Search Results

Search found 26454 results on 1059 pages for 'post parameter'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 359/1059 | < Previous Page | 355 356 357 358 359 360 361 362 363 364 365 366  | Next Page >

  • Website (jQuery) consistently crashes Internet Explorer (REALLY STUCK!)

    - by Bradley Bell
    Hey Guys. I posted this question yesterday, but haven't had a response. Basically, I'm totally stuck and clueless over crashing in Internet Explorer. The website now works fine in all browsers except internet explorer. The website is heavily reliant on jQuery and as far as I'm aware, I cant spot anything wrong with the script. Internet Explorer displays no errors and I don't know what I can possibly change. It displays fine, which would suggest that its nothing up with the CSS or HTML? I'm fairly sure it has to be the script, because it only crashes when you hover over one of the mouseover links. I'm already over the deadline and time is ticking! Its driving me crazy. I've uploaded it onto a test directory here: www.openyourheart.org.uk/test/index.html (I'll add the script/css links below as a comment, It wont let me post more than one here!) I would reaaly, really appreciate any help on this. I can also send the website compressed and post scripts here if required/preferred. Thanks in advance, Bradley

    Read the article

  • Non RBAC User Roles and Permissions System: checking the user's City

    - by micha12
    We are currently designing a User Roles and Permissions System in our web application (ASP.NET), and it seems that we have several cases that do no fit within the classical Role-Based Access Control (RBAC). I will post several questions, each devoted to a particular case, this being the first post. We have the following case: not to allow a user view a certain page if the user lives in a particular city. This is a simple case that is coded in the following way: if (User.City == “Moscow”) // Allow the user to view the page. else // Do not allow the user to view this page. Though this case is very simple and straightforward, it has nothing to do with the RBAC. On StackOverflow, someone called this an Attribute-based Access Control. Under the classical RBAC, it seems that this case should be designed like this: introduce a permission “City where the person lives”, this permission will have a property City. Then create a role, add a permission of type “City = Moscow” to it and the assign the role to the user. Looks extremely cumbersome. The question is whether it is acceptable to introduce such non-RBAC approaches to our permissions system – does that break the design or not? This might seem a primitive question, but we found that most applications use pure RBAC, and we started to think that we might be doing something wrong. Thank you.

    Read the article

  • Making a sprite always point to another sprite in XNA

    - by Whitey
    I have a player sprite (playerTexture) and a crosshair sprite (crossTexture) in my game. I need to make the player sprite always face towards the crosshair. Does anyone know how to do this? I have tried doing it myself but the math involved boggles my mind. I know there's a rotation parameter in the spriteBatch.Draw() method but I'm unsure how to use it. Thanks!

    Read the article

  • Why won't .attr('checked','checked') set?

    - by Jason
    I have the following snippet of code (I'm using jQuery 1.4.2): $.post('/Ads/GetAdStatsRow/', { 'ad_id': id }, function(result) { $('#edit_ads_form tbody').prepend(result); $(result).find('td.select-ad input').attr('checked','checked').click(); }); Assume that the post works correctly and returns a correct pre-built <tr> with some <td>s. Here's the weirdness: the $(result).find() line finds the correct input (which is a checkbox, as it's the only input in the cell) and runs the chained click() function correctly, but it REFUSES to set the box as checked, which I need to happen. Here's a crazy twist, too... when I get super specific and change the $(result).find() line to this (the id of the checkbox): $('#ad_' + id).click(); It checks the box, but doesn't run the click() function! If I set it to $('#ad_' + id).attr('checked','checked').click(); it runs the click function as though the box were checked, but the box remains unchecked, and if I do $('#ad_' + id).click().attr('checked','checked'); it does nothing at all. What in the world could be the matter with this? I'm running out of hair.... Thanks!

    Read the article

  • Using embedded standard HTML forms with ASP.NET

    - by RM
    I have a standard aspx page with which I need to add another standard HTML form into and have it submit to another location (external site), however whenever I press the submit button the page seems to do a post back rather than using the sub-forms action url. A mock up of what the form relationships is below. Note in the real deployment the form will be part of a content area of a master page layout, so the form needs to submit independantly from the master page form. <html xmlns="http://www.w3.org/1999/xhtml" > <head runat="server"> <title>Untitled Page</title> </head> <body> <form id="form1" runat="server"> <div> <form id="subscribe_form" method="post" action="https://someothersite.com" name="em_subscribe_form" > <input type="text" id="field1" name="field1" /> <input id="submitsubform" type="submit" value="Submit" /> </form> </div> </form> </body> </html>

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • jQuery - Not sure which method to use, closest() and parent() don't work.

    - by Nike
    Hello, again. :) God i feel like i'm spamming stackoverflow, this is my 3rd post for today. Sorry, heh. I even posted a question regarding this before, kind of, but i've changed the code a bit since so i thought it was better to post a new question. $('.pmlist ul li h4 .toggle').click(function() { $(this).closest('.meddel').toggle(250); }); That's what i've got now. The reason why the closest() method isn't working is because the div .meddel is just next to the h4 element. And closest() only crawls right up the DOM tree, ignoring other child elements. Right? parent() works almost the same and doesn't work either. And as i only want to toggle the closest .meddel div in the element, i need something that, yeah justs grabs the nearest one, and not all of them. To clear it up a bit, here's the HTML for one list item: <li class="item"> <h4><a class="toggle">ämne</a><small>2010-04-17 kl 12:54 by <u>nike1</u></small></h4> <div class="meddel"> <span> <img style="max-width: 70%; min-height: 70%;" src="profile-images/nike1.jpg" alt="" /> <a href="account.php?usr=47">nike1</a> </span> <p>text</p> </div> </li> I have several items like that, and if i click one toggle link, i just want the nearest .meddel to be toggled, as mentioned before. Thanks. -Nike

    Read the article

  • unalbe to register silverlight uesr control in aspx page

    - by anand-juventus
    I have made a simple silverlight application : everything is working fine but I am unable to use silverlight user control as my aspx page shows only embedded object code. I have also tried to register the silverlight control with the following code: <%@ Register Assembly="System.Web.SilverLight" Namespace="System.Web.UI.SilverLightControls" TagPrefix="asp" % but it did not work.I want to do this, so that I would able to pass parameter to silverlight control from my aspx page. How should I register the silverlight user control in my aspx page?I am using silverlight 3.0 version.

    Read the article

  • JsonParseException on Valid JSON

    - by user2909602
    I am having an issue calling a RESTful service from my client code. I have written the RESTful service using CXF/Jackson, deployed to localhost, and tested using RESTClient successfully. Below is a snippet of the service code: @POST @Produces("application/json") @Consumes("application/json") @Path("/set/mood") public Response setMood(MoodMeter mm) { this.getMmDAO().insert(mm); return Response.ok().entity(mm).build(); } The model class and dao work successfully and the service itself works fine using RESTClient. However, when I attempt to call this service from Java Script, I get the error below on the server side: Caused by: org.codehaus.jackson.JsonParseException: Unexpected character ('m' (code 109)): expected a valid value (number, String, array, object, 'true', 'false' or 'null') I have copied the client side code below. To make sure it has nothing to do with the JSON data itself, I used a valid JSON string (which works using RESTClient, JSON.parse() method, and JSONLint) in the vars 'json' (string) and 'jsonData' (JSON). Below is the Java Script code: var json = '{"mood_value":8,"mood_comments":"new comments","user_id":5,"point":{"latitude":37.292929,"longitude":38.0323323},"created_dtm":1381546869260}'; var jsonData = JSON.parse(json); $.ajax({ url: 'http://localhost:8080/moodmeter/app/service/set/mood', dataType: 'json', data: jsonData, type: "POST", contentType: "application/json" }); I've seen the JsonParseException a number of times on other threads, but in this case the JSON itself appears to be valid (and tested). Any thoughts are appreciated.

    Read the article

  • WPF: Link from grid to form

    - by Ron H
    What I need is a grid with all employees data, and a link to a single employees form. I'm ok with filling the grid with data. my questions are: how to create the link? how to send the parameter (employeeid) to the single-employee page, and make it open with the correct data. Thanks, Ron

    Read the article

  • How can I setup a simple custom route using Zend Framework's Zend_Application?

    - by Billy ONeal
    I'm looking to setup a custom route which supplies implicit parameter names to a Zend_Application. Essentially, I have an incoming URL which looks like this: /StandardSystems/Dell/LatitudeE6500 I'd like that to be mapped to the StandardsystemsController, and I'd like that controller to be passed parameters "make" => "Dell" and "model" => "LatitudeE6500". How can I setup such a system using Zend_Application?

    Read the article

  • Cannot get a session with Facebook app? (using its Graph API)

    - by Jian Lin
    I have really simple few lines of Facebook app, using the new Facebook API: <pre> <?php require 'facebook.php'; // Create our Application instance. $facebook = new Facebook(array( 'appId' => '117676584930569', 'secret' => '**********', // hidden here on the post... 'cookie' => true, )); var_dump($facebook); ?> but it is giving me the following output: http://apps.facebook.com/woolaladev/i2.php would give out object(Facebook)#1 (6) { ["appId:protected"]=> string(15) "117676584930569" ["apiSecret:protected"]=> string(32) "**********" <--- just hidden on this post ["session:protected"]=> NULL <--- Session is NULL for some reason ["sessionLoaded:protected"]=> bool(false) ["cookieSupport:protected"]=> bool(true) ["baseDomain:protected"]=> string(0) "" } Session is NULL for some reason, but I am logged in and can access my home and profile and run other apps on Facebook (to see that I am logged on). I am following the sample on: http://github.com/facebook/php-sdk/blob/master/examples/example.php http://github.com/facebook/php-sdk/blob/master/src/facebook.php (download using raw URL: wget http://github.com/facebook/php-sdk/raw/master/src/facebook.php ) Trying on both hosting companies at dreamhost.com and netfirms.com, and the results are the same.

    Read the article

  • ASP.Net MVC, strongly typed view with DateTime not accepted?

    - by Anders Juul
    Hi all, I wish to create a view like <%@ Control Language="C#" Inherits="System.Web.Mvc.ViewUserControl<System.DateTime?>" %> but I get an error saying that DateTime must be a reference type in order to use for parameter TModel. Fair enough, but I google plenty of examples that implement just what I try to achieve. Any clues as to what I need to change/install/update? Any comments welcome, Anders, Denmark

    Read the article

  • How do I debug a HTTP 502 error?

    - by Bialecki
    I have a Python Tornado server sitting behind a nginx frontend. Every now and then, but not every time, I get a 502 error. I look in the nginx access log and I see this: 127.0.0.1 - - [02/Jun/2010:18:04:02 -0400] "POST /a/question/updates HTTP/1.1" 502 173 "http://localhost/tagged/python" "Mozilla/5.0 (X11; U; Linux i686; en-US; rv:1.9.2.3) Gecko/20100401 Firefox/3.6.3" and in the error log: 2010/06/02 18:04:02 [error] 14033#0: *1700 connect() failed (111: Connection refused) while connecting to upstream, client: 127.0.0.1, server: _, request: "POST /a/question/updates HTTP/1.1", upstream: "http://127.0.0.1:8888/a/question/updates", host: "localhost", referrer: "http://localhost/tagged/python" I don't think any errors show up in the Tornado log. How would you go about debugging this? Is there something I can put in the Tornado or nginx configuration to help debug this? EDIT: In addition, I get a fair number of 504, gateway timeout errors. Is it possible that the Tornado instance is just busy or something?

    Read the article

  • Possible bug in ASP.net UpdatePanel control?

    - by Ben Robinson
    I have come across what seems to be an annoying bug with asp.net UpdatePanels in 2 seperate projects. If you have some kind of autopostback enabled control that can cause all of the controls in the update panel to have visible=false set, resulting in an empty update panel. When you change the autopostback control back to the postion that would re enable all of the controls in the update panel, it simply does not make a call back to the server and the update panel does not update. If you do anything else that makes a call back on the same page, then the update panel contents magically appear. It is as if asp.net has decided the update panel is empty so there is no point maikng a callback, even though making the call back would fill the updatepanel with content. The only way round this is to add a style of display:none to the controls instead of setting visible=false property. Then it works fine. Has anyone else encountered this problem? Is it a bug as i suspect or is it likely i am doing soemthing wrong? I haven't got time to post example code at the moment as the code i am using is too wrapped up in other unrealted things, if people think it would help i will create a simple example and post it when I get time.

    Read the article

  • ASP.net AppendHeader not working in ASP MVC

    - by Chao
    I'm having problems getting AppendHeader to work properly if I am also using an authorize filter. I'm using an actionfilter for my AJAX actions that applies Expires, Last-Modified, Cache-Control and Pragma (though while testing I have tried including it in the action method itself with no change in results). If I don't have an authorize filter the headers work fine. Once I add the filter the headers I tried to add get stripped. The headers I want to add Response.AppendHeader("Expires", "Sun, 19 Nov 1978 05:00:00 GMT"); Response.AppendHeader("Last-Modified", String.Format("{0:r}", DateTime.Now)); Response.AppendHeader("Cache-Control", "no-store, no-cache, must-revalidate"); Response.AppendHeader("Cache-Control", "post-check=0, pre-check=0"); Response.AppendHeader("Pragma", "no-cache"); An example of the headers from a correct page: Server ASP.NET Development Server/9.0.0.0 Date Mon, 14 Jun 2010 17:22:24 GMT X-AspNet-Version 2.0.50727 X-AspNetMvc-Version 2.0 Pragma no-cache Expires Sun, 19 Nov 1978 05:00:00 GMT Last-Modified Mon, 14 Jun 2010 18:22:24 GMT Cache-Control no-store, no-cache, must-revalidate, post-check=0, pre-check=0 Content-Type text/html; charset=utf-8 Content-Length 352 Connection Close And from an incorrect page: Server ASP.NET Development Server/9.0.0.0 Date Mon, 14 Jun 2010 17:27:34 GMT X-AspNet-Version 2.0.50727 X-AspNetMvc-Version 2.0 Pragma no-cache, no-cache Cache-Control private, s-maxage=0 Content-Type text/html; charset=utf-8 Content-Length 4937 Connection Close

    Read the article

  • How does overlayViewTouched notification work in the MoviePlayer sample code

    - by Jonathan
    Hi, I have a question regarding the MoviePlayer sample code provided by apple. I don't understand how the overlayViewTouch notification works. The NSlog message I added to it does not get sent when I touch the view (not button). // post the "overlayViewTouch" notification and will send // the overlayViewTouches: message - (void)overlayViewTouches:(NSNotification *)notification { NSLog(@"overlay view touched"); // Handle touches to the overlay view (MyOverlayView) here... } I can, however, get the NSlog notification if I place it in -(void)touchesBegan in "MyOverlayView.m". Which makes me think it is recognizing touches but not sending a notification. // Handle any touches to the overlay view - (void)touchesBegan:(NSSet *)touches withEvent:(UIEvent *)event { UITouch* touch = [touches anyObject]; if (touch.phase == UITouchPhaseBegan) { NSLog(@"overlay touched(from touchesBegan") // IMPORTANT: // Touches to the overlay view are being handled using // two different techniques as described here: // // 1. Touches to the overlay view (not in the button) // // On touches to the view we will post a notification // "overlayViewTouch". MyMovieViewController is registered // as an observer for this notification, and the // overlayViewTouches: method in MyMovieViewController // will be called. // // 2. Touches to the button // // Touches to the button in this same view will // trigger the MyMovieViewController overlayViewButtonPress: // action method instead. NSNotificationCenter *nc = [NSNotificationCenter defaultCenter]; [nc postNotificationName:OverlayViewTouchNotification object:nil]; } } Can anyone shed light on what I am missing or doing wrong? Thank you.

    Read the article

  • Fork or copy a users browser session in IE

    - by jmoeller
    Is it possible to fork a users session (or do something similar) in a Internet Explorer plugin? I want to process the page the user is on when they click a button in the toolbar. To avoid interrupting the users browsing, I'd like to "copy" everything so I can parse and process the page in the background. The processing can involve things such as loading the content of the result links on a Google search, if that's where the button was clicked. So - what I basically want is to imitate "Ctrl+N" but hide the window from the user, so they won't be interrupted. As you can see, if you fill out and submit the form on http://www.snee.com/xml/crud/posttest.html and press "Ctrl+N", everything posted will still appear in the new window, but it won't post the data twice. I was thinking of somehow copying the IWebBrowser2, but: I'm not sure if that's possible (I haven't been able to find any information on MSDN) I don't know if it copies the sessions as well. Creating a new instance of the IWebBrowser2 and simply navigating to the current URL isn't a valid solution as POST-variables of course doesn't get carried over.

    Read the article

  • Error: Cannot find .net assembly during FxCop analysis

    - by Draco
    I'm running FxCop from MSBuild and during the analysis it throws an error stating that it could not find the System.XML assembly and that I need to specify the location using the /directory parameter, which I then did but it didn't work. Any idea what I should do? I am running it on projects built on .Net 4.0

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 355 356 357 358 359 360 361 362 363 364 365 366  | Next Page >