Search Results

Search found 27946 results on 1118 pages for 'output buffer empty'.

Page 343/1118 | < Previous Page | 339 340 341 342 343 344 345 346 347 348 349 350  | Next Page >

  • add two float values in java

    - by user1845286
    acually i try to add two float values in java like this import java.text.DecimalFormat; class ExactDecimalValue { final strictfp static public void main(String... arg) { float f1=123.00000f; float f2=124.00000f; float f3=f1+f2; System.out.println(f1+f2); System.out.println("sum of two floats:"+f3); /*my expected output is:247.00000 but comming output is:247.0 and 247*/ } } Now what i can do to get the value in this format:247.00000. please any one help me. Thanks & Regards venkatesh

    Read the article

  • Retrieving data from simplexml_load_file

    - by Kole Odd
    Working with the simplexml_load_file() function, I get a side effect. To understand what I mean, see this code: $result = simplexml_load_file($xml_link); $arr = array(); foreach ($result->element as $elem) { $arr[] = $elem->number[0]; } print_r($arr); Output: Array ( [0] => SimpleXMLElement Object ( [0] => 330411879136 ) [1] => SimpleXMLElement Object ( [0] => 370346266228 ) [2] => SimpleXMLElement Object ( [0] => 370346266223 ) ) How would I store data into the array so that output would look like so: Array ( [0] => 330411879136 [1] => 370346266228 [2] => 370346266223 )

    Read the article

  • How to access controls collection of dynamically loaded aspx page?

    - by Naasir
    Let's say I have two webforms, A.aspx and B.aspx, where B.aspx contains some simple web controls such as a textbox and a button. I'm trying to do the following: When A.aspx is requested, I want to dynamically call and load B.aspx into memory and output details of all the controls contained in B.aspx. Here is what I tried in the codebehind for A.aspx: var compiledType = BuildManager.GetCompiledType("~/b.aspx"); if (compiledType != null) { var pageB = (Page)Activator.CreateInstance(compiledType); } foreach (var control in pageB.Controls) { //output some details for each control, like it's name and type... } When I try the code above, the controls collection for pageB is always empty. Any ideas on how I can get this to work? Some other important details: both webforms utilize a master page (so the web controls in b.aspx are actually placed within a "content" tag) I've also tried using BuildManager.CreateInstanceFromVirtualPath. No luck.

    Read the article

  • PHPMailer echo's from successful sent email

    - by Chris
    Hello I finally got PHPMailer to work with Google but now I am finding out that I am getting this output to the screen after the message has been sent. SMTP -> FROM SERVER:220 mx.google.com ESMTP f34sm21891943qco.35 SMTP -> FROM SERVER: 250-mx.google.com at your service, [76.28.109.170] 250-SIZE 35651584 250-8BITMIME 250-AUTH LOGIN PLAIN XOAUTH 250 ENHANCEDSTATUSCODES SMTP -> FROM SERVER:250 2.1.0 OK f34sm21891943qco.35 SMTP -> FROM SERVER:250 2.1.5 OK f34sm21891943qco.35 SMTP -> FROM SERVER:354 Go ahead f34sm21891943qco.35 SMTP -> FROM SERVER:250 2.0.0 OK 1276700936 f34sm21891943qco.35 I was wondering if there was any way to remove this output so the users don't see it?

    Read the article

  • how to find and add a string to a file in linux

    - by user2951644
    How can I check a file for a string if missing the string automatically add it for example Input Input file test.txt this is a test text for testing purpose this is a test for testing purpose this is a test for testing purpose this is a test text for testing purpose I would like to add "text" to all the lines Desired Output this is a test text for testing purpose this is a test text for testing purpose this is a test text for testing purpose this is a test text for testing purpose Is it possible? many thanks in advance Hi guys thanks for all the help, for my case is not that simple. I wont know which line will be different and in the middle string it will not only have a single string. i will give a clearer case Input file test.txt Group: IT_DEPT,VIP Role: Viewer Dept: IT Group: IT_DEPT,VIP Dept: IT Group: FINANCE LOAN VIEWER Role: Viewer Dept: FINANCE Group: FINANCE LOAN VIEWER Dept: FINANCE Desired output file test2.txt Group: IT_DEPT,VIP Role: Viewer Dept: IT Group: IT_DEPT,VIP Role: - Dept: IT Group: FINANCE LOAN VIEWER Role: Viewer Dept: FINANCE Group: FINANCE LOAN VIEWER Role: - Dept: FINANCE So those that are missing "Role:" will be added "Role: - ", hope this clear things out, thanks in advance again

    Read the article

  • Get return values from a stored procedure in c# (login process)

    - by Jin
    Hi all, I am trying to use a Stored Procedure which takes two parameters (login, pw) and returns the user info. If I execute the SP manually, I get Session_UID User_Group_Name Sys_User_Name ------------------------------------ -------------------------------------------------- - NULL Administrators NTMSAdmin No rows affected. (1 row(s) returned) @RETURN_VALUE = 0 Finished running [dbo].[p_SYS_Login]. But with the code below, I only get the return value. do you know how to get the other values shown above like Session_UID, User_Group_Name, and Sys_User_Name ? if you see the commented part below code. I tried to add some output parameters but it doesn't work with incorrect number of parameters error. string strConnection = Settings.Default.ConnectionString; using (SqlConnection conn = new SqlConnection(strConnection)) { using (SqlCommand cmd = new SqlCommand()) { SqlDataReader rdr = null; cmd.Connection = conn; cmd.CommandText = "p_SYS_Login"; //cmd.CommandText = "p_sys_Select_User_Group"; cmd.CommandType = CommandType.StoredProcedure; SqlParameter paramReturnValue = new SqlParameter(); paramReturnValue.ParameterName = "@RETURN_VALUE"; paramReturnValue.SqlDbType = SqlDbType.Int; paramReturnValue.SourceColumn = null; paramReturnValue.Direction = ParameterDirection.ReturnValue; //SqlParameter paramGroupName = new SqlParameter("@User_Group_Name", SqlDbType.VarChar, 50); //paramGroupName.Direction = ParameterDirection.Output; //SqlParameter paramUserName = new SqlParameter("@Sys_User_Name", SqlDbType.VarChar, 50); //paramUserName.Direction = ParameterDirection.Output; cmd.Parameters.Add(paramReturnValue); //cmd.Parameters.Add(paramGroupName); //cmd.Parameters.Add(paramUserName); cmd.Parameters.AddWithValue("@Sys_Login", textUserID.Text); cmd.Parameters.AddWithValue("@Sys_Password", textPassword.Text); try { conn.Open(); object result = cmd.ExecuteNonQuery(); int returnValue = (int)cmd.Parameters["@RETURN_VALUE"].Value; if (returnValue == 0) { Hide(); Program.MapForm.Show(); } else if (returnValue == 1) { MessageBox.Show("The username or password you entered is incorrect", "NTMS Login", MessageBoxButtons.OK, MessageBoxIcon.Warning); } else if (returnValue == 2) { MessageBox.Show("This account is disabled", "NTMS Login", MessageBoxButtons.OK, MessageBoxIcon.Warning); } else { MessageBox.Show("Database error. Please contact administrator", "NTMS Login", MessageBoxButtons.OK, MessageBoxIcon.Warning); } } catch (Exception ex) { string message = ex.Message; string caption = "MAVIS Exception"; MessageBoxButtons buttons = MessageBoxButtons.OK; MessageBox.Show( message, caption, buttons, MessageBoxIcon.Warning, MessageBoxDefaultButton.Button1); } } } Thanks for your help.

    Read the article

  • Python structure mistake

    - by jaddy123
    I'm writing a program in which I can Reverse the sequence and Replace all As with Ts, all Cs with Gs, all Gs with Cs, and all Ts with As. the program is to read a sequence of bases and output the reverse complement sequence. I am having trouble to do it so can anyone please help me with this by having a look on my code: word = raw_input("Enter sequence: ") a = word.replace('A', 'T') b = word.replace('C', 'G') c = word.replace('G', 'C') d = word.replace('T', 'A') if a == word and b == word and c == word and d == word: print "Reverse complement sequence: ", word And I want this sort of output: Enter sequence: CGGTGATGCAAGG Reverse complement sequence: CCTTGCATCACCG Regards

    Read the article

  • Firing events in script task

    - by Anonymouslemming
    I've got an SSIS project where I am constructing an SQL command based on some variables. I'm constructing the command in a script task, and want to output the constructed SQL to the 'Execution Results' window. I am trying to do this using a FireInformation line from inside my script as follows: Dts.Events.FireInformation(99, "test", "Make this event appear!", "", 0, true); However, in the script editor when editing ScriptMain.cs, that line is underlined in red, and on mouseover, I get the following message: Error: The best overloaded method match for 'Microsoft.SqlServer.Dts.Tasks.ScriptTask.EventsObjectWrapper.FireInformation(int, string, string, string, int, ref bool') has some invalid arguments As a result, my script does not compile and I cannot execute it. Any idea what I'm doing wrong here, or what I need to change to be able to see the values of my variables at this point in the Execution output?

    Read the article

  • t-sql getting leaf nodes

    - by stackoverflowuser
    Based on following table (I have kept spaces between the rows for clarity) Path ----------- \node1\node2\node3 \node1\node2\node3\node5 \node1\node6\node3 \node1\node4\node3 \node1\node4\node3\node7 \node1\node4\node3\node8 \node1\node4\node3\node9 \node1\node4\node3\node9\node10 I want to get all the paths containing leaf node. So for instance, following will be considered leaf nodes for path \node1\node4\node3 \node1\node4\node3\node7 \node1\node4\node3\node8 \node1\node4\node3\node9\node10 The following will be the output: Output --------------------------- \node1\node2\node3\node5 \node1\node6\node3 \node1\node4\node3\node7 \node1\node4\node3\node8 \node1\node4\node3\node9\node10 Pls. suggest. Thanks.

    Read the article

  • ruby confusing -- local variable or instance_method ?

    - by boblu
    I have the following program. module C def self.included(base) base.extend(ClassMethods) end module ClassMethods def test_for class_eval <<-DEFINECLASSMETHODS def self.my_method(param_a) puts "SELF is: #{self.inspect}" puts param_a puts "#{param_a}" end DEFINECLASSMETHODS end end end class A include C end class B < A test_for end when I run B.new.my_method("aaa"), I got this error NameError: undefined local variable or method `param_a' for B:Class I am quite confused. I define param_a as a local variable in class method my_method, puts param_a runs good, and will output the "aaa". however, puts "#{param_a}" output that error. why? Can anyone explain this?

    Read the article

  • calling java class file through windows service in .net

    - by Kaumadee Wijewantha
    i have creared windows service from C# for calling java class file. i have used bat file to call this java file in C#. the task of the java class is create output file. but the when stated the service output file wasnt created. java class is worked perfeclty with out servise when it invoke from bat file. (but may task manger shows instantiates of command prompt.) is it possible to call java class through bat file in windws servise?

    Read the article

  • Detecting when a process has finished (but not exited)

    - by Egwor
    I have a program that's run in unix (that I have no control over) that when finished prints 'Completed successfully' but does not exit. I want to automatically detect when the process finishes (by checking the output of the command), so that I can kill the process and so that I can proceed do other activities. The complexity comes because I want to be able to run multiples of these scripts concurrently. (One activity I need to do requires the script to be called with various inputs, but each time the script runs it takes a while to return, and so I want to do them in parallel) Has anyone done something similar to this? I could redirect the stderr and stdout output of the command to a temporary file which has a random file name, then tail the file and pipe to grep for the end conditions (I.e. the certain log lines). The problem is, surely tail -f would keep running, and so it would never exit. Should I poll? If so, what's the best approach?

    Read the article

  • Concatinate integer arrays iteratively

    - by Ojtwist
    I have a methode in2.getImagesOneDim() which gives me an array of integers, to be more precise the pixel values of an image. Now i want to create one big array with all the pixel values of all the images. Therefore I have to call this method several times. Now I would like to concatenate the previous output to the current output until all images are read. In some kind of pseudo code, where the + is a concatination ... : for (int i = 1; i < 25; i++) { ConArray = ConArray + in2.getImagesOneDim("../images/"+i); } How would I do this in java ?

    Read the article

  • Using template specialization in C++

    - by user550413
    How can I write a function using template specialization that has 2 different input types and an output type: template <class input1, class input2, class output> and return the sum of the 2 numbers (integers/doubles). However, if I get 2 integers I want to return an integer type but for any other combinations of integer and double I'll always return double. I am trying to do that without using directly the '+' operator but having the next functions instead: double add_double_double(double a, double b) {return (a+b);} double add_int_double(int a, double b) {return ((double)(a)+b);} int add_int_int(int a, int b) {return (a+b);}

    Read the article

  • How does the stream manipulators work?

    - by Narek
    It is well known that the user can define stream manipulators like this: ostream& tab(ostream & output) { return output<< '\t'; } And this can be used in main() like this: cout<<'a'<<tab<<'b'<<'c'<<endl; Please explain me how does this all work? If operator<< assumes as a second parameter a pointer to the function that takes and returns ostream &, then please explain my why it is necessary? What would be wrong if the function does not take and return ostream & but it was void instead of ostream &? Also it is interesting why “dec”, “hex” manipulators take effect until I don’t change between them, but user defined manipulators should be always used in order to take effect for each streaming?

    Read the article

  • Increment number in string

    - by iform
    Hi, I am stumped... I am trying to get the following output until a certain condition is met. test_1.jpg test_2.jpg .. test_50.jpg The solution (if you could remotely call it that) that I have is fileCount = 0 while (os.path.exists(dstPath)): fileCount += 1 parts = os.path.splitext(dstPath) dstPath = "%s_%d%s" % (parts[0], fileCount, parts[1]) however...this produces the following output. test_1.jpg test_1_2.jpg test_1_2_3.jpg .....etc The Question: How do I get change the number in its current place (without appending numbers to the end)? Ps. I'm using this for a file renaming tool.

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

  • Getting Null value with JSON from MySQL, how to retrive data from MySQL to JSON correctly?

    - by sky
    I'm using following code but cannot return data from MySQL. This is the output: <script type="text/javascript"> var somethings= [null,null,null]; </script> It does have three post, but I couldn't get the title(message) output. EDIT: this is the code I'm using: <?php $session = mysql_connect('localhost','name','pass'); mysql_select_db('dbname', $session); $result= mysql_query('SELECT * FROM posts', $session); $somethings= array(); while ($row= mysql_fetch_assoc($result)) { $somethings[]= $row['something']; } ?> <script type="text/javascript"> var somethings= <?php echo json_encode($somethings); ?>; </script> This is the table: message Try iPhone post! Welcome to Yo~ :) ??!

    Read the article

  • Mysql query problem

    - by Lost_in_code
    Below is a sample table: fruits +-------+---------+ | id | type | +-------+---------+ | 1 | apple | | 2 | orange | | 3 | banana | | 4 | apple | | 5 | apple | | 6 | apple | | 7 | orange | | 8 | apple | | 9 | apple | | 10 | banana | +-------+---------+ Following are the two queries of interest: SELECT * FROM fruits WHERE type='apple' LIMIT 2; SELECT COUNT(*) AS total FROM fruits WHERE type='apple'; // output 6 I want to combine these two queries so that the results looks like this: +-------+---------+---------+ | id | type | total | +-------+---------+---------+ | 1 | apple | 6 | | 4 | apple | 6 | +-------+---------+---------+ The output has to be limited to 2 records but it should also contain the total number of records of the type apple. How can this be done with 1 query?

    Read the article

  • EF Stored Procedure Complex Type

    - by Web Dev
    I am using EF4. I am somewhat confused on on the Entity Framework Complex name. When I go to Functional Import of a Stored Procedure name and it ask me to type in the Complex name, is that supposed to be the name of of a class that can handle that output. For examle, say if my stored procedure returns FirstName, LastName. Is the Complex name supposed to be a class that can handle that output in this case PersonName? public class PersonName { public string FirstName {get; set;} public string LastName {get;set} }

    Read the article

  • How to remove strings of certain lengths

    - by Macosx Iam
    So I have this array, and I want to delete strings that are 2 or 4 characters in length (strings that contain 2 or 4 characters). I am doing this method, and it doesn't work, even though logically, it SHOULD work. public static void main(String[] args) { ArrayList<String> list = new ArrayList<String>(); list.add("This"); list.add("is"); list.add("a"); list.add("test"); for (int i=0; i<list.size(); i++) { if(list.get(i).length()==2 || list.get(i).length()==4) { list.remove(i); } } } I'd like to stick to this method of doing it. Can you please give me some suggestions as to how to correct this code? The output of this code when I run it is: [is, a] Even though I want the output to be [a] because "is" is 2 characters long.

    Read the article

  • Filter Phrase Query

    - by alsuelo
    I try to filter a phrase to make a search in my website i've this query, this code working with one word but when i type wit more than one isn't working becuase the print is without spaces. $phrase = $this->getState($this->context.".filter_phrase"); printf("Original string: %s\n", $phrase); if(!empty($phrase)) { $escaped = $db->escape($phrase, true); printf("Escaped string: %s\n", $escaped); $quoted = $db->quote("%" . $escaped . "%" , false); $query->where ('a.title LIKE ' .$quoted); } Example i type king and the output is king , when i type the king the output is theking, i want to know if exist any way to conserve the blank spaces.

    Read the article

  • looking for RTF template system with simple DSL

    - by 01
    Is there any framework that fills up rtf document with data? The idea is to make business people/testers change the document in MsWord and than generate reports from that. The problem is with tables, Id need to create some special DSL for handling tables and showing hidding text/page parts. Id rather not do that and use some existing solution. I tried to search for something, but I only found frameworks that can produce rtf output from xml input and i want to use rtf as input and output.

    Read the article

  • PHP exec problem with s3-put

    - by schneck
    Hi there, I use the s3-bash-project to upload data to an S3-Bucket. My command looks like this: /mypath/s3_bash/s3-put -v -k '123456789' -s '/mypath/secret' -T '/mypath/upload/myuploadfile' '/my.bucket/mykeyname' I can run the command from the command line (Mac OS X), and it works well. Now I want to execute it from a PHP-Script: exec($command, $output); but in output, the "s3-put"-command only returns the command's help text. I log the command, and it works if I c&p it from the log the the command line, so there not a problem. It seems that PHP does not pass all the parameters to the command line, although I run escapeshellarg() over all the parameters. I'm using a local XAMPP-Test environment, safe_mode is off. Any ideas?

    Read the article

  • Is apparent NULL pointer dereference in C actually pointer arithmetic?

    - by karthik A
    hey ive got this piece of code. It dereferences a null pointer here. But then there is an and with unsigned int. I really dont understand the whole part. Can someone explain the output.?? struct hi { long a; int b; long c; }; int main() { struct hi ob={3,4,5}; struct hi *ptr=&ob; int num= (unsigned int) & (((struct hi *)0)->b); printf("%d",num); printf("%d",*(int *)((char *)ptr + (unsigned int) & (((struct hi *)0)->b))); } The output I get is 44. But how does it work?

    Read the article

< Previous Page | 339 340 341 342 343 344 345 346 347 348 349 350  | Next Page >