflect.Method.invokeNative(Native Method) 07-07 19:04:25.191: E/AndroidRuntime(8443): at java.lang.reflect.Method.invoke(Method.java:507) 07-07 19:04:25.191: E/AndroidRuntime(8443): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:866) 07-07 19:04:25.191: E/AndroidRuntime(8443): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:624) 07-07 19:04:25.191: E/AndroidRuntime(8443): at dalvik.system.NativeStart.main(Native Method) 07-07 19:04:25.191: E/AndroidRuntime(8443): Caused by: java.lang.RuntimeException: Unable to destroy activity {com.xxxx.xxxx/com.xxxx.projecte1.webPush}: java.lang.NullPointerException 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.app.ActivityThread.performDestroyActivity(ActivityThread.java:2693) 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.app.ActivityThread.performDestroyActivity(ActivityThread.java:2603) 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.app.LocalActivityManager.dispatchDestroy(LocalActivityManager.java:622) 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.app.ActivityGroup.onDestroy(ActivityGroup.java:85) 07-07 19:04:25.191: E/AndroidRuntime(8443): at com.xxxx.projecte1.TabBar_iOSActivity.onDestroy(TabBar_iOSActivity.java:417) 07-07 19:04:25.191: E/AndroidRuntime(8443): at android.app.ActivityThread.performDestroyActivity(ActivityThread.java:2680) 07-07 19:04:25.191: E/AndroidRuntime(8443): ... 11 more

  Read the article

• android : customer List Adatper + ArrayList

  - by Ram

  Team, Could you please help me debug the issue? ActivityAdapter activityAdapter = new ActivityAdapter(this,activityList); Log.d("list", "List Display - 1"); setListAdapter( activityAdapter ); Log.d("List", "list done"); It's throwing exception at the time of setListAdapter, 05-01 16:59:15.996: WARN/dalvikvm(251): threadid=3: thread exiting with uncaught exception (group=0x4001b188) 05-01 16:59:15.996: ERROR/AndroidRuntime(251): Uncaught handler: thread main exiting due to uncaught exception 05-01 16:59:16.204: ERROR/AndroidRuntime(251): java.lang.RuntimeException: Unable to start activity ComponentInfo{com.antennasoftware.xml/com.antennasoftware.xml.XMLParsing}: java.lang.RuntimeException: Your content must have a ListView whose id attribute is 'android.R.id.list' 05-01 16:59:16.204: ERROR/AndroidRuntime(251): at android.app.ActivityThread.performLaunchActivity(ActivityThread.java:2454) 05-01 16:59:16.204: ERROR/AndroidRuntime(251): at android.app.ActivityThread.handleLaunchActivity(ActivityThread.java:2470) 05-01 16:59:16.204: ERROR/AndroidRuntime(251): at android.app.ActivityThread.access$2200(ActivityThread.java:119) 05-01 16:59:16.204: ERROR/AndroidRuntime(251): at android.app.ActivityThread$H.handleMessage(ActivityThread.java:1821) 05-01 16:59:16.204: ERROR/AndroidRuntime(251): at android.os.Handler.dispatchMessage(Handler.java:99) 05-01 16:59:16.204: ERROR/AndroidRuntime(251): at android.os.Looper.loop(Looper.java:123) 05-01 16:59:16.204: ERROR/AndroidRuntime(251): at android.app.ActivityThread.main(ActivityThread.java:4310) 05-01 16:59:16.204: ERROR/AndroidRuntime(251): at java.lang.reflect.Method.invokeNative(Native Method) 05-01 16:59:16.204: ERROR/AndroidRuntime(251): at java.lang.reflect.Method.invoke(Method.java:521) 05-01 16:59:16.204: ERROR/AndroidRuntime(251): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:860) 05-01 16:59:16.204: ERROR/AndroidRuntime(251): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:618) 05-01 16:59:16.204: ERROR/AndroidRuntime(251): at dalvik.system.NativeStart.main(Native Method) 05-01 16:59:16.204: ERROR/AndroidRuntime(251): Caused by: java.lang.RuntimeException: Your content must have a ListView whose id attribute is 'android.R.id.list' 05-01 16:59:16.204: ERROR/AndroidRuntime(251): at android.app.ListActivity.onContentChanged(ListActivity.java:236) 05-01 16:59:16.204: ERROR/AndroidRuntime(251): at com.android.internal.policy.impl.PhoneWindow.setContentView(PhoneWindow.java:201) 05-01 16:59:16.204: ERROR/AndroidRuntime(251): at android.app.Activity.setContentView(Activity.java:1622) 05-01 16:59:16.204: ERROR/AndroidRuntime(251): at com.antennasoftware.xml.XMLParsing.onCreate(XMLParsing.java:36) 05-01 16:59:16.204: ERROR/AndroidRuntime(251): at android.app.Instrumentation.callActivityOnCreate(Instrumentation.java:1047) 05-01 16:59:16.204: ERROR/AndroidRuntime(251): at android.app.ActivityThread.performLaunchActivity(ActivityThread.java:2417) 05-01 16:59:16.204: ERROR/AndroidRuntime(251): ... 11 more Thanks in advance

  Read the article

• Multi-Threading Question Concerning WPF

  - by Andrew

  Hello, I'm a newbie to threading, and I don't really know how to code a particular task. I would like to handle a mouse click event on a window that will kick off a while loop in a seperate thread. This thread, which is distinct from the UI thread, should call a function in the while loop which updates a label on the window being serviced by the UI thread. The while loop should stop running when the left mouse button is no longer being pressed. All the loop does is increment a counter, and then repeatedly call the function which displays the updated value in the window. The code for the window and all of the threading is given below (I keep getting some error about STA threading, but don't know where to put the attribute). Also, I'm hoping to use this solution, if it ever works, in another project that makes asynchronous calls elsewhere to a service via wcf, so I was hoping not to make any application-wide special configurations, since I'm really new to multi-threading and am quite worried about breaking other code in a larger program... Here's what I have: <Window x:Class="WpfApplication2.MainWindow" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" xmlns:local="clr-namespace:WpfApplication2" Name="MyMainWindow" Title="MainWindow" Width="200" Height="150" PreviewMouseLeftButtonDown="MyMainWindow_PreviewMouseLeftButtonDown"> <Label Height="28" Name="CounterLbl" /> </Window> And here's the code-behind: using System.Windows; using System.Windows.Input; using System.Threading; namespace WpfApplication2 { /// <summary> /// Interaction logic for MainWindow.xaml /// </summary> public partial class MainWindow : Window { private int counter = 0; public MainWindow() { InitializeComponent(); } private delegate void EmptyDelegate(); private void MyMainWindow_PreviewMouseLeftButtonDown(object sender, MouseButtonEventArgs e) { Thread counterThread = new Thread(new ThreadStart(MyThread)); counterThread.Start(); } private void MyThread() { while (Mouse.LeftButton == MouseButtonState.Pressed) { counter++; Dispatcher.Invoke(new EmptyDelegate(UpdateLabelContents), null); } } private void UpdateLabelContents() { CounterLbl.Content = counter.ToString(); } } } Anyways, multi-threading is really new to me, and I don't have any experience implementing it, so any thoughts or suggestions are welcome! Thanks, Andrew

  Read the article

• How do compare dates when one of those are in string format in android

  - by Raj

  I am very much new to android so need some good help with a code example. I am getting a date in form of string from a server in the following format 2012-08-17 00:00:00 I want to compare this string with current date to find the difference between the dates in the form of year, months and days... I tried playing around it in the following code Date currentDate = new Date(System.currentTimeMillis()); Log.v("@@@@@@@@@","Current Date: " + currentDate); Date passDate = new SimpleDateFormat().parse(passDateString); Log.v("@@@@@@@@@","Pass Date: " + passDate); dateDifference = passDate.compareTo(currentDate); but it returned with following exception 04-15 12:08:29.101: V/@@@@@@@@@(1161): Current Date: Sun Apr 15 12:08:29 GMT+01:00 2012 04-15 12:08:29.101: W/System.err(1161): java.text.ParseException: Unparseable date: 2012-08-17 00:00:00 04-15 12:08:29.111: W/System.err(1161): at java.text.DateFormat.parse(DateFormat.java:645) 04-15 12:08:29.111: W/System.err(1161): at org.apis.PassesListItemAdapter.getView(PassesListItemAdapter.java:77) 04-15 12:08:29.111: W/System.err(1161): at android.widget.AbsListView.obtainView(AbsListView.java:1315) 04-15 12:08:29.111: W/System.err(1161): at android.widget.ListView.makeAndAddView(ListView.java:1727) 04-15 12:08:29.111: W/System.err(1161): at android.widget.ListView.fillDown(ListView.java:652) 04-15 12:08:29.111: W/System.err(1161): at android.widget.ListView.fillFromTop(ListView.java:709) 04-15 12:08:29.111: W/System.err(1161): at android.widget.ListView.layoutChildren(ListView.java:1580) 04-15 12:08:29.111: W/System.err(1161): at android.widget.AbsListView.onLayout(AbsListView.java:1147) 04-15 12:08:29.111: W/System.err(1161): at android.view.View.layout(View.java:7034) 04-15 12:08:29.111: W/System.err(1161): at android.widget.RelativeLayout.onLayout(RelativeLayout.java:909) 04-15 12:08:29.111: W/System.err(1161): at android.view.View.layout(View.java:7034) 04-15 12:08:29.111: W/System.err(1161): at android.widget.FrameLayout.onLayout(FrameLayout.java:333) 04-15 12:08:29.111: W/System.err(1161): at android.view.View.layout(View.java:7034) 04-15 12:08:29.111: W/System.err(1161): at android.widget.FrameLayout.onLayout(FrameLayout.java:333) 04-15 12:08:29.111: W/System.err(1161): at android.view.View.layout(View.java:7034) 04-15 12:08:29.111: W/System.err(1161): at android.view.ViewRoot.performTraversals(ViewRoot.java:1049) 04-15 12:08:29.111: W/System.err(1161): at android.view.ViewRoot.handleMessage(ViewRoot.java:1744) 04-15 12:08:29.111: W/System.err(1161): at android.os.Handler.dispatchMessage(Handler.java:99) 04-15 12:08:29.111: W/System.err(1161): at android.os.Looper.loop(Looper.java:144) 04-15 12:08:29.111: W/System.err(1161): at android.app.ActivityThread.main(ActivityThread.java:4937) 04-15 12:08:29.111: W/System.err(1161): at java.lang.reflect.Method.invokeNative(Native Method) 04-15 12:08:29.111: W/System.err(1161): at java.lang.reflect.Method.invoke(Method.java:521) 04-15 12:08:29.111: W/System.err(1161): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:868) 04-15 12:08:29.111: W/System.err(1161): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:626) 04-15 12:08:29.111: W/System.err(1161): at dalvik.system.NativeStart.main(Native Method) I am stuck... please help Raj

  Read the article

• Trying to filter a ListView with runQueryOnBackgroundThread but nothing happens - what am I missing?

  - by Ian Leslie

  I have a list of countries in a database. I have created a select country activity that consists of a edit box for filtering and a list which displays the flag and country name. When the activity starts the list shows the entire list of countries sorted alphabetically - works fine. When the customer starts typing into the search box I want the list to be filtered based on their typing. My database query was previously working in an AutoCompleteView (I just want to switch to a separate text box and list) so I know my full query and my constraint query are working. What I did was add a TextWatcher to the EditText view and every time the text is changed I invoke the list's SimpleCursorAdapter runQueryOnBackgroundThread with the edit boxes text as the constraint. The trouble is the list is never updated. I have set breakpoints in the debugger and the TextWatcher does make the call to runQueryOnBackgroundThread and my FilterQueryProvider is called with the expected constraint. The database query goes fine and the cursor is returned. The cursor adapter has a filter query provider set (and a view binder to display the flag): SimpleCursorAdapter adapter = new SimpleCursorAdapter (this, R.layout.country_list_row, countryCursor, from, to); adapter.setFilterQueryProvider (new CountryFilterProvider ()); adapter.setViewBinder (new FlagViewBinder ()); The FitlerQueryProvider: private final class CountryFilterProvider implements FilterQueryProvider { @Override public Cursor runQuery (CharSequence constraint) { Cursor countryCursor = myDbHelper.getCountryList (constraint); startManagingCursor (countryCursor); return countryCursor; } } And the EditText has a TextWatcher: myCountrySearchText = (EditText)findViewById (R.id.entry); myCountrySearchText.setHint (R.string.country_hint); myCountrySearchText.addTextChangedListener (new TextWatcher() { @Override public void afterTextChanged (Editable s) { SimpleCursorAdapter filterAdapter = (SimpleCursorAdapter)myCountryList.getAdapter (); filterAdapter.runQueryOnBackgroundThread (s.toString ()); } @Override public void onTextChanged (CharSequence s, int start, int before, int count) { // no work to do } @Override public void beforeTextChanged (CharSequence s, int start, int count, int after) { // no work to do } }); The query for the database looks like this: public Cursor getCountryList (CharSequence constraint) { if (constraint == null || constraint.length () == 0) { // Return the full list of countries return myDataBase.query (DATABASE_COUNTRY_TABLE, new String[] { KEY_ROWID, KEY_COUNTRYNAME, KEY_COUNTRYCODE }, null, null, null, null, KEY_COUNTRYNAME); } else { // Return a list of countries who's name contains the passed in constraint return myDataBase.query (DATABASE_COUNTRY_TABLE, new String[] { KEY_ROWID, KEY_COUNTRYNAME, KEY_COUNTRYCODE }, "Country like '%" + constraint.toString () + "%'", null, null, null, "CASE WHEN Country like '" + constraint.toString () + "%' THEN 0 ELSE 1 END, Country"); } } It just seems like there is a missing link somewhere. Any help would be appreciated. Thanks, Ian

  Read the article

• android error NoSuchElementException

  - by Alexander

  I have returned a cursor string but it contains a delimiter. The delimiter is . I have the string quest.setText(String.valueOf(c.getString(1)));I want to turn the into a new line. What is the best method to achieve this task in android. I understand there is a way to get the delimeter. I want this to achieved for each record. I can itterate through record like so. Cursor c = db.getContact(2); I tried using a string tokenizer but it doesnt seem to work. Here is the code for the tokenizer. I tested it in just plain java and it works without errors. String question = c.getString(1); // quest.setText(String.valueOf(c.getString(1))); //quest.setText(String.valueOf(question)); StringTokenizer st = new StringTokenizer(question,"<ENTER>"); //DisplayContact(c); // StringTokenizer st = new StringTokenizer(question, "=<ENTER>"); while(st.hasMoreTokens()) { String key = st.nextToken(); String val = st.nextToken(); System.out.println(key + "\n" + val); } I then tried running it in android. Here is the error log 06-06 22:31:55.251: E/AndroidRuntime(537): FATAL EXCEPTION: main 06-06 22:31:55.251: E/AndroidRuntime(537): java.util.NoSuchElementException 06-06 22:31:55.251: E/AndroidRuntime(537): at java.util.StringTokenizer.nextToken(StringTokenizer.java:208) 06-06 22:31:55.251: E/AndroidRuntime(537): at alex.android.test.database.quiz.TestdatabasequizActivity$1.onClick(TestdatabasequizActivity.java:95) 06-06 22:31:55.251: E/AndroidRuntime(537): at android.view.View.performClick(View.java:3511) 06-06 22:31:55.251: E/AndroidRuntime(537): at android.view.View$PerformClick.run(View.java:14105) 06-06 22:31:55.251: E/AndroidRuntime(537): at android.os.Handler.handleCallback(Handler.java:605) 06-06 22:31:55.251: E/AndroidRuntime(537): at android.os.Handler.dispatchMessage(Handler.java:92) 06-06 22:31:55.251: E/AndroidRuntime(537): at android.os.Looper.loop(Looper.java:137) 06-06 22:31:55.251: E/AndroidRuntime(537): at android.app.ActivityThread.main(ActivityThread.java:4424) 06-06 22:31:55.251: E/AndroidRuntime(537): at java.lang.reflect.Method.invokeNative(Native Method) 06-06 22:31:55.251: E/AndroidRuntime(537): at java.lang.reflect.Method.invoke(Method.java:511) 06-06 22:31:55.251: E/AndroidRuntime(537): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:784) 06-06 22:31:55.251: E/AndroidRuntime(537): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:551) 06-06 22:31:55.251: E/AndroidRuntime(537): at dalvik.system.NativeStart.main(Native Method) This is the database query public Cursor getContact(long rowId) throws SQLException { Cursor mCursor = db.query(true, DATABASE_TABLE, new String[] {KEY_ROWID, question, possibleAnsOne,possibleAnsTwo, possibleAnsThree,realQuestion,UR}, KEY_ROWID + "=" + rowId, null, null, null, null, null); if (mCursor != null) { mCursor.moveToFirst(); }

  Read the article

• Deserialization error in a new environment

  - by cerhart

  I have a web application that calls a third-party web service. When I run it locally, I have no problems, but when I move it to my production environment, I get the following error: There is an error in XML document (2, 428). Stack: at System.Xml.Serialization.XmlSerializer.Deserialize(XmlReader xmlReader, String encodingStyle, XmlDeserializationEvents events) at System.Xml.Serialization.XmlSerializer.Deserialize(XmlReader xmlReader, String encodingStyle) at System.Web.Services.Protocols.SoapHttpClientProtocol.ReadResponse(SoapClientMessage message, WebResponse response, Stream responseStream, Boolean asyncCall) at System.Web.Services.Protocols.SoapHttpClientProtocol.Invoke(String methodName, Object[] parameters) at RMXClasses.RMXContactService.ContactService.getActiveSessions(String user, String pass) in C:\Users\hp\Documents\Visual Studio 2008\Projects\ReklamStore\RMXClasses\Web References\RMXContactService\Reference.cs:line 257 at I have used the same web config file from the production environment but it still works locally. My local machine is a running vista home edition and the production environment is windows server 2003. The application is written in asp.net 3.5, wierdly under the asp.net config tab in iis, 3.5 doesn't show up in the drop down list, although that version of the framework is installed. The error is not being thrown in my code, it happens during serialization. I called the method on the proxy, I have checked the arguments and they are OK. I have also logged the SOAP request and response, and they both look OK as well. I am really at a loss here. Any ideas? SOAP log: This is the soap response that the program seems to have trouble parsing only on server 2003. On my machine the soap is identical, and yet it parses with no problems. SoapResponse BeforeDeserialize; <?xml version="1.0" encoding="UTF-8"?> <SOAP-ENV:Envelope xmlns:SOAP-ENV="http://schemas.xmlsoap.org/soap/envelope/" xmlns:ns1="urn:ContactService" xmlns:ns2="http://api.yieldmanager.com/types" xmlns:SOAP-ENC="http://schemas.xmlsoap.org/soap/encoding/" xmlns:xsd="http://www.w3.org/2001/XMLSchema" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" SOAP-ENV:encodingStyle="http://schemas.xmlsoap.org/soap/encoding/"><SOAP-ENV:Body><ns1:getActiveSessionsResponse> <sessions SOAP-ENC:arrayType="ns2:session[1]" xsi:type="ns2:array_of_session"> <item xsi:type="ns2:session"> <token xsi:type="xsd:string">xxxxxxxxxxxxxxxxxxxx1ae12517584b</token> <creation_time xsi:type="xsd:dateTime">2009-09-25T05:51:19Z</creation_time> <modification_time xsi:type="xsd:dateTime">2009-09-25T05:51:19Z</modification_time> <ip_address xsi:type="xsd:string">xxxxxxxxxx</ip_address> <contact_id xsi:type="xsd:long">xxxxxx</contact_id></item></sessions> </ns1:getActiveSessionsResponse></SOAP-ENV:Body></SOAP-ENV:Envelope>

  Read the article

• One intent is working, second is giving me a crash

  - by user1480742

  ok, so both intents receiver sides are on the same activite and they are sending from different ones....second one is not working, first one does, dont know why...all 3 activites are ok in manifest and all that //second intent on senders side public void onItemSelected(AdapterView<?> arg0, View users, int i, long l) { FILENAME = (adapter.getItem(i)).toString(); Bundle viewBag2 = new Bundle(); viewBag2.putString("profile_name", FILENAME); Intent b = new Intent(OptionsMenu.this, CoreActivity.class); b.putExtras(viewBag2); startActivity(b); } //second intent on receiver side private void Data_transfer() { Bundle gotbasket2 = getIntent().getExtras(); profileName = gotbasket2.getString("profile_name"); } //first (working intent) on senders side public void onClick(View v) { Bundle viewBag = new Bundle(); viewBag.putString("spinner_result", s); a.putExtras(viewBag); } //first (working intent) on receiver side private void Data_transfer() { // TODO Auto-generated method stub Bundle gotbasket = getIntent().getExtras(); x = gotbasket.getString("spinner_result"); } 06-26 20:22:09.787: D/AndroidRuntime(1802): Shutting down VM 06-26 20:22:09.787: W/dalvikvm(1802): threadid=1: thread exiting with uncaught exception (group=0x40015560) 06-26 20:22:09.847: E/AndroidRuntime(1802): FATAL EXCEPTION: main 06-26 20:22:09.847: E/AndroidRuntime(1802): java.lang.RuntimeException: Unable to start activity ComponentInfo{mioc.diver/mioc.diver.CoreActivity}: java.lang.NullPointerException 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.app.ActivityThread.performLaunchActivity(ActivityThread.java:1647) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.app.ActivityThread.handleLaunchActivity(ActivityThread.java:1663) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.app.ActivityThread.access$1500(ActivityThread.java:117) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.app.ActivityThread$H.handleMessage(ActivityThread.java:931) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.os.Handler.dispatchMessage(Handler.java:99) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.os.Looper.loop(Looper.java:123) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.app.ActivityThread.main(ActivityThread.java:3683) 06-26 20:22:09.847: E/AndroidRuntime(1802): at java.lang.reflect.Method.invokeNative(Native Method) 06-26 20:22:09.847: E/AndroidRuntime(1802): at java.lang.reflect.Method.invoke(Method.java:507) 06-26 20:22:09.847: E/AndroidRuntime(1802): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:839) 06-26 20:22:09.847: E/AndroidRuntime(1802): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:597) 06-26 20:22:09.847: E/AndroidRuntime(1802): at dalvik.system.NativeStart.main(Native Method) 06-26 20:22:09.847: E/AndroidRuntime(1802): Caused by: java.lang.NullPointerException 06-26 20:22:09.847: E/AndroidRuntime(1802): at mioc.diver.CoreActivity.Data_transfer(CoreActivity.java:189) 06-26 20:22:09.847: E/AndroidRuntime(1802): at mioc.diver.CoreActivity.onCreate(CoreActivity.java:88) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.app.Instrumentation.callActivityOnCreate(Instrumentation.java:1047) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.app.ActivityThread.performLaunchActivity(ActivityThread.java:1611) 06-26 20:22:09.847: E/AndroidRuntime(1802): ... 11 more

  Read the article

• def constrainedMatchPair(firstMatch,secondMatch,length):

  - by smart

  matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

  Read the article

• use jQuery to get 'true size' of image without removing the class

  - by jon3laze

  I am using Jcrop on an image that is resized with css for uniformity. JS <script type="text/javascript"> $(window).load(function() { //invoke Jcrop API and set options var api = $.Jcrop('#image', { onSelect: storeCoords, trueSize: [w, h] }); api.disable(); //disable until ready to use //enable the Jcrop on crop button click $('#crop').click(function() { api.enable(); }); }); function storeCoords(c) { $('#X').val(c.x); $('#Y').val(c.y); $('#W').val(c.w); $('#H').val(c.h); }; </script> HTML <body> <img src="/path/to/image.jpg" id="image" class="img_class" alt="" /> <br /> <span id="crop" class="button">Crop Photo</span> <span id="#X" class="hidden"></span> <span id="#Y" class="hidden"></span> <span id="#W" class="hidden"></span> <span id="#H" class="hidden"></span> </body> CSS body { font-size: 13px; width: 500px; height: 500px; } .image { width: 200px; height: 300px; } .hidden { display: none; } I need to set the h and w variables to the size of the actual image. I tried using the .clone() manipulator to make a copy of the image and then remove the class from the clone to get the sizing but it sets the variables to zeros. var pic = $('#image').clone(); pic.removeClass('image'); var h = pic.height(); var w = pic.width(); It works if I append the image to an element in the page, but these are larger images and I would prefer not to be loading them as hidden images if there is a better way to do this. Also removing the class, setting the variables, and then re-adding the class was producing sporadic results. I was hoping for something along the lines of: $('#image').removeClass('image', function() { h = $(this).height(); w = $(this).width(); }).addClass('image'); But the removeClass function doesn't work like that :P

  Read the article

• Activity gets killed while executing the camera intent

  - by BlackRider

  In my app I call the system camera to take a picture, and then handle the result in onActivityResult. You know, the usual. It used to work, but now my calling activity gets killed while I'm taking the picture. Specifically, onDestroy() is called on my activity right after I press the camera shutter. The photo does get taken & saved (I've checked that the file gets written on the SD card). After I accept the photo, instead of returning to the calling activity and invoking onActivityResult, the previous activity in the activity stack gets called. I see no exceptions in the logcat. My custom exception handler doesn't get called. If it matters, my app also includes a service that listens to GPS updates, but I unregister all the receivers in onPause(). Here's the call stack for MyCallingActivity.onDestroy(): Thread [<1> main] (Suspended (breakpoint at line 303 in NewPlaceDetailsActivity)) NewPlaceDetailsActivity.onDestroy() line: 303 ActivityThread.performDestroyActivity(IBinder, boolean, int, boolean) line: 2663 ActivityThread.handleDestroyActivity(IBinder, boolean, int, boolean) line: 2694 ActivityThread.access$2100(ActivityThread, IBinder, boolean, int, boolean) line: 117 BinderProxy(ActivityThread$H).handleMessage(Message) line: 968 ActivityThread$H(Handler).dispatchMessage(Message) line: 99 Looper.loop() line: 130 ActivityThread.main(String[]) line: 3687 Method.invokeNative(Object, Object[], Class, Class[], Class, int, boolean) line: not available [native method] Method.invoke(Object, Object...) line: 507 ZygoteInit$MethodAndArgsCaller.run() line: 842 ZygoteInit.main(String[]) line: 600 NativeStart.main(String[]) line: not available [native method] This is how I start the camera activity, in case you're wondering: protected void startCamera() { createPhotoDirsIfNeeded(); String fileName = "temp.jpg"; ContentValues values = new ContentValues(); values.put(MediaStore.Images.Media.TITLE, fileName); m_capturedImageUri = getContentResolver().insert(MediaStore.Images.Media.EXTERNAL_CONTENT_URI, values); m_photoFileName = APP_PHOTO_PATH + "/" + DateFormat.format(DATE_FORMAT, Calendar.getInstance().getTime()) + ".jpg"; File picFile = new File(m_photoFileName); if(picFile.exists()) { picFile.delete(); } // start the camera activity Intent intent = new Intent(MediaStore.ACTION_IMAGE_CAPTURE); intent.putExtra(MediaStore.EXTRA_OUTPUT, Uri.fromFile(picFile)); startActivityForResult(intent, IntentHelper.REQUEST_TAKE_PHOTO); } How can I find out why does my activity get killed, AND removed from the stack instead of being created again?

  Read the article

• Exception showing a erroneous web page in a WPF frame

  - by H4mm3rHead

  I have a small application where i need to navigate to an url, I use this method to get the Frame: public override System.Windows.UIElement GetPage(System.Windows.UIElement container) { XmlDocument doc = new XmlDocument(); doc.Load(Location); string webSiteUrl = doc.SelectSingleNode("website").InnerText; Frame newFrame = new Frame(); if (!webSiteUrl.StartsWith("http://")) { webSiteUrl = "http://" + webSiteUrl; } newFrame.Source = new Uri(webSiteUrl); return newFrame; } My problem is now that the page im trying to show generates a error (or so i think), when i load the page in a browser it never fully loads, keeps saying "loading1 element" in the load bar and the green progress line (IE 8) keeps showing. When i attach my debugger i get this error: System.ArgumentException was unhandled Message="Parameter and value pair is not valid. Expected form is parameter=value." Source="WindowsBase" StackTrace: at MS.Internal.ContentType.ParseParameterAndValue(String parameterAndValue) at MS.Internal.ContentType..ctor(String contentType) at MS.Internal.WpfWebRequestHelper.GetContentType(WebResponse response) at System.Windows.Navigation.NavigationService.GetObjectFromResponse(WebRequest request, WebResponse response, Uri destinationUri, Object navState) at System.Windows.Navigation.NavigationService.HandleWebResponse(IAsyncResult ar) at System.Windows.Navigation.NavigationService.<>c__DisplayClassc.<HandleWebResponseOnRightDispatcher>b__8(Object unused) at System.Windows.Threading.ExceptionWrapper.InternalRealCall(Delegate callback, Object args, Boolean isSingleParameter) at System.Windows.Threading.ExceptionWrapper.TryCatchWhen(Object source, Delegate callback, Object args, Boolean isSingleParameter, Delegate catchHandler) at System.Windows.Threading.DispatcherOperation.InvokeImpl() at System.Threading.ExecutionContext.runTryCode(Object userData) at System.Runtime.CompilerServices.RuntimeHelpers.ExecuteCodeWithGuaranteedCleanup(TryCode code, CleanupCode backoutCode, Object userData) at System.Threading.ExecutionContext.Run(ExecutionContext executionContext, ContextCallback callback, Object state) at System.Windows.Threading.DispatcherOperation.Invoke() at System.Windows.Threading.Dispatcher.ProcessQueue() at System.Windows.Threading.Dispatcher.WndProcHook(IntPtr hwnd, Int32 msg, IntPtr wParam, IntPtr lParam, Boolean& handled) at MS.Win32.HwndWrapper.WndProc(IntPtr hwnd, Int32 msg, IntPtr wParam, IntPtr lParam, Boolean& handled) at MS.Win32.HwndSubclass.DispatcherCallbackOperation(Object o) at System.Windows.Threading.ExceptionWrapper.InternalRealCall(Delegate callback, Object args, Boolean isSingleParameter) at System.Windows.Threading.ExceptionWrapper.TryCatchWhen(Object source, Delegate callback, Object args, Boolean isSingleParameter, Delegate catchHandler) ved System.Windows.Threading.Dispatcher.InvokeImpl(DispatcherPriority priority, TimeSpan timeout, Delegate method, Object args, Boolean isSingleParameter) at MS.Win32.HwndSubclass.SubclassWndProc(IntPtr hwnd, Int32 msg, IntPtr wParam, IntPtr lParam) at MS.Win32.UnsafeNativeMethods.DispatchMessage(MSG& msg) at System.Windows.Threading.Dispatcher.TranslateAndDispatchMessage(MSG& msg) at System.Windows.Threading.Dispatcher.PushFrameImpl(DispatcherFrame frame) at System.Windows.Application.RunInternal(Window window) at GreenWebPlayerWPF.App.Main() i C:\Development\Hvarregaard\GWDS\GreenWeb\GreenWebPlayerWPF\obj\Debug\App.g.cs:linje 0 at System.AppDomain._nExecuteAssembly(Assembly assembly, String[] args) at Microsoft.VisualStudio.HostingProcess.HostProc.RunUsersAssembly() at System.Threading.ExecutionContext.Run(ExecutionContext executionContext, ContextCallback callback, Object state) at System.Threading.ThreadHelper.ThreadStart() InnerException: Anyone? Or any way to capture it and respond to it, tried a try/catch around my code, but its not caught - seems something deep inside the guts of the CLR is failing.

  Read the article

• Android - exception from an AsynchTask call

  - by GeekedOut

  I have an Activity that makes a remote server call and tries to populate a list. The call to the server works fine, and the call returns some JSON which is good. But then the system throws this exception: 04-06 18:43:19.626: D/AndroidRuntime(2564): Shutting down VM 04-06 18:43:19.626: W/dalvikvm(2564): threadid=1: thread exiting with uncaught exception (group=0x409c01f8) 04-06 18:43:19.686: E/AndroidRuntime(2564): FATAL EXCEPTION: main 04-06 18:43:19.686: E/AndroidRuntime(2564): java.lang.NullPointerException 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.widget.ArrayAdapter.createViewFromResource(ArrayAdapter.java:394) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.widget.ArrayAdapter.getView(ArrayAdapter.java:362) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.widget.AbsListView.obtainView(AbsListView.java:2033) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.widget.ListView.measureHeightOfChildren(ListView.java:1244) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.widget.ListView.onMeasure(ListView.java:1155) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.view.View.measure(View.java:12723) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.view.ViewGroup.measureChildWithMargins(ViewGroup.java:4698) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.widget.LinearLayout.measureChildBeforeLayout(LinearLayout.java:1369) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.widget.LinearLayout.measureVertical(LinearLayout.java:660) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.widget.LinearLayout.onMeasure(LinearLayout.java:553) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.view.View.measure(View.java:12723) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.view.ViewGroup.measureChildWithMargins(ViewGroup.java:4698) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.widget.FrameLayout.onMeasure(FrameLayout.java:293) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.view.View.measure(View.java:12723) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.widget.LinearLayout.measureVertical(LinearLayout.java:812) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.widget.LinearLayout.onMeasure(LinearLayout.java:553) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.view.View.measure(View.java:12723) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.view.ViewGroup.measureChildWithMargins(ViewGroup.java:4698) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.widget.FrameLayout.onMeasure(FrameLayout.java:293) 04-06 18:43:19.686: E/AndroidRuntime(2564): at com.android.internal.policy.impl.PhoneWindow$DecorView.onMeasure(PhoneWindow.java:2092) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.view.View.measure(View.java:12723) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.view.ViewRootImpl.performTraversals(ViewRootImpl.java:1064) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.view.ViewRootImpl.handleMessage(ViewRootImpl.java:2442) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.os.Handler.dispatchMessage(Handler.java:99) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.os.Looper.loop(Looper.java:137) 04-06 18:43:19.686: E/AndroidRuntime(2564): at android.app.ActivityThread.main(ActivityThread.java:4424) 04-06 18:43:19.686: E/AndroidRuntime(2564): at java.lang.reflect.Method.invokeNative(Native Method) 04-06 18:43:19.686: E/AndroidRuntime(2564): at java.lang.reflect.Method.invoke(Method.java:511) 04-06 18:43:19.686: E/AndroidRuntime(2564): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:784) 04-06 18:43:19.686: E/AndroidRuntime(2564): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:551) 04-06 18:43:19.686: E/AndroidRuntime(2564): at dalvik.system.NativeStart.main(Native Method) Why would this happen? It doesn't point to any of my code so its a bit strange. the protected void onPostExecute(String result) never gets called on the callback. Thanks!

  Read the article

• How do I create a thread-safe write-once read-many value in Java?

  - by Software Monkey

  This is a problem I encounter frequently in working with more complex systems and which I have never figured out a good way to solve. It usually involves variations on the theme of a shared object whose construction and initialization are necessarily two distinct steps. This is generally because of architectural requirements, similar to applets, so answers that suggest I consolidate construction and initialization are not useful. By way of example, let's say I have a class that is structured to fit into an application framework like so: public class MyClass { private /*ideally-final*/ SomeObject someObject; MyClass() { someObject=null; } public void startup() { someObject=new SomeObject(...arguments from environment which are not available until startup is called...); } public void shutdown() { someObject=null; // this is not necessary, I am just expressing the intended scope of someObject explicitly } } I can't make someObject final since it can't be set until startup() is invoked. But I would really like it to reflect it's write-once semantics and be able to directly access it from multiple threads, preferably avoiding synchronization. The idea being to express and enforce a degree of finalness, I conjecture that I could create a generic container, like so: public class WoRmObject<T> { private T object; WoRmObject() { object=null; } public WoRmObject set(T val) { object=val; return this; } public T get() { return object; } } and then in MyClass, above, do: private final WoRmObject<SomeObject> someObject; MyClass() { someObject=new WoRmObject<SomeObject>(); } public void startup() { someObject.set(SomeObject(...arguments from environment which are not available until startup is called...)); } Which raises some questions for me: Is there a better way, or existing Java object (would have to be available in Java 4)? Is this thread-safe provided that no other thread accesses someObject.get() until after it's set() has been called. The other threads will only invoke methods on MyClass between startup() and shutdown() - the framework guarantees this. Given the completely unsynchronized WoRmObject container, it is ever possible under either JMM to see a value of object which is neither null nor a reference to a SomeObject? In other words, does has the JMM always guaranteed that no thread can observe the memory of an object to be whatever values happened to be on the heap when the object was allocated.

  Read the article

• Writing a managed wrapper for unmanaged (C++) code - custom types/structs

  - by Bobby

  faacEncConfigurationPtr FAACAPI faacEncGetCurrentConfiguration( faacEncHandle hEncoder); I'm trying to come up with a simple wrapper for this C++ library; I've never done more than very simple p/invoke interop before - like one function call with primitive arguments. So, given the above C++ function, for example, what should I do to deal with the return type, and parameter? FAACAPI is defined as: #define FAACAPI __stdcall faacEncConfigurationPtr is defined: typedef struct faacEncConfiguration { int version; char *name; char *copyright; unsigned int mpegVersion; unsigned long bitRate; unsigned int inputFormat; int shortctl; psymodellist_t *psymodellist; int channel_map[64]; } faacEncConfiguration, *faacEncConfigurationPtr; AFAIK this means that the return type of the function is a reference to this struct? And faacEncHandle is: typedef struct { unsigned int numChannels; unsigned long sampleRate; ... SR_INFO *srInfo; double *sampleBuff[MAX_CHANNELS]; ... double *freqBuff[MAX_CHANNELS]; double *overlapBuff[MAX_CHANNELS]; double *msSpectrum[MAX_CHANNELS]; CoderInfo coderInfo[MAX_CHANNELS]; ChannelInfo channelInfo[MAX_CHANNELS]; PsyInfo psyInfo[MAX_CHANNELS]; GlobalPsyInfo gpsyInfo; faacEncConfiguration config; psymodel_t *psymodel; /* quantizer specific config */ AACQuantCfg aacquantCfg; /* FFT Tables */ FFT_Tables fft_tables; int bitDiff; } faacEncStruct, *faacEncHandle; So within that struct we see a lot of other types... hmm. Essentially, I'm trying to figure out how to deal with these types in my managed wrapper? Do I need to create versions of these types/structs, in C#? Something like this: [StructLayout(LayoutKind.Sequential)] struct faacEncConfiguration { uint useTns; ulong bitRate; ... } If so then can the runtime automatically "map" these objects onto eachother? And, would I have to create these "mapped" types for all the types in these return types/parameter type hierarchies, all the way down until I get to all primitives? I know this is a broad topic, any advice on getting up-to-speed quickly on what I need to learn to make this happen would be very much appreciated! Thanks!

  Read the article

• Problem with continue in While Loop within Try/Catch in C# (2.0)

  - by csharpnoob

  Hi, when i try to use in my ASPX Webpage in the Code Behind this try{ while() { ... db.Open(); readDataMoney = new OleDbCommand("SELECT * FROM Customer WHERE card = '" + customer.card + "';", db).ExecuteReader(); while (readDataMoney.Read()) { try { if (!readDataMoney.IsDBNull(readDataMoney.GetOrdinal("Credit"))) { customer.credit = Convert.ToDouble(readDataMoney[readDataMoney.GetOrdinal("Credit")]); } if (!readDataMoney.IsDBNull(readDataMoney.GetOrdinal("Bonus"))) { customer.bonus = Convert.ToDouble(readDataMoney[readDataMoney.GetOrdinal("Bonus")]); } } catch (Exception ex) { Connector.writeLog("Money: " + ex.StackTrace + "" + ex.Message + "" + ex.Source); customer.credit = 0.0; customer.credit = 0.0; continue; } finally { } } readDataMoney.Close(); vsiDB.Close(); ... } }catch { continue; } The whole page hangs if there is a problem when the read from db isn't working. I tried to check for !isNull, but same problem. I have a lots of differend MDB Files to process, which are readonly (can't repair/compact) and some or others not. Same Design/Layout of Tables. With good old ASP Classic 3.0 all of them are processing with the "On Resume Next". I know I know. But that's how it is. Can't change the source. So the basic question: So is there any way to tell .NET to continue the loop whatever happens within the try loop if there is any exception? After a lots of wating time i get this exceptions: at System.Data.Common.UnsafeNativeMethods.IDBInitializeInitialize.Invoke(IntPtr pThis) at System.Data.OleDb.DataSourceWrapper.InitializeAndCreateSession(OleDbConnectionString constr, SessionWrapper& sessionWrapper) at System.Data.OleDb.OleDbConnectionInternal..ctor(OleDbConnectionString constr, OleDbConnection connection) at System.Data.OleDb.OleDbConnectionFactory.CreateConnection(DbConnectionOptions options, Object poolGroupProviderInfo, DbConnectionPool pool, DbConnection owningObject) at System.Data.ProviderBase.DbConnectionFactory.CreateNonPooledConnection(DbConnection owningConnection, DbConnectionPoolGroup poolGroup) at System.Data.ProviderBase.DbConnectionFactory.GetConnection(DbConnection owningConnection) at System.Data.ProviderBase.DbConnectionClosed.OpenConnection(DbConnection outerConnection, DbConnectionFactory connectionFactory) at System.Data.OleDb.OleDbConnection.Open() at GetCustomer(String card)Thread was being aborted.System.Data and System.Runtime.InteropServices.Marshal.ReadInt16(IntPtr ptr, Int32 ofs) System.Data.ProviderBase.DbBuffer.ReadInt16(Int32 offset) System.Data.OleDb.ColumnBinding.Value_I2() System.Data.OleDb.ColumnBinding.Value() System.Data.OleDb.OleDbDataReader.GetValue(Int32 ordinal) System.Data.OleDb.OleDbDataReader.get_Item(Int32 index) Thread was terminated.mscorlib Thanks for any help.

  Read the article

• C++ game designing & polymorphism question

  - by Kotti

  Hi! I'm trying to implement some sort of 'just-for-me' game engine and the problem's plot goes the following way: Suppose I have some abstract interface for a renderable entity, e.g. IRenderable. And it's declared the following way: interface IRenderable { // (...) // Suppose that Backend is some abstract backend used // for rendering, and it's implementation is not important virtual void Render(Backend& backend) = 0; }; What I'm doing right now is something like declaring different classes like class Ball : public IRenderable { virtual void Render(Backend& backend) { // Rendering implementation, that is specific for // the Ball object // (...) } }; And then everything looks fine. I can easily do something like std::vector<IRenderable*> items, push some items like new Ball() in this vector and then make a call similiar to foreach (IRenderable* in items) { item->Render(backend); } Ok, I guess it is the 'polymorphic' way, but what if I want to have different types of objects in my game and an ability to manipulate their state, where every object can be manipulated via it's own interface? I could do something like struct GameState { Ball ball; Bonus bonus; // (...) }; and then easily change objects state via their own methods, like ball.Move(...) or bonus.Activate(...), where Move(...) is specific for only Ball and Activate(...) - for only Bonus instances. But in this case I lose the opportunity to write foreach IRenderable* simply because I store these balls and bonuses as instances of their derived, not base classes. And in this case the rendering procedure turns into a mess like ball.Render(backend); bonus.Render(backend); // (...) and it is bad because we actually lose our polymorphism this way (no actual need for making Render function virtual, etc. The other approach means invoking downcasting via dynamic_cast or something with typeid to determine the type of object you want to manipulate and this looks even worse to me and this also breaks this 'polymorphic' idea. So, my question is - is there some kind of (probably) alternative approach to what I want to do or can my current pattern be somehow modified so that I would actually store IRenderable* for my game objects (so that I can invoke virtual Render method on each of them) while preserving the ability to easily change the state of these objects? Maybe I'm doing something absolutely wrong from the beginning, if so, please point it out :) Thanks in advance!

  Read the article

• SQL Invalid Object Name 'AddressType'

  - by salvationishere

  I am getting the above error in my VS 2008 C# method when I try to invoke the SQL getColumnNames stored procedure from VS. This SP accepts one input parameter, the table name, and works successfully from SSMS. Currently I am selecting the AdventureWorks AddressType table for it to pull the column names from this table. I can see teh AdventureWorks table available in VS from my Server Explorer / Data Connection. And I see both the AddressType table and getColumnNames SP showing in Server Explorer. But I am still getting this error listed above. Here is the C# code snippet I use to execute this: public static DataTable DisplayTableColumns(string tt) { SqlDataReader dr = null; string TableName = tt; string connString = "Data Source=.;AttachDbFilename=\"C:\Program Files\Microsoft SQL Server\MSSQL10.MSSQLSERVER\MSSQL\DATA\AdventureWorks_Data.mdf\";Initial Catalog=AdventureWorks;Integrated Security=True;Connect Timeout=30;User Instance=False"; string errorMsg; SqlConnection conn2 = new SqlConnection(connString); SqlCommand cmd = conn2.CreateCommand(); try { cmd.CommandText = "dbo.getColumnNames"; cmd.CommandType = CommandType.StoredProcedure; cmd.Connection = conn2; SqlParameter parm = new SqlParameter("@TableName", SqlDbType.VarChar); parm.Value = TableName; parm.Direction = ParameterDirection.Input; cmd.Parameters.Add(parm); conn2.Open(); dr = cmd.ExecuteReader(); } catch (Exception ex) { errorMsg = ex.Message; } And when I examine the errorMsg it says the following: " at System.Data.SqlClient.SqlConnection.OnError(SqlException exception, Boolean breakConnection)\r\n at System.Data.SqlClient.SqlInternalConnection.OnError(SqlException exception, Boolean breakConnection)\r\n at System.Data.SqlClient.TdsParser.ThrowExceptionAndWarning(TdsParserStateObject stateObj)\r\n at System.Data.SqlClient.TdsParser.Run(RunBehavior runBehavior, SqlCommand cmdHandler, SqlDataReader dataStream, BulkCopySimpleResultSet bulkCopyHandler, TdsParserStateObject stateObj)\r\n at System.Data.SqlClient.SqlDataReader.ConsumeMetaData()\r\n at System.Data.SqlClient.SqlDataReader.get_MetaData()\r\n at System.Data.SqlClient.SqlCommand.FinishExecuteReader(SqlDataReader ds, RunBehavior runBehavior, String resetOptionsString)\r\n at System.Data.SqlClient.SqlCommand.RunExecuteReaderTds(CommandBehavior cmdBehavior, RunBehavior runBehavior, Boolean returnStream, Boolean async)\r\n at System.Data.SqlClient.SqlCommand.RunExecuteReader(CommandBehavior cmdBehavior, RunBehavior runBehavior, Boolean returnStream, String method, DbAsyncResult result)\r\n at System.Data.SqlClient.SqlCommand.RunExecuteReader(CommandBehavior cmdBehavior, RunBehavior runBehavior, Boolean returnStream, String method)\r\n at System.Data.SqlClient.SqlCommand.ExecuteReader(CommandBehavior behavior, String method)\r\n at System.Data.SqlClient.SqlCommand.ExecuteReader()\r\n at ADONET_namespace.ADONET_methods.DisplayTableColumns(String tt) in C:\Documents and Settings\Admin\My Documents\Visual Studio 2008\Projects\AddFileToSQL\AddFileToSQL\ADONET methods.cs:line 35" Where line 35 is dr = cmd.ExecuteReader();

  Read the article

• Implementing hoverIntent for Drop Down Menu (coming from click_event)

  - by stormeTrooper

  I've just recently started programming, I was hoping for some help. I have a drop down menu that was originally activated by click_event, however I want to now implement hoverIntent in order to make the menu drop. The issue I am having now is being able to use the menu, because whenever I invoke the menu now, once I leave the area that activates the menu, the menu closes. If you could explain to me like I'm five, I'd appreciate it, thanks :) The code I am using as follows: JavaScript: function setupUserConfigMenu() { $('.user_profile_btn').hoverIntent( function (event) { $('#user_settings_dropdown').animate({height:['toggle', 'swing'] }, 225); }, function (event) { $('#user_settings_dropdown').animate({height:['toggle', 'swing'] }, 225); }) } HTML: <li> <a href="<%= "#" %>" class="user_profile_btn" title="Your profile page"><%= truncate(current_user.full_name || current_user.name, :length => 28) %> <div class="arrow_down"></div></a> <ul id="user_settings_dropdown"> <li> <a href="<%= current_user.get_url(true) %>"> <%= image_tag current_user.get_thumb_url, :size => "30x30" %> <div> <%= truncate(current_user.full_name || current_user.name, :length => 40) %> <br> View profile </div> </a> </li> <div class="grey_line"></div> <li class="settings_list_item"> <%= link_to "Settings", edit_user_registration_path %> </li> <li class="settings_list_item"> <%= link_to "About", "/about" %> </li> <li class="settings_list_item"> <%= link_to "Logout", destroy_user_session_path, :method => :delete %> </li> </ul> </li>

  Read the article

• Force close while calling mainactivity from widget (android)

  - by Shaji Thorn Blue

  Iam creating a simple widget, by this widget i want to open my mainactivity. Iam sending a unique key from my widget class to check whether my mainactivity is called via widget or not. But as soon as i clicked on my widget my mainactivity get force close. here is code of my widget class... @Override public void onUpdate(Context context, AppWidgetManager appWidgetManager, int[] widgets) { // TODO Auto-generated method stub int numofWidgets = widgets.length; for(int i=0;i<numofWidgets;i++){ int widget = widgets[i]; Intent in = new Intent(context, EmergencyButton.class); in.putExtra("uniquevalue", "widget"); PendingIntent pendingintent = PendingIntent.getActivity(context, 0, in, 0); RemoteViews views = new RemoteViews(context.getPackageName(), R.layout.widgetlayout); views.setOnClickPendingIntent(R.id.button, pendingintent); appWidgetManager.updateAppWidget(widget, views); } } And Here is my code of mainactivity where iam checking whether called came from widget or not @Override protected void onCreate(Bundle savedInstanceState) { // TODO Auto-generated method stub super.onCreate(savedInstanceState); setContentView(R.layout.mainactivity); Intent intentwidget = this.getIntent(); if(intentwidget !=null) { String widgetdata = "nothing"; widgetdata = intentwidget.getExtras().getString("uniquevalue"); if(widgetdata.equals("widget")) { et1.setText(widgetdata); } } } And here is my logcat 11-04 14:57:14.361: E/AndroidRuntime(1701): FATAL EXCEPTION: main 11-04 14:57:14.361: E/AndroidRuntime(1701): java.lang.RuntimeException: Unable to start activityComponentInfo{com.appsionlabs.googlemapv2/com.appsionlabs.googlemapv2.EmergencyButton}: java.lang.NullPointerException 11-04 14:57:14.361: E/AndroidRuntime(1701): at android.app.ActivityThread.performLaunchActivity(ActivityThread.java:1647) 11-04 14:57:14.361: E/AndroidRuntime(1701): at android.app.ActivityThread.handleLaunchActivity(ActivityThread.java:1663) 11-04 14:57:14.361: E/AndroidRuntime(1701): at android.app.ActivityThread.access$1500(ActivityThread.java:117) 11-04 14:57:14.361: E/AndroidRuntime(1701): at android.app.ActivityThread$H.handleMessage(ActivityThread.java:931) 11-04 14:57:14.361: E/AndroidRuntime(1701): at android.os.Handler.dispatchMessage(Handler.java:99) 11-04 14:57:14.361: E/AndroidRuntime(1701): at android.os.Looper.loop(Looper.java:123) 11-04 14:57:14.361: E/AndroidRuntime(1701): at android.app.ActivityThread.main(ActivityThread.java:3683) 11-04 14:57:14.361: E/AndroidRuntime(1701): at java.lang.reflect.Method.invokeNative(Native Method) 11-04 14:57:14.361: E/AndroidRuntime(1701): at java.lang.reflect.Method.invoke(Method.java:507) 11-04 14:57:14.361: E/AndroidRuntime(1701): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:839) 11-04 14:57:14.361: E/AndroidRuntime(1701): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:597) 11-04 14:57:14.361: E/AndroidRuntime(1701): at dalvik.system.NativeStart.main(Native Method) 11-04 14:57:14.361: E/AndroidRuntime(1701): Caused by: java.lang.NullPointerException 11-04 14:57:14.361: E/AndroidRuntime(1701): at com.appsionlabs.googlemapv2.EmergencyButton.onCreate(EmergencyButton.java:29) 11-04 14:57:14.361: E/AndroidRuntime(1701): at android.app.Instrumentation.callActivityOnCreate(Instrumentation.java:1047) 11-04 14:57:14.361: E/AndroidRuntime(1701): at android.app.ActivityThread.performLaunchActivity(ActivityThread.java:1611)

  Read the article

• How do I use Ruby metaprogramming to refactor this common code?

  - by James Wenton

  I inherited a project with a lot of badly-written Rake tasks that I need to clean up a bit. Because the Rakefiles are enormous and often prone to bizarre nonsensical dependencies, I'm simplifying and isolating things a bit by refactoring everything to classes. Specifically, that pattern is the following: namespace :foobar do desc "Frozz the foobar." task :frozzify do unless Rake.application.lookup('_frozzify') require 'tasks/foobar' Foobar.new.frozzify end Rake.application['_frozzify'].invoke end # Above pattern repeats many times. end # Several namespaces, each with tasks that follow this pattern. In tasks/foobar.rb, I have something that looks like this: class Foobar def frozzify() # The real work happens here. end # ... Other tasks also in the :foobar namespace. end For me, this is great, because it allows me to separate the task dependencies from each other and to move them to another location entirely, and I've been able to drastically simplify things and isolate the dependencies. The Rakefile doesn't hit a require until you actually try to run a task. Previously this was causing serious issues because you couldn't even list the tasks without it blowing up. My problem is that I'm repeating this idiom very frequently. Notice the following patterns: For every namespace :xyz_abc, there is a corresponding class in tasks/... in the file tasks/[namespace].rb, with a class name that looks like XyzAbc. For every task in a particular namespace, there is an identically named method in the associated namespace class. For example, if namespace :foo_bar has a task :apples, you would expect to see def apples() ... inside the FooBar class, which itself is in tasks/foo_bar.rb. Every task :t defines a "meta-task" _t (that is, the task name prefixed with an underscore) which is used to do the actual work. I still want to be able to specify a desc-description for the tasks I define, and that will be different for each task. And, of course, I have a small number of tasks that don't follow the above pattern at all, so I'll be specifying those manually in my Rakefile. I'm sure that this can be refactored in some way so that I don't have to keep repeating the same idiom over and over, but I lack the experience to see how it could be done. Can someone give me an assist?

  Read the article

• nodejs async.waterfall method

  - by user1513388

  Update 2 Complete code listing var request = require('request'); var cache = require('memory-cache'); var async = require('async'); var server = '172.16.221.190' var user = 'admin' var password ='Passw0rd' var dn ='\\VE\\Policy\\Objects' var jsonpayload = {"Username": user, "Password": password} async.waterfall([ //Get the API Key function(callback){ request.post({uri: 'http://' + server +'/sdk/authorize/', json: jsonpayload, headers: {'content_type': 'application/json'} }, function (e, r, body) { callback(null, body.APIKey); }) }, //List the credential objects function(apikey, callback){ var jsonpayload2 = {"ObjectDN": dn, "Recursive": true} request.post({uri: 'http://' + server +'/sdk/Config/enumerate?apikey=' + apikey, json: jsonpayload2, headers: {'content_type': 'application/json'} }, function (e, r, body) { var dns = []; for (var i = 0; i < body.Objects.length; i++) { dns.push({'name': body.Objects[i].Name, 'dn': body.Objects[i].DN}) } callback(null, dns, apikey); }) }, function(dns, apikey, callback){ // console.log(dns) var cb = []; for (var i = 0; i < dns.length; i++) { //Retrieve the credential var jsonpayload3 = {"CredentialPath": dns[i].dn, "Pattern": null, "Recursive": false} console.log(dns[i].dn) request.post({uri: 'http://' + server +'/sdk/credentials/retrieve?apikey=' + apikey, json: jsonpayload3, headers: {'content_type': 'application/json'} }, function (e, r, body) { // console.log(body) cb.push({'cl': body.Classname}) callback(null, cb, apikey); console.log(cb) }); } } ], function (err, result) { // console.log(result) // result now equals 'done' }); Update: I'm building a small application that needs to make multiple HTTP calls to a an external API and amalgamates the results into a single object or array. e.g. Connect to endpoint and get auth key - pass auth key to step 2 Connect to endpoint using auth key and get JSON results - create an object containing summary results and pass to step 3. Iterate over passed object summary results and call API for each item in the object to get detailed information for each summary line Create a single JSON data structure that contains the summary and detail information. The original question below outlines what I've tried so far! Original Question: Will the async.waterfall method support multiple callbacks? i.e. Iterate over an array thats passed from a previous item in the chain, then invoke multiple http requests each of which would have their own callbacks. e.g, sync.waterfall([ function(dns, key, callback){ var cb = []; for (var i = 0; i < dns.length; i++) { //Retrieve the credential var jsonpayload3 = {"Cred": dns[i].DN, "Pattern": null, "Recursive": false} console.log(dns[i].DN) request.post({uri: 'http://' + vedserver +'/api/cred/retrieve?apikey=' + key, json: jsonpayload3, headers: {'content_type': 'application/json'} }, function (e, r, body) { console.log(body) cb.push({'cl': body.Classname}) callback(null, cb, key); }); } }

  Read the article

• emacs: how do I use edebug on code that is defined in a macro?

  - by Cheeso

  I don't even know the proper terminology for this lisp syntax, so I don't know if the words I'm using to ask the question, make sense. But the question makes sense, I'm sure. So let me just show you. cc-mode (cc-fonts.el) has things called "matchers" which are bits of code that run to decide how to fontify a region of code. That sounds simple enough, but the matcher code is in a form I don't completely understand, with babckticks and comma-atsign and just comma and so on, and furthermore it is embedded in a c-lang-defcost, which itself is a macro. And I want to run edebug on that code. Look: (c-lang-defconst c-basic-matchers-after "Font lock matchers for various things that should be fontified after generic casts and declarations are fontified. Used on level 2 and higher." t `(;; Fontify the identifiers inside enum lists. (The enum type ;; name is handled by `c-simple-decl-matchers' or ;; `c-complex-decl-matchers' below. ,@(when (c-lang-const c-brace-id-list-kwds) `((,(c-make-font-lock-search-function (concat "\\<\\(" (c-make-keywords-re nil (c-lang-const c-brace-id-list-kwds)) "\\)\\>" ;; Disallow various common punctuation chars that can't come ;; before the '{' of the enum list, to avoid searching too far. "[^\]\[{}();,/#=]*" "{") '((c-font-lock-declarators limit t nil) (save-match-data (goto-char (match-end 0)) (c-put-char-property (1- (point)) 'c-type 'c-decl-id-start) (c-forward-syntactic-ws)) (goto-char (match-end 0))))))) I am reading up on lisp syntax to figure out what those things are and what to call them, but aside from that, how can I run edebug on the code that follows the comment that reads ;; Fontify the identifiers inside enum lists. ? I know how to run edebug on a defun - just invoke edebug-defun within the function's definition, and off I go. Is there a corresponding thing I need to do to edebug the cc-mode matcher code forms?

  Read the article

• functional, bind1st and mem_fun

  - by Neil G

  Why won't this compile? #include <functional> #include <boost/function.hpp> class A { A() { typedef boost::function<void ()> FunctionCall; FunctionCall f = std::bind1st(std::mem_fun(&A::process), this); } void process() {} }; Errors: In file included from /opt/local/include/gcc44/c++/bits/stl_function.h:712, from /opt/local/include/gcc44/c++/functional:50, from a.cc:1: /opt/local/include/gcc44/c++/backward/binders.h: In instantiation of 'std::binder1st<std::mem_fun_t<void, A> >': a.cc:7: instantiated from here /opt/local/include/gcc44/c++/backward/binders.h:100: error: no type named 'second_argument_type' in 'class std::mem_fun_t<void, A>' /opt/local/include/gcc44/c++/backward/binders.h:103: error: no type named 'first_argument_type' in 'class std::mem_fun_t<void, A>' /opt/local/include/gcc44/c++/backward/binders.h:106: error: no type named 'first_argument_type' in 'class std::mem_fun_t<void, A>' /opt/local/include/gcc44/c++/backward/binders.h:111: error: no type named 'second_argument_type' in 'class std::mem_fun_t<void, A>' /opt/local/include/gcc44/c++/backward/binders.h:117: error: no type named 'second_argument_type' in 'class std::mem_fun_t<void, A>' /opt/local/include/gcc44/c++/backward/binders.h: In function 'std::binder1st<_Operation> std::bind1st(const _Operation&, const _Tp&) [with _Operation = std::mem_fun_t<void, A>, _Tp = A*]': a.cc:7: instantiated from here /opt/local/include/gcc44/c++/backward/binders.h:126: error: no type named 'first_argument_type' in 'class std::mem_fun_t<void, A>' In file included from /opt/local/include/boost/function/detail/maybe_include.hpp:13, from /opt/local/include/boost/function/detail/function_iterate.hpp:14, from /opt/local/include/boost/preprocessor/iteration/detail/iter/forward1.hpp:47, from /opt/local/include/boost/function.hpp:64, from a.cc:2: /opt/local/include/boost/function/function_template.hpp: In static member function 'static void boost::detail::function::void_function_obj_invoker0<FunctionObj, R>::invoke(boost::detail::function::function_buffer&) [with FunctionObj = std::binder1st<std::mem_fun_t<void, A> >, R = void]': /opt/local/include/boost/function/function_template.hpp:913: instantiated from 'void boost::function0<R>::assign_to(Functor) [with Functor = std::binder1st<std::mem_fun_t<void, A> >, R = void]' /opt/local/include/boost/function/function_template.hpp:722: instantiated from 'boost::function0<R>::function0(Functor, typename boost::enable_if_c<boost::type_traits::ice_not::value, int>::type) [with Functor = std::binder1st<std::mem_fun_t<void, A> >, R = void]' /opt/local/include/boost/function/function_template.hpp:1064: instantiated from 'boost::function<R()>::function(Functor, typename boost::enable_if_c<boost::type_traits::ice_not::value, int>::type) [with Functor = std::binder1st<std::mem_fun_t<void, A> >, R = void]' a.cc:7: instantiated from here /opt/local/include/boost/function/function_template.hpp:153: error: no match for call to '(std::binder1st<std::mem_fun_t<void, A> >) ()'

  Read the article

• My winform application doesn't work on others' pc without vs 2010 installed

  - by wings

  Just like I said, my winform application works properly on computers with VS installed, but on other computers, it will crash due to a FileNotFound Exception. I used using Application = Microsoft.Office.Interop.Excel.Application; in my source code to generate a Excel file, and the problem occurs as soon as the Excel-related function is called. But I don't know what it refers to exactly. Do I have to get some .dll included along with the .exe file? And what DLL is that? Below are part of my codes: private void FileExport(object objTable) { StartWaiting(); string[,] table = null; try { table = (string[,])objTable; } catch (Exception ex) { ShowStatus(ex.Message, StatusType.Warning); } if (table == null) { return; } Application excelApp = new Application { DisplayAlerts = false }; Workbooks workbooks = excelApp.Workbooks; Workbook workbook = workbooks.Add(XlWBATemplate.xlWBATWorksheet); Worksheet worksheet = (Worksheet)workbook.Worksheets[1]; worksheet.Name = "TABLE"; for (int i = 0; i < table.GetLength(0); i++) { for (int j = 0; j < table.GetLength(1); j++) { worksheet.Cells[i + 1, j + 1] = table[i, j]; } } Range range = excelApp.Range["A1", "H1"]; range.Merge(); range.Font.Bold = true; range.Font.Size = 15; range.RowHeight = 50; range.EntireRow.AutoFit(); range = excelApp.Range["A2", "H8"]; range.Font.Size = 11; range = excelApp.Range["A1", "H8"]; range.NumberFormatLocal = "@"; range.RowHeight = 300; range.ColumnWidth = 50; range.HorizontalAlignment = XlHAlign.xlHAlignCenter; range.VerticalAlignment = XlVAlign.xlVAlignCenter; range.EntireRow.AutoFit(); range.EntireColumn.AutoFit(); worksheet.UsedRange.Borders.LineStyle = 1; Invoke(new MainThreadInvokerDelegate(SaveAs), new object[] { worksheet, workbook, excelApp } ); EndWaiting(); }

  Read the article

< Previous Page | 337 338 339 340 341 342 343 344 345 346 347 348  | Next Page >