Search Results

Search found 20484 results on 820 pages for 'small projects'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 342/820 | < Previous Page | 338 339 340 341 342 343 344 345 346 347 348 349  | Next Page >

  • Histogram in Matplotlib with input file

    - by Arkapravo
    I wish to make a Histogram in Matplotlib from an input file containing the raw data (.txt). I am facing issues in referring to the input file. I guess it should be a rather small program. Any Matplotlib gurus, any help ? I am not asking for the code, some inputs should put me on the right way !

    Read the article

  • Amazon Web Services Apache Server

    - by Samnsparky
    I am trying to get a feel for the costs imposed by running apache on AWS continually. Assuming that the service is scarcely used, does anyone know how many cpu hours that would eat up in a month just by sitting there and running? I understand that this is slightly impractical but I am trying to figure out what the cost of entry is to deploy an application on this platform (as compared to GAE). I suspect it to be small but I would like to know.

    Read the article

  • Where are global settings stored?

    - by Philipp
    Hi, sometimes after logging out and in again, my settings in Tools/Options/Projects and Solutions/VC++ Directories are lost. To investigate the problem I tried to find the file where Visual Studio (2008 Team) stores those settings on disk. (Or is it in the registry?) Can anybody point me to where it is? Thanks a lot!

    Read the article

  • Object of type "X" cannot be converted to object of type "X"

    - by Benjol
    (Can't believe this hasn't already been asked, but I can't find a dup) In Visual Studio with lots of projects, when I first open the solution, I sometimes get the warning Object of type "X" cannot be converted to object of type "X". Generally rebuilding seems to make it go away, but does anyone know what this is caused by, and how to avoid it? UPDATE I read somewhere that deleting all your resx files and rebuilding can help. I unthinkingly tried this. Not a good idea...

    Read the article

  • .NET / WPF Alternative

    - by eWolf
    I know the .NET framework and WPF pretty well, but I think the whole thing has gotten too blown up, especially for small apps as the whole .NET framework 3.5 weighs 197 MB by now. I am looking for a language/framework/library that provides functionality similar to that of WPF (animations, gradients, a.s.o.) and the .NET framework (of course not everything, but the basic features) and which is faster and more lightweight than the .NET framework and creates smaller and faster applications than the ones using .NET. Do you have any suggestions?

    Read the article

  • how do you create a simple obejctice-c command line project in xcode

    - by Mark
    im moving from a c# VS2008 world into the mac world and I just wanted to know how I can create a quick little command line based application so that I can write many little objective-c apps without worrying about creating an iPhone app or whatever. Which projects do I create in xcode? I can see the Command Line Tool under "Mac os x" but the only options for the type is "C", "C++", "Core Data", "Core Foundation", "Core Services" and "Foundation" but no simple objective c project? Thanks

    Read the article

  • Looking for a target that works like "_CopyWebApplication" but for console apps

    - by Rihan Meij
    Hi We all ready have build scripts that creates our web application folders very nicely. We create multiple folders for each environment, and then change the configs in those folders according to the environment. How can we get the same results as what _CopyWebApplication does? Example: <MSBuild Projects="$(SourceCodeCheckoutFolder)\source\UI\$(ProjectName)\$(ProjectName).csproj" Targets="ResolveReferences; ResolveProjectReferences; _CopyWebApplication" ToolsVersion="3.5" StopOnFirstFailure="False" RunEachTargetSeparately="False" </MSBuild

    Read the article

  • How to Include an xml file from a silverlight class library into the xap file.

    - by cmaduro
    I have a certain config.xml file in one of my projects (Silverlight class library) in a folder in the solution. It's build action is set to content. In that same project I am trying to load the xml file by saying: XDocument xml = XDocument.Load("/config.xml"); This unfortunately is not working. Upon inspecting the xap file, I see that the xml file is not being copied to it. I am using Visual Studio 2010 RC.

    Read the article

  • virtualenvwrapper .hook problem

    - by Wraith
    I've used virtualenvwrapper, but I'm having problems running it on a new computer. My .bashrc file is updated per the instructions: export WORKON_HOME=$DEV_HOME/projects source /usr/local/bin/virtualenvwrapper.sh But when source is run, I get the following: bash: /25009.hook: Permission denied bash: /25009.hook: No such file or directory This previous post leads me to believe the filename is being recycled and locked because virtualenvwrapper.sh uses $$. Is there any way to fix this?

    Read the article

  • Multicore programming: what's necessary to do it?

    - by Casey
    I have a quadcore processor and I would really like to take advantage of all those cores when I'm running quick simulations. The problem is I'm only familiar with the small Linux cluster we have in the lab and I'm using Vista at home. What sort of things do I want to look into for multicore programming with C or Java? What is the lingo that I want to google? Thanks for the help.

    Read the article

  • How a programmer should motivate himself ?

    - by Indigo Praveen
    Hi All, The question came into my mind because from last 2-3 months I am feeling a kind of bored in my job. Actually there is nothing happening in the project, I just have to create some class , properties and some small routines to do some functionality. I hope you guys must have gone through this phase as well in your career. Please share your experience how did you motivate yourself in this kind of situation ?

    Read the article

  • Why is a c++ reference considered safer than a pointer?

    - by anand.arumug
    When the c++ compiler generates very similar assembler code for a reference and pointer, why is using references preferred (and considered safer) compared to pointers? I did see Difference between pointer variable and reference variable in C++ which discusses the differences between them. EDIT-1: I was looking at the assembler code generated by g++ for this small program: int main(int argc, char* argv[]) { int a; int &ra = a; int *pa = &a; }

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Documentation on System.Deployment

    - by krisnam
    I have a Win Application which is publish using ClickOnce deployment (go though VS IDE). I want to develop another small application (Web) to do this deployment process without going though VS IDE. I heard about System.Deployment and Microsoft.Build.BuildEngine name spaces. But I count find good doc to solve my problem. If you have one please send me any references.

    Read the article

  • Source control system for single developer

    - by kaiz.net
    What's the recommended source control system for a very small team (one developer)? Price does not matter. Customer would pay :-) I'm working on Vista32 with VS 2008 in C++ and later in C# and with WPF. Setting up an extra (physical) server for this seems overkill to me. Any opinions?

    Read the article

  • How can I disable mouse click event system wide using C#?

    - by mazzzzz
    Hey guys, I have a laptop with a very sensitive touch pad, and wanted to code a small program that could block the mouse input when I was typing a paper or something. I didn't think it would be hard to do, considering everything I've seen on low-level hooks, but I was wrong (astounding, right?). I looked at a few examples, but the examples I've seen either block both keyboard and mouse, or just hide the mouse. Any help with this would be great.

    Read the article

  • How to export each open project in Eclipse as its own JAR?

    - by Freiheit
    I have several projects open in an Eclipse workspace. Like so: com.harbl.project.one com.harbl.project.two com.harbl.project.three I would like to export those as JARs in a batch such that I wind up with the following JAR files: ./com.harbl.project.one.jar ./com.harbl.project.two.jar ./com.harbl.project.three.jar Is this possible with one of the Eclipse wizards or working sets? Is my only option to export each one individually?

    Read the article

  • How do you set the default source for the Output window in Visual Studio?

    - by Grank
    We added a SharePoint BDC model project to a solution in Visual Studio 2010. Ever since, whenever the solution is built, instead of showing the Build output in the Output window, it insists on having "SharePoint Tools" selected in the "Show Output from:" drop-down, just to say "Model validation started ... Model validation completed with no errors." Short of shutting off any SharePoint projects in the build configuration, can this behavior be overridden?

    Read the article

  • CSS: What is the proper way to deal with multiple classes of Text

    - by DavidR
    So I'm on commission for a website, and I'm trying to improve my code. When dealing with a website with multiple types of font (here it's large, there it's small, there it's bold, here it's underlined, etc.) is this where we use the h1-h6, or do we reserve those for times when there is a definite hierarchy, using instead <p class="xxx"> to define different classes for text?

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 338 339 340 341 342 343 344 345 346 347 348 349  | Next Page >