Search Results

Search found 29554 results on 1183 pages for 'human computer interface'.

Page 358/1183 | < Previous Page | 354 355 356 357 358 359 360 361 362 363 364 365  | Next Page >

  • What's the best software analogy you've heard?

    - by Mantorok
    Hi Quite frequently I have to explain things to Project Managers who sometimes want to know a little bit more about something, and sometimes I try and come up with some analogy that best explains it. Now, I can't really kick this off with a good analagy because mine usually suck, but I would be interested in yours, or some you've heard that have been used to simplify explanations. One analogy that does come up often is when explaining Interfaces (i.e. .Net) to which I usually explain in terms of a vehicle has a driver interface, and all vehicles must implement that interface so that anyone who can drive a vehicle will be able to utilise it. Any more? Would like to hear some, both serious and humourous. Please close if a duplicate.

    Read the article

  • textbox, combobox in WPF listview.

    - by RAJ K
    hello everyone, I am porting an application from foxpro to C#.Net. This is a wine shop billing software. Its billing interface screenshot link is here http://picasaweb.google.com/raj.kishor09/RAJK?feat=directlink But my client wants similar interface on WPF too. I think listview can help me in this regard but don't know how to implement. i figured out that each row of listview should have 2 textbox, 1 combobox and few textblock or label. Not only this but cursor should jump from one control to other control using "Enter/Return" key instead of "Tab" key. Please help me with some code lines. Please guys help me......

    Read the article

  • how to get ipv6 public address on xp machine ?

    - by SR Dusad
    C:netsh netshinterface ipv6 netsh interface ipv6show addres Querying active state... Interface 6: Local Area Connection 3 Addr Type DAD State Valid Life Pref. Life Address Temporary Preferred 6d23h38m55s 23h36m8s 2001:db8:1dde:1:6d16:9d1:b1ec:2245 Public Preferred 29d23h59m30s 6d23h59m30s 2001:db8:1dde:1:201:2ff:fe29:23b6 Link Preferred infinite infinite fe80::201:2ff:fe29:23b6 The books says, after IPv6 is enabled on XP, auto configure will give it 3 addresses, a Link, a Public, and a Temporary one. But on my computer, I could only see Link, what was the problem? I used the XP machine. But when i try it on windows 2007 .it works fine and show me a public address. - How to get public ipv6 address from xp machine ? - on my xp machine ipv6 is enabled but when i use command tracert6 www.kame.net it shows No route to destination. Why Any type of help willl appreciated..

    Read the article

  • Accidentally deletion of classes from XCode 3.2.5

    - by Alok Srivastava
    Accidentally my classes folder is deleted with reference from xcode(project). i try to recover them from trash but it was not present in trash. how ever i used svn for backup. but after check out the whole project when i try to run the project then it gives ann error 2012-06-05 09:46:59.651 Lisnx[527:207] Unknown class LisnxAppDelegate in Interface Builder file. 2012-06-05 09:46:59.652 Lisnx[527:207] Unknown class LisnxViewController in Interface Builder file. 2012-06-05 09:46:59.656 Lisnx[527:207] * Terminating app due to uncaught exception 'NSUnknownKeyException', reason: '[ setValue:forUndefinedKey:]: this class is not key value coding-compliant for the key viewController.'

    Read the article

  • Custom SessionListener, name is not bound in this context, javax.naming.NameNotFoundException

    - by mehmet6parmak
    Hi, I am trying to implement HttpSessionListener so that users of this listener can register implementation of ISessionEvent interface to session Events.code is below: public class MySessionListener implements HttpSessionListener{ @Resource ISessionEvent sessionEvent; public ISessionEvent getSessionEvent() { return sessionEvent; } public void setSessionEvent(ISessionEvent sessionEvent) { this.sessionEvent = sessionEvent; } @Override public void sessionCreated(HttpSessionEvent arg0) { sessionEvent.SessionCreated(arg0.getSession()); } @Override public void sessionDestroyed(HttpSessionEvent arg0) { sessionEvent.SessionDestroyed(arg0.getSession()); } } When user implement ISessionEvent and add as a bean, SessionCreated and SessionDestroyed functions of implementation will be called when these events occured. You can ask why dont you just write inside listeners methods, i dont i'm just trying. When i try the code above i got the following error message: javax.naming.NameNotFoundException: Name com.mehmet6parmak.sessionlistener.MySessionListener is not bound in this Context at org.apache.naming.NamingContext.lookup(NamingContext.java:770) at org.apache.naming.NamingContext.lookup(NamingContext.java:153) at org.apache.catalina.util.DefaultAnnotationProcessor.lookupFieldResource(DefaultAnnotationProcessor.java:278) at org.apache.catalina.util.DefaultAnnotationProcessor.processAnnotations(DefaultAnnotationProcessor.java:187) at org.apache.catalina.core.StandardContext.listenerStart(StandardContext.java:4082) at org.apache.catalina.core.StandardContext.start(StandardContext.java:4630) at org.apache.catalina.core.ContainerBase.start(ContainerBase.java:1045) at org.apache.catalina.core.StandardHost.start(StandardHost.java:785) at org.apache.catalina.core.ContainerBase.start(ContainerBase.java:1045) at org.apache.catalina.core.StandardEngine.start(StandardEngine.java:445) at org.apache.catalina.core.StandardService.start(StandardService.java:519) at org.apache.catalina.core.StandardServer.start(StandardServer.java:710) at org.apache.catalina.startup.Catalina.start(Catalina.java:581) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at org.apache.catalina.startup.Bootstrap.start(Bootstrap.java:289) at org.apache.catalina.startup.Bootstrap.main(Bootstrap.java:414) Resource annotation causes the error but i could not resolve it. Thanks All... Interface and Implementation @Resource public interface ISessionEvent { public void SessionCreated(HttpSession session); public void SessionDestroyed(HttpSession session); } @Resource public class SessionEvent implements ISessionEvent { @Override public void SessionDestroyed(HttpSession session) { System.out.println("From Session Event Callback(Destroy):" + session.getId()); } @Override public void SessionCreated(HttpSession session) { System.out.println("From Session Event Callback(Create):" + session.getId()); } } Bean Definition <context:annotation-config/> <context:component-scan base-package="com.mehmet6parmak"> </context:component-scan> <bean id="sessionEvent" autowire="byName" class="com.mehmet6parmak.sessionlistener.SessionEvent"></bean> Solution:Using the method used in link works.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Why do I get a WCF timeout even though my service call and callback are successful?

    - by KallDrexx
    I'm playing around with hooking up an in-game console to a WCF interface, so an external application can send console commands and receive console output. To accomplish this I created the following service contracts: public interface IConsoleNetworkCallbacks { [OperationContract(IsOneWay = true)] void NewOutput(IEnumerable<string> text, string category); } [ServiceContract(SessionMode = SessionMode.Required, CallbackContract = typeof(IConsoleNetworkCallbacks))] public interface IConsoleInterface { [OperationContract] void ProcessInput(string input); [OperationContract] void ChangeCategory(string category); } On the server I implemented it with: public class ConsoleNetworkInterface : IConsoleInterface, IDisposable { public ConsoleNetworkInterface() { ConsoleManager.Instance.RegisterOutputUpdateHandler(OutputHandler); } public void Dispose() { ConsoleManager.Instance.UnregisterOutputHandler(OutputHandler); } public void ProcessInput(string input) { ConsoleManager.Instance.ProcessInput(input); } public void ChangeCategory(string category) { ConsoleManager.Instance.UnregisterOutputHandler(OutputHandler); ConsoleManager.Instance.RegisterOutputUpdateHandler(OutputHandler, category); } protected void OutputHandler(IEnumerable<string> text, string category) { var callbacks = OperationContext.Current.GetCallbackChannel<IConsoleNetworkCallbacks>(); callbacks.NewOutput(text, category); } } On the client I implemented the callback with: public class Callbacks : IConsoleNetworkCallbacks { public void NewOutput(IEnumerable<string> text, string category) { MessageBox.Show(string.Format("{0} lines received for '{1}' category", text.Count(), category)); } } Finally, I establish the service host with the following class: public class ConsoleServiceHost : IDisposable { protected ServiceHost _host; public ConsoleServiceHost() { _host = new ServiceHost(typeof(ConsoleNetworkInterface), new Uri[] { new Uri("net.pipe://localhost") }); _host.AddServiceEndpoint(typeof(IConsoleInterface), new NetNamedPipeBinding(), "FrbConsolePipe"); _host.Open(); } public void Dispose() { _host.Close(); } } and use the following code on my client to establish the connection: protected Callbacks _callbacks; protected IConsoleInterface _proxy; protected void ConnectToConsoleServer() { _callbacks = new Callbacks(); var factory = new DuplexChannelFactory<IConsoleInterface>(_callbacks, new NetNamedPipeBinding(), new EndpointAddress("net.pipe://localhost/FrbConsolePipe")); _proxy = factory.CreateChannel(); _proxy.ProcessInput("Connected"); } So what happens is that my ConnectToConsoleServer() is called and then it gets all the way to _proxy.ProcessInput("Connected");. In my game (on the server) I immediately see the output caused by the ProcessInput call, but the client is still stalled on the _proxy.ProcessInput() call. After a minute my client gets a JIT TimeoutException however at the same time my MessageBox message appears. So obviously not only is my command being sent immediately, my callback is being correctly called. So why am I getting a timeout exception? Note: Even removing the MessageBox call, I still have this issue, so it's not an issue of the GUI blocking the callback response.

    Read the article

  • Is a Multi-DAL Approach the way to go here?

    - by Krisc
    Working on the data access / model layer in this little MVC2 project and trying to think things out to future projects. I have a database with some basic tables and I have classes in the model layer that represent them. I obviously need something to connect the two. The easiest is to provide some sort of 'provider' that can run operations on the database and return objects. But this is for a website that would potentially be used "a lot" (I know, very general) so I want to cache results from the data layer and keep the cache updated as new data is generated. This question deals with how best to approach this problem of dual DALS. One that returns cached data when possible and goes to the data layer when there is a cache miss. But more importantly, how to integrate the core provider (thing that goes into database) with the caching layer so that it too can rely on cached objects rather than creating new ones. Right now I have the following interfaces: IDataProvider is used to reach the database. It doesn't concern itself with the meaning of the objects it produces, but simply the way to produce them. interface IDataProvider{ // Select, Update, Create, et cetera access IEnumerable<Entry> GetEntries(); Entry GetEntryById(int id); } IDataManager is a layer that sits on top of the IDataProvider layer and manages the cache interface IDataManager : IDataProvider{ void ClearCache(); } Note that in practice the IDataManager implementation will have useful helper functions to add objects to their related cache stores. (In the future I may define other functions on the interface) I guess what I am looking for is the best way to approach a loop back from the IDataProvider implementations so that they can access the cache. Or a different approach entirely may be in order? I am not very interested in 3rd party products at the moment as I am interested in the design of these things much more than this specific implementation. Edit: I realize the title may be a bit misleading. I apologize for that... not sure what to call this question.

    Read the article

  • Animating UIImageView iPhone

    - by Fred Dpn
    Hi, i'm having trouble about animating an Image in a UIImageView. I've created an image view in interface builder and linked it to its iboutlet. Here is my code. @interface Game : UIViewController <UIAccelerometerDelegate>{ IBOutlet UIImageView *diying; } @property (nonatomic, retain) UIImageView *diying; In the viewDidLoad method i've written this code NSArray * imageArray = [[NSArray alloc] initWithObjects: [UIImage imageNamed:@"Die1.gif"], [UIImage imageNamed:@"Die2.gif"], [UIImage imageNamed:@"Die3.gif"], [UIImage imageNamed:@"Die4.gif"], nil]; diying.animationImages = imageArray; diying.animationDuration = 1.1; diying.contentMode = UIViewContentModeBottomLeft; [diying startAnimating]; [super viewDidLoad]; which is a adaptation of what i've found here : http://icodeblog.com/2009/07/24/iphone-programming-tutorial-animating-a-game-sprite/ NB : those .gif files are simple images and are not animated. I did the tutorial and it worked fine but i can't figure out why it my adaptation doesn't work !

    Read the article

  • How do I determine inactivity in a MVVM application?

    - by Jordan
    I have an MVVM kiosk application that I need to restart when it has been inactive for a set amount of time. I'm using Prism and Unity to facilitate the MVVM pattern. I've got the restarting down and I even know how to handle the timer. What I want to know is how to know when activity, that is any mouse event, has taken occurred. The only way I know how to do that is by subscribing to the preview mouse events of the main window. That breaks MVVM thought, doesn't it? I've thought about exposing my window as an interface that exposes those events to my application, but that would require that the window implement that interface which also seems to break MVVM.

    Read the article

  • How can I push a string from one client connected to a WCF service to another connected as well?

    - by Sergio Tapia
    Here's what I have so far: IService: using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.ServiceModel; namespace ServiceLibrary { [ServiceContract(SessionMode = SessionMode.Allowed, CallbackContract = typeof(IServiceCallback))] public interface IService { [OperationContract(IsOneWay = false, IsInitiating = true, IsTerminating = false)] void Join(string userName); } interface IServiceCallback { [OperationContract(IsOneWay = true)] void UserJoined(string senderName); } } Service: using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.ServiceModel; namespace ServiceLibrary { [ServiceBehavior(InstanceContextMode = InstanceContextMode.PerSession, ConcurrencyMode = ConcurrencyMode.Multiple)] public class Service:IService { IServiceCallback callback = null; public void Join(string userName) { callback = OperationContext.Current.GetCallbackChannel<IServiceCallback>(); } } } Just a simple string passed from one client to another.

    Read the article

  • Exporting classes containing std:: objects (vector, map, etc) from a dll

    - by RnR
    I'm trying to export classes from a DLL that contain objects such as std::vectors and std::stings - the whole class is declared as dll export through: class DLL_EXPORT FontManager { The problem is that for members of the complex types I get this warning: warning C4251: 'FontManager::m__fonts' : class 'std::map<_Kty,_Ty' needs to have dll-interface to be used by clients of class 'FontManager' with [ _Kty=std::string, _Ty=tFontInfoRef ] I'm able to remove some of the warnings by putting the following forward class declaration before them even though I'm not changing the type of the member variables themselves: template class DLL_EXPORT std::allocator<tCharGlyphProviderRef>; template class DLL_EXPORT std::vector<tCharGlyphProviderRef,std::allocator<tCharGlyphProviderRef> >; std::vector<tCharGlyphProviderRef> m_glyphProviders; Looks like the forward declaration "injects" the DLL_EXPORT for when the member is compiled but is it safe? Does it realy change anything when the client compiles this header and uses the std container on his side? Will it make all future uses of such a container DLL_EXPORT (and possibly not inline?)? And does it really solve the problem that the warning tries to warn about? Is this warning anything I should be worried about or would it be best to disable it in the scope of these constructs? The clients and the dll will always be built using the same set of libraries and compilers and those are header only classes... I'm using Visual Studio 2003 with the standard STD library. ---- Update ---- I'd like to target you more though as I see the answers are general and here we're talking about std containers and types (such as std::string) - maybe the question really is: Can we disable the warning for standard containers and types available to both the client and the dll through the same library headers and treat them just as we'd treat an int or any other built-in type? (It does seem to work correctly on my side.) If so would should be the conditions under which we can do this? Or should maybe using such containers be prohibited or at least ultra care taken to make sure no assignment operators, copy constructors etc will get inlined into the dll client? In general I'd like to know if you feel designing a dll interface having such objects (and for example using them to return stuff to the client as return value types) is a good idea or not and why - I'd like to have a "high level" interface to this functionality... maybe the best solution is what Neil Butterworth suggested - creating a static library?

    Read the article

  • Java Best Practice for type resolution at runtime.

    - by Brian
    I'm trying to define a class (or set of classes which implement the same interface) that will behave as a loosely typed object (like JavaScript). They can hold any sort of data and operations on them depend on the underlying type. I have it working in three different ways but none seem ideal. These test versions only allow strings and integers and the only operation is add. Adding integers results in the sum of the integer values, adding strings concatenates the strings and adding an integer to a string converts the integer to a string and concatenates it with the string. The final version will have more types (Doubles, Arrays, JavaScript-like objects where new properties can be added dynamically) and more operations. Way 1: public interface DynObject1 { @Override public String toString(); public DynObject1 add(DynObject1 d); public DynObject1 addTo(DynInteger1 d); public DynObject1 addTo(DynString1 d); } public class DynInteger1 implements DynObject1 { private int value; public DynInteger1(int v) { value = v; } @Override public String toString() { return Integer.toString(value); } public DynObject1 add(DynObject1 d) { return d.addTo(this); } public DynObject1 addTo(DynInteger1 d) { return new DynInteger1(d.value + value); } public DynObject1 addTo(DynString1 d) { return new DynString1(d.toString()+Integer.toString(value)); } } ...and similar for DynString1 Way 2: public interface DynObject2 { @Override public String toString(); public DynObject2 add(DynObject2 d); } public class DynInteger2 implements DynObject2 { private int value; public DynInteger2(int v) { value = v; } @Override public String toString() { return Integer.toString(value); } public DynObject2 add(DynObject2 d) { Class c = d.getClass(); if(c==DynInteger2.class) { return new DynInteger2(value + ((DynInteger2)d).value); } else { return new DynString2(toString() + d.toString()); } } } ...and similar for DynString2 Way 3: public class DynObject3 { private enum ObjectType { Integer, String }; Object value; ObjectType type; public DynObject3(Integer v) { value = v; type = ObjectType.Integer; } public DynObject3(String v) { value = v; type = ObjectType.String; } @Override public String toString() { return value.toString(); } public DynObject3 add(DynObject3 d) { if(type==ObjectType.Integer && d.type==ObjectType.Integer) { return new DynObject3(Integer.valueOf(((Integer)value).intValue()+((Integer)value).intValue())); } else { return new DynObject3(value.toString()+d.value.toString()); } } } With the if-else logic I could use value.getClass()==Integer.class instead of storing the type but with more types I'd change this to use a switch statement and Java doesn't allow switch to use Classes. Anyway... My question is what is the best way to go about something thike this?

    Read the article

  • Need help with developing a class for my JUnit test

    - by alpdog14
    I have this JUnit test that I need help developing a Interface and Class for, here is the test: Box b1 = new DefaultBox( "abc" ); Box b2 = new DefaultBox( "def" ); Box b3 = new DefaultBox( "" ); assertEquals("abc", b1.contents()); assertEquals("[abc]", b1.toString()); assertTrue(b1.equals(b1)); assertFalse(b1.equals(b2)); assertFalse(b1.equals(null)); assertEquals("cba", b1.flip().contents()); assertEquals("", b3.flip().contents()); can anyone help me in developing a Default box class and a box interface to make these test pass? Any help would be most appreciated.

    Read the article

  • Generic Type constraint in .net

    - by Jose
    Okay I'm looking for some input, I'm pretty sure this is not currently supported in .NET 3.5 but here goes. I want to require a generic type passed into my class to have a constructor like this: new(IDictionary<string,object>) so the class would look like this public MyClass<T> where T : new(IDictionary<string,object>) { T CreateObject(IDictionary<string,object> values) { return new T(values); } } But the compiler doesn't support this, it doesn't really know what I'm asking. Some of you might ask, why do you want to do this? Well I'm working on a pet project of an ORM so I get values from the DB and then create the object and load the values. I thought it would be cleaner to allow the object just create itself with the values I give it. As far as I can tell I have two options: 1) Use reflection(which I'm trying to avoid) to grab the PropertyInfo[] array and then use that to load the values. 2) require T to support an interface like so: public interface ILoadValues { void LoadValues(IDictionary values); } and then do this public MyClass<T> where T:new(),ILoadValues { T CreateObject(IDictionary<string,object> values) { T obj = new T(); obj.LoadValues(values); return obj; } } The problem I have with the interface I guess is philosophical, I don't really want to expose a public method for people to load the values. Using the constructor the idea was that if I had an object like this namespace DataSource.Data { public class User { protected internal User(IDictionary<string,object> values) { //Initialize } } } As long as the MyClass<T> was in the same assembly the constructor would be available. I personally think that the Type constraint in my opinion should ask (Do I have access to this constructor? I do, great!) Anyways any input is welcome.

    Read the article

  • Scroll Gestures not Passed to IScrollInfo implementing panel in Windows Phone 7 CTP

    - by user50088
    I am using a custom panel as a ItemsPanel for a ItemsControl in a with a custom template that provides for a scroll viewer. (See Xaml below.) So long as my panel does not implement IScrollInfo, scrolling works in this scenerio. I implement IScrollInfo and update my viewport and extent sizes in measure override. The scroll bar shows the correct relative size, and if I call the IScrollInfo methods directly, scrolling works as expected. However, the drag and flick gestures no longer scroll the content. Putting a breakpoint on the input of every IScrollInfo method shows that drag and pick are not calling the interface. Removing the IScrollInfo interface declaration restores the scroll on drag and flick behavior. Is there a simple way to restore the flick and pan gestures to ItemControls with panels that implement IScrollInfo?

    Read the article

  • C++ game designing & polymorphism question

    - by Kotti
    Hi! I'm trying to implement some sort of 'just-for-me' game engine and the problem's plot goes the following way: Suppose I have some abstract interface for a renderable entity, e.g. IRenderable. And it's declared the following way: interface IRenderable { // (...) // Suppose that Backend is some abstract backend used // for rendering, and it's implementation is not important virtual void Render(Backend& backend) = 0; }; What I'm doing right now is something like declaring different classes like class Ball : public IRenderable { virtual void Render(Backend& backend) { // Rendering implementation, that is specific for // the Ball object // (...) } }; And then everything looks fine. I can easily do something like std::vector<IRenderable*> items, push some items like new Ball() in this vector and then make a call similiar to foreach (IRenderable* in items) { item->Render(backend); } Ok, I guess it is the 'polymorphic' way, but what if I want to have different types of objects in my game and an ability to manipulate their state, where every object can be manipulated via it's own interface? I could do something like struct GameState { Ball ball; Bonus bonus; // (...) }; and then easily change objects state via their own methods, like ball.Move(...) or bonus.Activate(...), where Move(...) is specific for only Ball and Activate(...) - for only Bonus instances. But in this case I lose the opportunity to write foreach IRenderable* simply because I store these balls and bonuses as instances of their derived, not base classes. And in this case the rendering procedure turns into a mess like ball.Render(backend); bonus.Render(backend); // (...) and it is bad because we actually lose our polymorphism this way (no actual need for making Render function virtual, etc. The other approach means invoking downcasting via dynamic_cast or something with typeid to determine the type of object you want to manipulate and this looks even worse to me and this also breaks this 'polymorphic' idea. So, my question is - is there some kind of (probably) alternative approach to what I want to do or can my current pattern be somehow modified so that I would actually store IRenderable* for my game objects (so that I can invoke virtual Render method on each of them) while preserving the ability to easily change the state of these objects? Maybe I'm doing something absolutely wrong from the beginning, if so, please point it out :) Thanks in advance!

    Read the article

  • Captcha replacement

    - by portoalet
    Hi, I stumbled upon http://www.kettletime.com.au/chance where the user needs to drag and drop a box with a number into another box to prove that he is human. How do you implement this? Any free library to do this? Thanks

    Read the article

  • 3-Tier architecture-layering and the term-mishmash

    - by Rookian
    Hi! I am confused about the different possibilities to express a 3-Tier architecture. Data-Access-Layer Business-Layer Presentation Layer (User Interface) or Database (aka Backend) Business-Layer Presentation Layer (User Interface) Why can you skip the database in the 1st approach? Both use a database! Does the database belong to the layering or not?! What is wrong and what is right? Can someone of you clarify this :)? Thanks in advance!

    Read the article

< Previous Page | 354 355 356 357 358 359 360 361 362 363 364 365  | Next Page >