Search Results

Search found 26908 results on 1077 pages for 'asynchronous wcf call'.

Page 343/1077 | < Previous Page | 339 340 341 342 343 344 345 346 347 348 349 350  | Next Page >

  • Calling unmanaged c++ code in C# Mixed with STL

    - by Turtle
    Hey, I want to call unmanaged c++ code in C# The function interface is like following(I simplified it to make it easy to understand) Face genMesh(int param1, int param2); Face is a struct defined as: struct Face{ vector<float> nodes; vector<int> indexs; } I googled and read the MSDN docs found ways to call simple c/c++ unmanged code in C#, also know how to hand the struct as return value. And My question is how to handle "vector". I did not find rules about mapping between vector and some types in C# Thanks!

    Read the article

  • Problems crossing the boundary between protected greasemonkey execution space and the unsafeWindow l

    - by Chilly
    Hi guys. Here is my problem: I've registered some callbacks into a Yahoo event driven webpage (betfair.com market views) and am trapping the betsPlaced events with a handler. So far so simple. Next stage is to get the event back into greasemonkey land, and while I know that from greasemoney space you can call unsafeWindow.stuff, there is no reverse operation (by design). So if I want to send the contents of the event over, say, a cometd queue, my carefully set up jquery, greasemonkey, YUI2, betfair environment fails by telling me that unsafeWindow processes cant call GM_ajax stuff. This is obviously safe and sane, but it basically stops me doing what I want to do. Has anyone tried doing this (ignore the cometd stuff, just general ajax calls) and succeeded? I've had a look at pages like this: http://wiki.greasespot.net/0.7.20080121.0%2B_compatibility but it doesnt appear to work for all the calls.

    Read the article

  • Assign an existing click event function to another click event using jquery

    - by Peter Delahunty
    Ok so i have some html like this: <div id="navigation"> <ul> <li> <a>tab name</a> <span class="delete-tab">X</span> </li> <li> <a>tab name</a> <span class="delete-tab">X</span> </li> <li> <a>tab name</a> <span class="delete-tab">X</span> </li> <li class="selected"> <a>tab name</a> <span class="tab-del-btn">X</span> </li> </ul> </div> I then have javascript that is excuted on the page that i do not control (this is in liferay portal). I want to then manipulate things afterwards with my own custom javascript. SO... For each of the span.delete-tab elements an on-click event function has been assign earlier. It is the same function call for each span. I want to take that function (any) and call it from the click event of the span.tab-del-btn ? This is what i tried to do: var navigation = jQuery('#navigation'); var navTabs = navigation.find('.delete-tab'); var existingDeleteFunction = null; navTabs.each(function (i){ var tab = jQuery(this); existingDeleteFunction = tab.click; }); var selectedTab = jQuery('#navigation li.selected'); var deleteBtn = selectedTab.find('.tab-del-btn'); deleteBtn.click(function(event){ existingDeleteFunction.call(this); }); It does not work though. existingDeleteFunction is not the original function it is some jquery default function. Any ideas?

    Read the article

  • Can someone describe some DI terms to me?

    - by SoBeNoFear
    I'm in the process of writing a DI framework for PHP 5, and I've been trying to find the 'official' definitions of some words in relation to dependency injection. Some of these words are 'context' and 'lifecycle'. And also, what would I call the object that gets created/injected? Finally, what is the difference between components and services, and which term (if either) should I call the objects that can be injected? I've read Martin Fowler's article and looked through other DI frameworks (Phemto, Spring, Google Guice, Xyster, etc.), but I want to know what you think. Thanks!

    Read the article

  • GCC/XCode equivalent of _CrtCheckMemory?

    - by Chris Becke
    When dealing with random memory overwrites, in MSVC it is possible to validate the state of the heap at various points with a call to _CrtCheckMemory, and know with at least a small level of confidence that the code up until the check was not responsible for any errors that might cause new or malloc to fail later. In XCode, whats the equivalent way to try and box in a memory overwrite? All I have at the moment is a random failure of a call to new, somewhere deep in the bowels of some code with no real idea of how long the code has been running with a corrupt heap up until that point.

    Read the article

  • Driver Problem in Sybase

    - by nitinkhanna
    Hi, I am working on XP m\c and right now I don't have sybase install. But My server has the sybase 12.5 (that much I only know). I am using web service to talk to that server. How can I call the data from that server, For this I am using a webservice which has some web methods that are using specific connection string. Right now I am using ODBC connection string for that. I want to know do I need to install SYbase clinet at my m/c to call server data. OR else How shouls I proceed, Thaks

    Read the article

  • Java SOAP WSDL 1.1 message sending all the parameters (even future ones)

    - by Eduardo
    I have to communicate with a SOAP Web Service defined in a WSDL 1.1. All the parameters are optional in the WSDL like: <xsd:element name="Submitter" type="xsd:string"/> but if I do not send them I get an error because the parameter was not sent, so instead I have to send an empty string for any parameter I do not intent to send. So instead of not sending the element I have to send: <Submitter></Submitter> The problem is that the WebService publisher does not have any problem adding new parameters at any point in time but I must sent at least an empty string for all the parameters. How may I call this WebService in Java so every time I call the WebService the WSDL is read so that all the parameters are sent having the parameters I care for are actually filled with the data I provide? I am currently using Apache CXF but I am open to anything to solve this problem.

    Read the article

  • Why are all response bodies after the first blank in Cucumber?

    - by James A. Rosen
    I'm using Cucumber (0.6.3), Cucumber-Rails (0.3.0), Webrat (0.7.0), and Rails (2.3.5) for some tests. The following scenario passes just fine: Scenario: load one page Given I am on the home page Then I should see "Welcome" The following, however, fails: Scenario: load two pages Given I am on the FAQ pag When I go to the home page Then I should see "Welcome" The problem is that the second @response.body is blank. I added a Rack middleware to get a little more information: class LogEachRequest def initialize(app); @app = app; @count = 0; end def call(env) puts "Processing request # #{@count += 1)" @app.call(env) end end It shows me only one request processed. That is, it only ever prints out Processing request # 1

    Read the article

  • Jquery $.post and PHP - Prevent the ability to use script outside of main website.

    - by Tim
    I have a PHP script setup using Jquery $.post which would return a response or do an action within the targeted .php file within $.post. Eg. My page has a form where you type in your Name. Once you hit the submit form button, $.post is called and sends the entered Name field value into "mywebsite.xyz/folder/ajaxscript.php" If a user was to visit "mywebsite.xyz/folder/ajaxscript.php" directly and somehow POST the data to the script, the script would return a response / do an action, based on the submitted POST data. The problem is, I don't want others to be able to periodically "call" an action or request a response from my website without using the website directly. Theoretically, right now you could determine what Name values my website allows without even visiting it, or you could call an action without going through the website, by simply visiting "mywebsite.xyz/folder/ajaxscript.php" So, what measures can I take to prevent this from happening? So far my idea is to ensure that it is a $_POST and not a $_GET - so they cannot manually enter it into the browser, but they could still post data to the script... Another measure is to apply a session key that expires, and is only valid for X amount of visits until they revisit the website. ~ Or, just have a daily "code" that changes and they'd need to grab this code from the website each day to keep their direct access to the script working (eg. I pass the daily "code" into each post request. I then check that code matches in the ajax php script.) However, even with these meaures, they will STILL have access to the scripts so long as they know how to POST the data, and also get the new code each day. Also, having a daily code requirement will cause issues when visiting the site at midnight (12:00am) as the code will change and the script will break for someone who is on the website trying to call the script, with the invalid code being passed still. I have attempted using .htaccess however using: order allow,deny deny from all Prevents legitimate access, and I'd have to add an exception so the website's IP is allowed to access it.. which is a hassle to update I think. Although, if it's the only legitimate solution I guess I'll have to. If I need to be more clear please let me know.

    Read the article

  • How to return a value when destroying/cleaning-up an object instance

    - by Mridang Agarwalla
    When I initiate a class in Python, I give it some values. I then call method in the class which does something. Here's a snippet: class TestClass(): def __init__(self): self.counter = 0 def doSomething(self): self.counter = self.counter + 1 print 'Hiya' if __name__ == "__main__": obj = TestClass() obj.doSomething() obj.doSomething() obj.doSomething() print obj.counter As you can see, everytime I call the doSomething method, it prints some text and increments an internal variable i.e. counter. When I initiate the class, i set the counter variable to 0. When I destroy the object, I'd like to return the internal counter variable. What would be a good way of doing this? I wanted to know if there were other ways apart from doing stuff like: accessing the variable directly. Like obj.counter. creating a method like getCounter. Thanks.

    Read the article

  • Jquery Delay Function Calls

    - by fizgig07
    I'm trying to find a way to delay all code that takes place after I make a service call. The reason for this delay is that my service returns code necesarry for the following functions and the result I pass is to these following functions is undefined. I have tried attaching the setTimeout() to the function that is called directly after the service call, but then it just skips the function I set the timeout on and jumps to the next function...My web method that I am calling is not that big and is not doing anything that is too intensive public bool GetSpreadsheetStatusForAdmin(string cacId) { SpreadSheetStatus result = new SpreadSheetStatus(); List<Data.Spreadsheet> spreadsheets = SpreadsheetManager.GetUserSpreadsheets(GetCurrent.Identity); if (spreadsheets.Count != 0) { foreach (Data.Spreadsheet spreadsheet in spreadsheets) { if (spreadsheet.Status == SpreadsheetStatus.Pending) { return true; } } } return false; } I had found the delay() and thought that might work, but I don't have jquery 1.4 and can't use it as of yet. is there anything that can help..?

    Read the article

  • calling a method on the parent page from a user control

    - by Kyle
    I am using a user control that I created (just a .cs file not an .ascx file), that does some magic and depending on a value generated by the control, I need it to do something on the parent page that is 'hosting' the control. It needs to call a method under certain circumstances (method is on the parent control). the control is placed on the parent page like so: <customtag:MyControl ID="something" runat="server" /> I'm dynamically creating buttons etc on the control itself but when a button is clicked, let's say for example that there's a text box on the control and if the value of the textbox is "bob" it needs to call a method on the page that's housing the control...how can I accomplish this?

    Read the article

  • Using jep.invoke() method

    - by hofsoc
    Hi, I need to call a function from a python script and pass in parameters into it. I have a test python script which I can call and run from java using Jepp - this then adds the person. Eg Test.py import Finding from Finding import * f = Finding() f.addFinding("John", "Doe", 27) Within my Finding class I have addFinding(firstname, lastName, age) However, I wish to be able to do this from within java. Should I be using the jep.invoke() method. Does anyone have a hello world example of such a thing being done or forward me to some good examples? Does anyone have any suggestions please? Thanks in advance

    Read the article

  • What's the best way to run a process remotely with capturing the output ?

    - by Homam
    Hi all, I have a windows service responsible for running processes on a remote machine with capturing the output, I googled for that and read a lot of articles and threads, I found two ways: 1) using WMI for call the remote process like this example: http://www.codeproject.com/KB/cs/EverythingInWmi02.aspx 2) using the PsExec tool by System.Diagnostic.Process class ever way of these has many problems, the WMI doesn't support returning the output and doesn't support "WaitingToExit" It just call the process and return the PId, and the PsExec couldn't capture the output programmatically by System.Diagnostic.Process in a clear way, I found only workarounds like redirect the output to a file then read the redirected file..etc, I need a real solution please

    Read the article

  • Problem of using cin twice.

    - by gc
    Here is the code: string str; cinstr; cout<<"first input:"<<str<<endl; getline(cin, str); cout<<"line input:"<<str<<endl; The result is that getline never pauses for user input, therefore the second output is always empty. After spending some time on it, I realized after the first call "cinstr", it seems '\n' is still stored in cin (using cin.peek() to check), which ends getline immediately. The solution will be adding one more line between the first usage and the second one: cin.ignore(numeric_limits::max(), '\n'); However, I still don't understand, why is '\n' left there after the first call? What does istream& operator really do?

    Read the article

  • c#, Internal, and Reflection

    - by cyberconte
    Duplicate of: Accessing internal members via System.Reflection? Is there a way to execute "internal" code via reflection? Here is an example program: using System; using System.Reflection; namespace ReflectionInternalTest { class Program { static void Main(string[] args) { Assembly asm = Assembly.GetExecutingAssembly(); // Call normally new TestClass(); // Call with Reflection asm.CreateInstance("ReflectionInternalTest.TestClass", false, BindingFlags.Default | BindingFlags.CreateInstance, null, null, null, null); // Pause Console.ReadLine(); } } class TestClass { internal TestClass() { Console.WriteLine("Test class instantiated"); } } } Creating a testclass normally works perfectly, however when i try to create an instance via reflection, I get a missingMethodException error saying it can't find the Constructor (which is what would happen if you tried calling it from outside the assembly). Is this impossible, or is there some workaround i can do?

    Read the article

  • rails error on create action

    - by ash34
    SQL (2.0ms) SELECT task_report_requests_seq.NEXTVAL id FROM dual TaskReportRequest Create (2.2ms) INSERT INTO task_report_requests (location, created_at, updated_at, id, freq, login, task_dt) VALUES('020', TO_DATE('2010-05-25 05:02:38','YYYY-MM-DD HH24:MI:SS'), TO_DATE('2010-05-25 05:02:38','YYYY-MM-DD HH24:MI:SS'), 10023, 'M', NULL, TO_DATE('2010-05-30 00:00:00','YYYY-MM-DD HH24:MI:SS')) NoMethodError (You have a nil object when you didn't expect it! The error occurred while evaluating nil.call): app/controllers/task_report_requests_controller.rb:45:in `create' It says error evaluating nil.call . Can someone tell me when I would get such an error. I am not able to figure out with this information. thanks, ash

    Read the article

  • Static source code analysis with LLVM

    - by Phong
    I recently discover the LLVM (low level virtual machine) project, and from what I have heard It can be used to performed static analysis on a source code. I would like to know if it is possible to extract the different function call through function pointer (find the caller function and the callee function) in a program. I could find the kind of information in the website so it would be really helpful if you could tell me if such an library already exist in LLVM or can you point me to the good direction on how to build it myself (existing source code, reference, tutorial, example...). EDIT: With my analysis I actually want to extract caller/callee function call. In the case of a function pointer, I would like to return a set of possible callee. both caller and callee must be define in the source code (this does not include third party function in a library).

    Read the article

  • Singletons and other design issues

    - by Ahmed Saleh
    I have worked using different languages like C++/Java and currently AS3. Most applications were computer vision, and small 2D computer games. Most companies that I have worked for, they use Singletons in a language like AS3, to retrieve elements or classes in an easy way. Their problem is basically they needs some variables or to call other functions from other classes. In a language like AS3, there is no private constructor, and they write a hacky code to prevent new instances. In Java and C++ I also faced the situation that I need to use other classe's members or to call their functions in different classes. The question is, is there a better or another design, to let other classes interact with each others without using singletons? I feel that composition is the answer, but I need more detailed solutions or design suggestions.

    Read the article

  • user notification while waiting

    - by user315445
    I am writing a simple win forms app in C#. There is a method call in my method which loads files but is taking a while to respond. Below is the method call Directory.GetFiles(selectedFolder, "*.xml", SearchOption.AllDirectories); I want to notify this to users. Is there a way to show them that file loading is in progress? I want a simplest way. I suppose Splash screen is too costly for my app.

    Read the article

  • How can I receive messages using C# over http without MSMQ

    - by pduncan
    I need a reliable messaging framework that runs over http/https (due to client security requirements) and that doesn't use MSMQ (because some clients will use Windows XP Home). The clients only need to be able to receive messages, not send them. We already have a message queue on the server for each user, and the receivers have been getting messages by connecting to an HttpHandler on the server and getting a Stream from WebResponse.GetResponseStream() We keep this stream open, and pull messages off of it using Stream.Read(). This MOSTLY works, but Stream.Read() is a blocking call, and we can't reliably interrupt it. We need to be able to stop and start the receiver without losing messages, but the old stream often hangs around, even after we call Thread.Abort on its thread. Any suggestions?

    Read the article

  • How to access a function inside a function? Python

    - by viddhart
    I am wondering how I can access a function inside another function. I saw code like this: >>> def make_adder(x): def adder(y): return x+y return adder >>> a = make_adder(5) >>> a(10) 15 So, is there another way to call the adder function? And my second question is why in the last line I call adder not adder(...)? Good explanations are much appreciated.

    Read the article

  • Perform Push Segue From a Tab View Controller

    - by user1416492
    I have a Tab Bar Controller App, the tab bar controller is forked into several "tab" view controller, in one of the view controller I want to redirect the user to an other view controller. I create a segue from that tab view controller to the destination view controller and given it an Identifer. And I call "performSegueWithIdentifier" in "viewDidAppear" to redirect the user. It works fine when the segue is "Modal", however since I want to retain the tabs, I want to call the segue through "Push". However, once I change the segue to "Push", it is not working anymore (it does not try to go to the destination view controller). The app did not crash on the simulator but just staying on the origin tab view controller.

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Windows Phone 7 HttpRequest Unable to see true Error Code and response details

    - by Bob
    I have to call a somewhat broken API from a Windows Phone 7 application. The API returns a 302 error and a cookie to the authentication request. I've tried every way I've been able to find in the MSDN documentation for using ClientHTTP instead of BrowserHTTP (registering the prefix, using the call to explicitly create a ClientHTTP using Request), but the 302 is getting translated to a 404 and I'm not seeing the cookies on the response. I've tried a WebClient, I've tried an HttpRequest and it is always the translated error message. If I allocate a CookieContainer for the HttpRequest, I get a null argument exception when the client stack is parsing the returned message. I can see that the response is coming back as expected via Fiddler.

    Read the article

< Previous Page | 339 340 341 342 343 344 345 346 347 348 349 350  | Next Page >