Search Results

Search found 26454 results on 1059 pages for 'post parameter'.

Page 359/1059 | < Previous Page | 355 356 357 358 359 360 361 362 363 364 365 366  | Next Page >

  • How do I debug a HTTP 502 error?

    - by Bialecki
    I have a Python Tornado server sitting behind a nginx frontend. Every now and then, but not every time, I get a 502 error. I look in the nginx access log and I see this: 127.0.0.1 - - [02/Jun/2010:18:04:02 -0400] "POST /a/question/updates HTTP/1.1" 502 173 "http://localhost/tagged/python" "Mozilla/5.0 (X11; U; Linux i686; en-US; rv:1.9.2.3) Gecko/20100401 Firefox/3.6.3" and in the error log: 2010/06/02 18:04:02 [error] 14033#0: *1700 connect() failed (111: Connection refused) while connecting to upstream, client: 127.0.0.1, server: _, request: "POST /a/question/updates HTTP/1.1", upstream: "http://127.0.0.1:8888/a/question/updates", host: "localhost", referrer: "http://localhost/tagged/python" I don't think any errors show up in the Tornado log. How would you go about debugging this? Is there something I can put in the Tornado or nginx configuration to help debug this? EDIT: In addition, I get a fair number of 504, gateway timeout errors. Is it possible that the Tornado instance is just busy or something?

    Read the article

  • Making a sprite always point to another sprite in XNA

    - by Whitey
    I have a player sprite (playerTexture) and a crosshair sprite (crossTexture) in my game. I need to make the player sprite always face towards the crosshair. Does anyone know how to do this? I have tried doing it myself but the math involved boggles my mind. I know there's a rotation parameter in the spriteBatch.Draw() method but I'm unsure how to use it. Thanks!

    Read the article

  • Create an Xml file from an object

    - by remi bourgarel
    I work as a web developer with a web designer and we usually do like this : - I create the system , I generate some Xml files - the designer display the xml files with xslt Nothing new. My problem is that I use Xml Serialization to create my xml files, but I never use Deserialization. So I'd like to know if there is a way to avoid fix like these : empty setter for my property empty parameter-less constructor implement IXmlSerializable and throw "notimplementedexception" on deserialization do a copy of the class with public fields

    Read the article

  • Help regarding C# thread pool

    - by Matt
    I have a method that gets called quite often, with text coming in as a parameter.. I'm looking at creating a thread pool that checks the line of text, and performs actions based on that.. Can someone help me out with the basics behind creating the thread pool and firing off new threads please? This is so damn confusing..

    Read the article

  • Possible bug in ASP.net UpdatePanel control?

    - by Ben Robinson
    I have come across what seems to be an annoying bug with asp.net UpdatePanels in 2 seperate projects. If you have some kind of autopostback enabled control that can cause all of the controls in the update panel to have visible=false set, resulting in an empty update panel. When you change the autopostback control back to the postion that would re enable all of the controls in the update panel, it simply does not make a call back to the server and the update panel does not update. If you do anything else that makes a call back on the same page, then the update panel contents magically appear. It is as if asp.net has decided the update panel is empty so there is no point maikng a callback, even though making the call back would fill the updatepanel with content. The only way round this is to add a style of display:none to the controls instead of setting visible=false property. Then it works fine. Has anyone else encountered this problem? Is it a bug as i suspect or is it likely i am doing soemthing wrong? I haven't got time to post example code at the moment as the code i am using is too wrapped up in other unrealted things, if people think it would help i will create a simple example and post it when I get time.

    Read the article

  • Why won't .attr('checked','checked') set?

    - by Jason
    I have the following snippet of code (I'm using jQuery 1.4.2): $.post('/Ads/GetAdStatsRow/', { 'ad_id': id }, function(result) { $('#edit_ads_form tbody').prepend(result); $(result).find('td.select-ad input').attr('checked','checked').click(); }); Assume that the post works correctly and returns a correct pre-built <tr> with some <td>s. Here's the weirdness: the $(result).find() line finds the correct input (which is a checkbox, as it's the only input in the cell) and runs the chained click() function correctly, but it REFUSES to set the box as checked, which I need to happen. Here's a crazy twist, too... when I get super specific and change the $(result).find() line to this (the id of the checkbox): $('#ad_' + id).click(); It checks the box, but doesn't run the click() function! If I set it to $('#ad_' + id).attr('checked','checked').click(); it runs the click function as though the box were checked, but the box remains unchecked, and if I do $('#ad_' + id).click().attr('checked','checked'); it does nothing at all. What in the world could be the matter with this? I'm running out of hair.... Thanks!

    Read the article

  • Using embedded standard HTML forms with ASP.NET

    - by RM
    I have a standard aspx page with which I need to add another standard HTML form into and have it submit to another location (external site), however whenever I press the submit button the page seems to do a post back rather than using the sub-forms action url. A mock up of what the form relationships is below. Note in the real deployment the form will be part of a content area of a master page layout, so the form needs to submit independantly from the master page form. <html xmlns="http://www.w3.org/1999/xhtml" > <head runat="server"> <title>Untitled Page</title> </head> <body> <form id="form1" runat="server"> <div> <form id="subscribe_form" method="post" action="https://someothersite.com" name="em_subscribe_form" > <input type="text" id="field1" name="field1" /> <input id="submitsubform" type="submit" value="Submit" /> </form> </div> </form> </body> </html>

    Read the article

  • Can T-SQL function return user-defined table type?

    - by abatishchev
    I have my own type: CREATE TYPE MyType AS TABLE ( foo INT ) and a function receiving it as a parameter: CREATE FUNCTION Test ( @in MyType READONLY ) RETURNS @return MyType AS ... can it return MyType or only TABLE repeating MyType's structure: CREATE FUNCTION Test ( @in MyType READONLY ) RETURNS @return TABLE (foo INT) AS ... ?

    Read the article

  • Website (jQuery) consistently crashes Internet Explorer (REALLY STUCK!)

    - by Bradley Bell
    Hey Guys. I posted this question yesterday, but haven't had a response. Basically, I'm totally stuck and clueless over crashing in Internet Explorer. The website now works fine in all browsers except internet explorer. The website is heavily reliant on jQuery and as far as I'm aware, I cant spot anything wrong with the script. Internet Explorer displays no errors and I don't know what I can possibly change. It displays fine, which would suggest that its nothing up with the CSS or HTML? I'm fairly sure it has to be the script, because it only crashes when you hover over one of the mouseover links. I'm already over the deadline and time is ticking! Its driving me crazy. I've uploaded it onto a test directory here: www.openyourheart.org.uk/test/index.html (I'll add the script/css links below as a comment, It wont let me post more than one here!) I would reaaly, really appreciate any help on this. I can also send the website compressed and post scripts here if required/preferred. Thanks in advance, Bradley

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • How Can I Detect A Data Type in AS3

    - by Jascha
    I'd like to make a call to a function and send either a string or an integer... function getImage(val:*):void{ if(val == String){ switch(val){ case'next': loadNext(); break; case'prev': loadPrev(); break } } }else{ loadImg(val); } } and vary my function accordingly... anyone know how to detect the parameter type? Thanks -J

    Read the article

  • jQuery - Not sure which method to use, closest() and parent() don't work.

    - by Nike
    Hello, again. :) God i feel like i'm spamming stackoverflow, this is my 3rd post for today. Sorry, heh. I even posted a question regarding this before, kind of, but i've changed the code a bit since so i thought it was better to post a new question. $('.pmlist ul li h4 .toggle').click(function() { $(this).closest('.meddel').toggle(250); }); That's what i've got now. The reason why the closest() method isn't working is because the div .meddel is just next to the h4 element. And closest() only crawls right up the DOM tree, ignoring other child elements. Right? parent() works almost the same and doesn't work either. And as i only want to toggle the closest .meddel div in the element, i need something that, yeah justs grabs the nearest one, and not all of them. To clear it up a bit, here's the HTML for one list item: <li class="item"> <h4><a class="toggle">ämne</a><small>2010-04-17 kl 12:54 by <u>nike1</u></small></h4> <div class="meddel"> <span> <img style="max-width: 70%; min-height: 70%;" src="profile-images/nike1.jpg" alt="" /> <a href="account.php?usr=47">nike1</a> </span> <p>text</p> </div> </li> I have several items like that, and if i click one toggle link, i just want the nearest .meddel to be toggled, as mentioned before. Thanks. -Nike

    Read the article

  • unalbe to register silverlight uesr control in aspx page

    - by anand-juventus
    I have made a simple silverlight application : everything is working fine but I am unable to use silverlight user control as my aspx page shows only embedded object code. I have also tried to register the silverlight control with the following code: <%@ Register Assembly="System.Web.SilverLight" Namespace="System.Web.UI.SilverLightControls" TagPrefix="asp" % but it did not work.I want to do this, so that I would able to pass parameter to silverlight control from my aspx page. How should I register the silverlight user control in my aspx page?I am using silverlight 3.0 version.

    Read the article

  • ASP.net AppendHeader not working in ASP MVC

    - by Chao
    I'm having problems getting AppendHeader to work properly if I am also using an authorize filter. I'm using an actionfilter for my AJAX actions that applies Expires, Last-Modified, Cache-Control and Pragma (though while testing I have tried including it in the action method itself with no change in results). If I don't have an authorize filter the headers work fine. Once I add the filter the headers I tried to add get stripped. The headers I want to add Response.AppendHeader("Expires", "Sun, 19 Nov 1978 05:00:00 GMT"); Response.AppendHeader("Last-Modified", String.Format("{0:r}", DateTime.Now)); Response.AppendHeader("Cache-Control", "no-store, no-cache, must-revalidate"); Response.AppendHeader("Cache-Control", "post-check=0, pre-check=0"); Response.AppendHeader("Pragma", "no-cache"); An example of the headers from a correct page: Server ASP.NET Development Server/9.0.0.0 Date Mon, 14 Jun 2010 17:22:24 GMT X-AspNet-Version 2.0.50727 X-AspNetMvc-Version 2.0 Pragma no-cache Expires Sun, 19 Nov 1978 05:00:00 GMT Last-Modified Mon, 14 Jun 2010 18:22:24 GMT Cache-Control no-store, no-cache, must-revalidate, post-check=0, pre-check=0 Content-Type text/html; charset=utf-8 Content-Length 352 Connection Close And from an incorrect page: Server ASP.NET Development Server/9.0.0.0 Date Mon, 14 Jun 2010 17:27:34 GMT X-AspNet-Version 2.0.50727 X-AspNetMvc-Version 2.0 Pragma no-cache, no-cache Cache-Control private, s-maxage=0 Content-Type text/html; charset=utf-8 Content-Length 4937 Connection Close

    Read the article

  • Java library for parsing command-line parameters?

    - by Mnementh
    I write a little command-line-application in Java. This application should work with a mix of parameters and commands, similar to svn. Examples app url command1 app url command2 --parameter2 -x app url command1 --param-with-argument argument app --parameter url command1 app --no-url command2 app --help Wanted Exists an easy-to-use library for Java Supports parsing of such command-lines (Bonus) Automatically creates an appropriate help

    Read the article

  • Use localeURL middleware with apache prefix

    - by Olivier R.
    Good morning everyone, I Got a question about localeURL usage. Everything works great for me with url like this : www.mysite.com/ If I type www.mysite.com/ in adress bar, it turns correctly in www.mysite.com/en/ for example. If I use the view change_locale, it's also all right (ie change www.mysite.com/en/ in www.mysite.com/fr/). But my application use apache as server, and use a prefix for the site, that gives url like this : www.mysite.com/prefix/ If I type www.mysite.com/prefix/ in the adress bar, the adress turns into www.mysite.com/en/ without prefix (so 404) I change code of view to manage our settings.SERVER_PREFIX value : def change_locale(request) : """ Redirect to a given url while changing the locale in the path The url and the locale code need to be specified in the request parameters. O. Rochaix; Taken from localeURL view, and tuned to manage : - SERVER_PREFIX from settings.py """ next = request.REQUEST.get('next', None) if not next: next = request.META.get('HTTP_REFERER', None) if not next: next = settings.SERVER_PREFIX + '/' next = urlsplit(next).path prefix = False if settings.SERVER_PREFIX!="" and next.startswith(settings.SERVER_PREFIX) : prefix = True next = "/" + next.lstrip(settings.SERVER_PREFIX) _, path = utils.strip_path (next) if request.method == 'POST': locale = request.POST.get('locale', None) if locale and check_for_language(locale): path = utils.locale_path(path, locale) if prefix : path = settings.SERVER_PREFIX + path response = http.HttpResponseRedirect(path) return response with this customized view, i'm able to correctly change language, but i'm not sure that's the right way of doing stuff. Is there any option on localeURL to manage prefix of apache ?

    Read the article

  • Local variabeles in java

    - by Mandar
    Hello , I went through local variables and class variables concept. But I had stuck at a doubt " Why is it so that we cannot declare local variables as static " ? For e.g Suppose we have a play( ) function : void play( ) { static int i=5; System.out.println(i); } It gives me error in eclipse : Illegal modifier for parameter i; Thanks.

    Read the article

  • ASP.Net MVC, strongly typed view with DateTime not accepted?

    - by Anders Juul
    Hi all, I wish to create a view like <%@ Control Language="C#" Inherits="System.Web.Mvc.ViewUserControl<System.DateTime?>" %> but I get an error saying that DateTime must be a reference type in order to use for parameter TModel. Fair enough, but I google plenty of examples that implement just what I try to achieve. Any clues as to what I need to change/install/update? Any comments welcome, Anders, Denmark

    Read the article

  • How does overlayViewTouched notification work in the MoviePlayer sample code

    - by Jonathan
    Hi, I have a question regarding the MoviePlayer sample code provided by apple. I don't understand how the overlayViewTouch notification works. The NSlog message I added to it does not get sent when I touch the view (not button). // post the "overlayViewTouch" notification and will send // the overlayViewTouches: message - (void)overlayViewTouches:(NSNotification *)notification { NSLog(@"overlay view touched"); // Handle touches to the overlay view (MyOverlayView) here... } I can, however, get the NSlog notification if I place it in -(void)touchesBegan in "MyOverlayView.m". Which makes me think it is recognizing touches but not sending a notification. // Handle any touches to the overlay view - (void)touchesBegan:(NSSet *)touches withEvent:(UIEvent *)event { UITouch* touch = [touches anyObject]; if (touch.phase == UITouchPhaseBegan) { NSLog(@"overlay touched(from touchesBegan") // IMPORTANT: // Touches to the overlay view are being handled using // two different techniques as described here: // // 1. Touches to the overlay view (not in the button) // // On touches to the view we will post a notification // "overlayViewTouch". MyMovieViewController is registered // as an observer for this notification, and the // overlayViewTouches: method in MyMovieViewController // will be called. // // 2. Touches to the button // // Touches to the button in this same view will // trigger the MyMovieViewController overlayViewButtonPress: // action method instead. NSNotificationCenter *nc = [NSNotificationCenter defaultCenter]; [nc postNotificationName:OverlayViewTouchNotification object:nil]; } } Can anyone shed light on what I am missing or doing wrong? Thank you.

    Read the article

  • Cannot get a session with Facebook app? (using its Graph API)

    - by Jian Lin
    I have really simple few lines of Facebook app, using the new Facebook API: <pre> <?php require 'facebook.php'; // Create our Application instance. $facebook = new Facebook(array( 'appId' => '117676584930569', 'secret' => '**********', // hidden here on the post... 'cookie' => true, )); var_dump($facebook); ?> but it is giving me the following output: http://apps.facebook.com/woolaladev/i2.php would give out object(Facebook)#1 (6) { ["appId:protected"]=> string(15) "117676584930569" ["apiSecret:protected"]=> string(32) "**********" <--- just hidden on this post ["session:protected"]=> NULL <--- Session is NULL for some reason ["sessionLoaded:protected"]=> bool(false) ["cookieSupport:protected"]=> bool(true) ["baseDomain:protected"]=> string(0) "" } Session is NULL for some reason, but I am logged in and can access my home and profile and run other apps on Facebook (to see that I am logged on). I am following the sample on: http://github.com/facebook/php-sdk/blob/master/examples/example.php http://github.com/facebook/php-sdk/blob/master/src/facebook.php (download using raw URL: wget http://github.com/facebook/php-sdk/raw/master/src/facebook.php ) Trying on both hosting companies at dreamhost.com and netfirms.com, and the results are the same.

    Read the article

  • Passing XML markers to Google Map

    - by djmadscribbler
    I've been creating a V3 Google map based on this example from Mike Williams http://www.geocodezip.com/v3_MW_example_map3.html I've run into a bit of a problem though. If I have no parameters in my URL then I get the error "id is undefined idmarkers [id.toLowerCase()] = marker;" in Firebug and only one marker will show up. If I have a parameter (?id=105 for example) then all the sidebar links say 105 (or whatever the parameter in the URL was) instead of their respective label as listed in the XML file and a random infowindow will be opened instead of the window for the id in the URL. Here is my javascript: var map = null; var lastmarker = null; // ========== Read paramaters that have been passed in ========== // Before we go looking for the passed parameters, set some defaults // in case there are no parameters var id; var index = -1; // these set the initial center, zoom and maptype for the map // if it is not specified in the query string var lat = 42.194741; var lng = -121.700301; var zoom = 18; var maptype = google.maps.MapTypeId.HYBRID; function MapTypeId2UrlValue(maptype) { var urlValue = 'm'; switch (maptype) { case google.maps.MapTypeId.HYBRID: urlValue = 'h'; break; case google.maps.MapTypeId.SATELLITE: urlValue = 'k'; break; case google.maps.MapTypeId.TERRAIN: urlValue = 't'; break; default: case google.maps.MapTypeId.ROADMAP: urlValue = 'm'; break; } return urlValue; } // If there are any parameters at eh end of the URL, they will be in location.search // looking something like "?marker=3" // skip the first character, we are not interested in the "?" var query = location.search.substring(1); // split the rest at each "&" character to give a list of "argname=value" pairs var pairs = query.split("&"); for (var i = 0; i < pairs.length; i++) { // break each pair at the first "=" to obtain the argname and value var pos = pairs[i].indexOf("="); var argname = pairs[i].substring(0, pos).toLowerCase(); var value = pairs[i].substring(pos + 1).toLowerCase(); // process each possible argname - use unescape() if theres any chance of spaces if (argname == "id") { id = unescape(value); } if (argname == "marker") { index = parseFloat(value); } if (argname == "lat") { lat = parseFloat(value); } if (argname == "lng") { lng = parseFloat(value); } if (argname == "zoom") { zoom = parseInt(value); } if (argname == "type") { // from the v3 documentation 8/24/2010 // HYBRID This map type displays a transparent layer of major streets on satellite images. // ROADMAP This map type displays a normal street map. // SATELLITE This map type displays satellite images. // TERRAIN This map type displays maps with physical features such as terrain and vegetation. if (value == "m") { maptype = google.maps.MapTypeId.ROADMAP; } if (value == "k") { maptype = google.maps.MapTypeId.SATELLITE; } if (value == "h") { maptype = google.maps.MapTypeId.HYBRID; } if (value == "t") { maptype = google.maps.MapTypeId.TERRAIN; } } } // this variable will collect the html which will eventually be placed in the side_bar var side_bar_html = ""; // arrays to hold copies of the markers and html used by the side_bar // because the function closure trick doesnt work there var gmarkers = []; var idmarkers = []; // global "map" variable var map = null; // A function to create the marker and set up the event window function function createMarker(point, icon, label, html) { var contentString = html; var marker = new google.maps.Marker({ position: point, map: map, title: label, icon: icon, zIndex: Math.round(point.lat() * -100000) << 5 }); marker.id = id; marker.index = gmarkers.length; google.maps.event.addListener(marker, 'click', function () { lastmarker = new Object; lastmarker.id = marker.id; lastmarker.index = marker.index; infowindow.setContent(contentString); infowindow.open(map, marker); }); // save the info we need to use later for the side_bar gmarkers.push(marker); idmarkers[id.toLowerCase()] = marker; // add a line to the side_bar html side_bar_html += '<a href="javascript:myclick(' + (gmarkers.length - 1) + ')">' + id + '<\/a><br>'; } // This function picks up the click and opens the corresponding info window function myclick(i) { google.maps.event.trigger(gmarkers[i], "click"); } function makeLink() { var mapinfo = "lat=" + map.getCenter().lat().toFixed(6) + "&lng=" + map.getCenter().lng().toFixed(6) + "&zoom=" + map.getZoom() + "&type=" + MapTypeId2UrlValue(map.getMapTypeId()); if (lastmarker) { var a = "/about/map/default.aspx?id=" + lastmarker.id + "&" + mapinfo; var b = "/about/map/default.aspx?marker=" + lastmarker.index + "&" + mapinfo; } else { var a = "/about/map/default.aspx?" + mapinfo; var b = a; } document.getElementById("idlink").innerHTML = '<a href="' + a + '" id=url target=_new>- Link directly to this page by id</a> (id in xml file also entry &quot;name&quot; in sidebar menu)'; document.getElementById("indexlink").innerHTML = '<a href="' + b + '" id=url target=_new>- Link directly to this page by index</a> (position in gmarkers array)'; } function initialize() { // create the map var myOptions = { zoom: zoom, center: new google.maps.LatLng(lat, lng), mapTypeId: maptype, mapTypeControlOptions: { style: google.maps.MapTypeControlStyle.DROPDOWN_MENU }, navigationControl: true, mapTypeId: google.maps.MapTypeId.HYBRID }; map = new google.maps.Map(document.getElementById("map_canvas"), myOptions); var stylesarray = [ { featureType: "poi", elementType: "labels", stylers: [ { visibility: "off" } ] }, { featureType: "landscape.man_made", elementType: "labels", stylers: [ { visibility: "off" } ] } ]; var options = map.setOptions({ styles: stylesarray }); // Make the link the first time when the page opens makeLink(); // Make the link again whenever the map changes google.maps.event.addListener(map, 'maptypeid_changed', makeLink); google.maps.event.addListener(map, 'center_changed', makeLink); google.maps.event.addListener(map, 'bounds_changed', makeLink); google.maps.event.addListener(map, 'zoom_changed', makeLink); google.maps.event.addListener(map, 'click', function () { lastmarker = null; makeLink(); infowindow.close(); }); // Read the data from example.xml downloadUrl("example.xml", function (doc) { var xmlDoc = xmlParse(doc); var markers = xmlDoc.documentElement.getElementsByTagName("marker"); for (var i = 0; i < markers.length; i++) { // obtain the attribues of each marker var lat = parseFloat(markers[i].getAttribute("lat")); var lng = parseFloat(markers[i].getAttribute("lng")); var point = new google.maps.LatLng(lat, lng); var html = markers[i].getAttribute("html"); var label = markers[i].getAttribute("label"); var icon = markers[i].getAttribute("icon"); // create the marker var marker = createMarker(point, icon, label, html); } // put the assembled side_bar_html contents into the side_bar div document.getElementById("side_bar").innerHTML = side_bar_html; // ========= If a parameter was passed, open the info window ========== if (id) { if (idmarkers[id]) { google.maps.event.trigger(idmarkers[id], "click"); } else { alert("id " + id + " does not match any marker"); } } if (index > -1) { if (index < gmarkers.length) { google.maps.event.trigger(gmarkers[index], "click"); } else { alert("marker " + index + " does not exist"); } } }); } var infowindow = new google.maps.InfoWindow( { size: new google.maps.Size(150, 50) }); google.maps.event.addDomListener(window, "load", initialize); And here is an example of my XML formatting <marker lat="42.196175" lng="-121.699224" html="This is the information about 104" iconimage="/about/map/images/104.png" label="104" />

    Read the article

  • Fork or copy a users browser session in IE

    - by jmoeller
    Is it possible to fork a users session (or do something similar) in a Internet Explorer plugin? I want to process the page the user is on when they click a button in the toolbar. To avoid interrupting the users browsing, I'd like to "copy" everything so I can parse and process the page in the background. The processing can involve things such as loading the content of the result links on a Google search, if that's where the button was clicked. So - what I basically want is to imitate "Ctrl+N" but hide the window from the user, so they won't be interrupted. As you can see, if you fill out and submit the form on http://www.snee.com/xml/crud/posttest.html and press "Ctrl+N", everything posted will still appear in the new window, but it won't post the data twice. I was thinking of somehow copying the IWebBrowser2, but: I'm not sure if that's possible (I haven't been able to find any information on MSDN) I don't know if it copies the sessions as well. Creating a new instance of the IWebBrowser2 and simply navigating to the current URL isn't a valid solution as POST-variables of course doesn't get carried over.

    Read the article

  • WPF: Link from grid to form

    - by Ron H
    What I need is a grid with all employees data, and a link to a single employees form. I'm ok with filling the grid with data. my questions are: how to create the link? how to send the parameter (employeeid) to the single-employee page, and make it open with the correct data. Thanks, Ron

    Read the article

< Previous Page | 355 356 357 358 359 360 361 362 363 364 365 366  | Next Page >