Search Results

Search found 45013 results on 1801 pages for 'example'.

Page 363/1801 | < Previous Page | 359 360 361 362 363 364 365 366 367 368 369 370  | Next Page >

  • Returning JSON object from an ASP.NET page

    - by Emin
    Hi, In my particular situation, I have couple of solutions to my problem. I want to find out which one is more feasible. In this case, I can also achieve my goal by returning a JSON object from my server side code, however, I do not know how it is done and what is the best way of doing it. First off, I don't need a full aspx page as I only need a response returned from code. So, do I use web services? handler? or is there any other specific way you people do this? Is this solution feasible? do I build the JSON string using the StringBuilder class and inject that string into the target aspx page? are there any precautions? or things that I should be aware of? I appreciate your ideas. Regards, Kemal ------------UPDATE !------------ Suppose I have a JSON object in my userlist.aspx page. which then I use it with jQuery... {"menu": { "id": "color1", "value": "color", "popup": { "menuitem": [ {"value": "Red"}, {"value": "Green"}, {"value": "Yellow"} ] } }} // example taken from the json.org/example page now when I want to add a new menuitem from my aspx page, what do I do... I think this way my question is more specific... Lets assume I create a new string in my aspx code, as such "{"value": "Blue"}. Now how do I inject this into the already existing itemlist in the target page? or is this not the correct approach to this kind of situation? if not how else can it be achieved? Also if I wanted to fire a jquery event when a new item is added to this list, how is this achieved?

    Read the article

  • WP7: Why does a ListBox.ItemsPanel break my ElementName data binding?

    - by iguanaNet
    I have a Windows Phone 7 ListBox that binds to a list of integers. I am using the default MVVM Light template, so there is a ViewModel class that contains data and a simple RelayCommand. Here is the ListBox: <ListBox ItemsSource="{Binding MyData}"> <ListBox.ItemTemplate> <DataTemplate> <Button Content="{Binding}"> <i:Interaction.Triggers> <i:EventTrigger EventName="Click"> <cmd:EventToCommand Command="{Binding ElementName=ContentGrid, Path=DataContext.TestCommand}" CommandParameter="{Binding}" /> </i:EventTrigger> </i:Interaction.Triggers> </Button> </DataTemplate> </ListBox.ItemTemplate> </ListBox> This displays a vertical list of integers inside buttons. If you click any of them, the following command code executes and shows a pop-up: new RelayCommand<int>(i => MessageBox.Show("Test" + i)); However, if I simply add the following XAML to change to a horizontal list, the databinding fails. Nothing happens when you click the button and no error messages are written to the Output window. <ListBox.ItemsPanel> <ItemsPanelTemplate> <StackPanel Orientation="Horizontal" HorizontalAlignment="Center" /> </ItemsPanelTemplate> </ListBox.ItemsPanel> I have tried some other types of binding for the EventToCommand. For example, specifying my ViewModel as a static resource. It works, but is less ideal than the example above. Why does that ItemsPanel break the databinding?

    Read the article

  • How to start matching and saving matched from exact point in a text

    - by yuliya
    I have a text and I write a parser for it using regular expressions and perl. I can match what I need with two empty lines (I use regexp), because there is a pattern that allows recognize blocks of text after two empty lines. But the problem is that the whole text has Introduction part and some text in the end I do not need. Here is a code which matches text when it finds two empty lines #!/usr/bin/perl use strict; use warnings; my $file = 'first'; open(my $fh, '<', $file); my $empty = 0; my $block_num = 1; open(OUT, '>', $block_num . '.txt'); while (my $line = <$fh>) { chomp ($line); if ($line =~ /^\s*$/) { $empty++; } elsif ($empty == 2) { close(OUT); open(OUT, '>', ++$block_num . '.txt'); $empty = 0; } else { $empty = 0;} print OUT "$line\n"; } close(OUT); This is example of the text I need (it's really small :)) this is file example I think that I need to iterate over the text till the moment it will find the word LOREM IPSUM with regexps this kind "/^LOREM IPSUM/", because it is the point from which needed text starts(and save the text in one file when i reach the word). And I need to finish iterating over the text when INDEX word is fount or save the text in separate file. How could I implement it. Should I use next function to proceed with lines or what? BR, Yuliya

    Read the article

  • OCaml delimiters and scopes

    - by Jack
    Hello! I'm learning OCaml and although I have years of experience with imperative programming languages (C, C++, Java) I'm getting some problems with delimiters between declarations or expressions in OCaml syntax. Basically I understood that I have to use ; to concatenate expressions and the value returned by the sequence will be the one of last expression used, so for example if I have exp1; exp2; exp3 it will be considered as an expression that returns the value of exp3. Starting from this I could use let t = something in exp1; exp2; exp3 and it should be ok, right? When am I supposed to use the double semicol ;;? What does it exactly mean? Are there other delimiters that I must use to avoid syntax errors? I'll give you an example: let rec satisfy dtmc state pformula = match (state, pformula) with (state, `Next sformula) -> let s = satisfy_each dtmc sformula and adder a state = let p = 0.; for i = 0 to dtmc.matrix.rows do p <- p +. get dtmc.matrix i state.index done; a +. p in List.fold_left adder 0. s | _ -> [] It gives me syntax error on | but I don't get why.. what am I missing? This is a problem that occurs often and I have to try many different solutions until it suddently works :/ A side question: declaring with let instead that let .. in will define a var binding that lasts whenever after it has been defined? What I basically ask is: what are the delimiters I have to use and when I have to use them. In addition are there differences I should consider while using the interpreter ocaml instead that the compiler ocamlc? Thanks in advance!

    Read the article

  • Designing a chain of states

    - by devoured elysium
    I want to model a kind of FSM(Finite State Machine). I have a sequence of states (let's say, from StateA to StateZ). This sequence is called a Chain and is implemented internally as a List. I will add states by the order I want them to run. My purpose is to be able to make a sequence of actions in my computer (for example, mouse clicks). (I know this has been done a zillion times). So a state is defined as a: boolean Precondition() <- Checks to see if for this state, some condition is true. For example, if I want to click in the Record button of a program, in this method I would check if the program's process is running or not. If it is, go to the next state in the chain list, otherwise, go to what was defined as the fail state (generally is the first state of them all). IState GetNextState() <- Returns the next state to evaluate. If Precondition() was sucessful, it should yield the next state in the chain otherwise it should yield the fail state. Run() Simply checks the Precondition() and sets the internal data so GetNextState() works as expected. So, a naive approach to this would be something like this: Chain chain = new Chain(); //chain.AddState(new State(Precondition, FailState, NextState) <- Method structure chain.AddState(new State(new WinampIsOpenCondition(), null, new <problem here, I want to referr to a state that still wasn't defined!>); The big problem is that I want to make a reference to a State that at this point still wasn't defined. I could circumvent the problem by using strings when refrering to states and using an internal hashtable, but isn't there a clearer alternative? I could just pass only the pre-condition and failure states in the constructor, having the chain just before execution put in each state the correct next state in a public property but that seems kind of awkward.

    Read the article

  • Eclipse > Javascript > Code highlighting not working with Object Notation

    - by Redsandro
    I am using Eclipse Helios with PDT, and when I am editing JavaScript files with the default JavaScript Editor (JSDT), code highlighting (Mark Occurrences) is not working for half of the code, for example JSON-style (or Object Literal if you will) declarations. Little example: Foo = {}; Foo.Bar = Foo.Bar || {}; Foo.Bar = { bar: function(str) { alert(str) }, baz: function(str) { this.bar(str); // This bar *is* highlighted though } }; Foo.Bar.baz('text'); No Bar, bar or baz is highlighted. For now, I humbly edit the JavaScript part of projects in Notepad++ because it just highlights every occurrence of whatever is currently selected. Is there a common practice for Eclipse JavaScript developers to get code highlighting work correctly, using the popular Object Literal notation? An option or update I missed? -update- I have found that code highlighting depends on the code being properly outlined. Altough commonly used, Object Literal outlining still seems rare in javascript editors. the Spket Javascript Editor does partial Object Literal outlining, and the Aptana Javascript Editor does full Object Literal outlining. But both loses other important functionality. A quest for the editor with the least loss of functionality is currently in progress in this question.

    Read the article

  • How to use Node.js to build pages that are a mix between static and dynamic content?

    - by edt
    All pages on my 5 page site should be output using a Node.js server. Most of the page content is static. At the bottom of each page, there is a bit of dynamic content. My node.js code currently looks like: var http = require('http'); http.createServer(function (request, response) { console.log('request starting...'); response.writeHead(200, { 'Content-Type': 'text/html' }); var html = '<!DOCTYPE html><html><head><title>My Title</title></head><body>'; html += 'Some more static content'; html += 'Some more static content'; html += 'Some more static content'; html += 'Some dynamic content'; html += '</body></html>'; response.end(html, 'utf-8'); }).listen(38316); I'm sure there are numerous things wrong about this example. Please enlighten me! For example: How can I add static content to the page without storing it in a string as a variable value with += numerous times? What is the best practices way to build a small site in Node.js where all pages are a mix between static and dynamic content?

    Read the article

  • File/Property rename problem in Visual Studio and Explorer

    - by user211377
    I am running Windows 7. In Visual Studio, if I try to rename a file by right-click/rename, it behaves as normal for a couple of seconds, then switches out of edit mode. A similar problem occurs when I try to change a property, for example the name of a control. When I click in the property value, I can start editing, but then it assumes the edit is complete, and if I continue typing it overwrites the text. It does this every couple of seconds, so, for example, if I want to name a control mnuFile, I might get mn, then uFi, then le. S, the control ends upgetting called whatever I typed in the last 2-3 characters. I have the same problem with file rename in Explorer. Looks to me as though some timeout is kicking in and terminating the edit. Well, I was going to try a 'Repair install', but that's not an option in Windows 7! So, I went through the re-install, up to the point where I thought is was going to trash my install, and then cancelled it! By some miracle, that has fixed the problem!#Thanks for the advice about ShellExView, I'll try that next time it happens. Thanks for the answers guys! In my view it is more a Visual Studio issue, since it affects both file renames and properties in VS. In Explorer it only affects file rename, which is (just slightly) less annoying!

    Read the article

  • Angular JS pagination after data loaded

    - by Federico Bucchi
    do you have any example of Angular JS elements pagination loaded from I file? I found this example: http://jsfiddle.net/SAWsA/11/ Now, instead of having this: $scope.items = [ {"id":"1","name":"name 1","description":"description 1","field3":"field3 1","field4":"field4 1","field5 ":"field5 1"}, {"id":"2","name":"name 2","description":"description 1","field3":"field3 2","field4":"field4 2","field5 ":"field5 2"}, {"id":"3","name":"name 3","description":"description 1","field3":"field3 3","field4":"field4 3","field5 ":"field5 3"}, {"id":"4","name":"name 4","description":"description 1","field3":"field3 4","field4":"field4 4","field5 ":"field5 4"}, {"id":"5","name":"name 5","description":"description 1","field3":"field3 5","field4":"field4 5","field5 ":"field5 5"}, {"id":"6","name":"name 6","description":"description 1","field3":"field3 6","field4":"field4 6","field5 ":"field5 6"}, {"id":"7","name":"name 7","description":"description 1","field3":"field3 7","field4":"field4 7","field5 ":"field5 7"}, {"id":"8","name":"name 8","description":"description 1","field3":"field3 8","field4":"field4 8","field5 ":"field5 8"}, {"id":"9","name":"name 9","description":"description 1","field3":"field3 9","field4":"field4 9","field5 ":"field5 9"}, {"id":"10","name":"name 10","description":"description 1","field3":"field3 10","field4":"field4 10","field5 ":"field5 10"}, {"id":"11","name":"name 11","description":"description 1","field3":"field3 11","field4":"field4 11","field5 ":"field5 11"}, {"id":"12","name":"name 12","description":"description 1","field3":"field3 12","field4":"field4 12","field5 ":"field5 12"}, {"id":"13","name":"name 13","description":"description 1","field3":"field3 13","field4":"field4 13","field5 ":"field5 13"}, {"id":"14","name":"name 14","description":"description 1","field3":"field3 14","field4":"field4 14","field5 ":"field5 14"}, {"id":"15","name":"name 15","description":"description 1","field3":"field3 15","field4":"field4 15","field5 ":"field5 15"}, {"id":"16","name":"name 16","description":"description 1","field3":"field3 16","field4":"field4 16","field5 ":"field5 16"}, {"id":"17","name":"name 17","description":"description 1","field3":"field3 17","field4":"field4 17","field5 ":"field5 17"}, {"id":"18","name":"name 18","description":"description 1","field3":"field3 18","field4":"field4 18","field5 ":"field5 18"}, {"id":"19","name":"name 19","description":"description 1","field3":"field3 19","field4":"field4 19","field5 ":"field5 19"}, {"id":"20","name":"name 20","description":"description 1","field3":"field3 20","field4":"field4 20","field5 ":"field5 20"} ]; I have to use something generated by: $http.get('/json/mocks/apps/applications.json') .then(function (result) { $scope.items = result.data.applications; }); How would you create the pagination waiting for the data loaded from $http.get?

    Read the article

  • javac will not compile enum, ( Windows Sun 1.6 --> OpenJDK 1.6)

    - by avgvstvs
    package com.scheduler.process; public class Process { public enum state { NOT_SUBMITTED, SUBMITTED, BLOCKED, READY, RUNNING, COMPLETED } private state currentState; public state getCurrentState() { return currentState; } public void setCurrentState(state currentState) { this.currentState = currentState; } } package com.scheduler.machine; import com.scheduler.process.Process; import com.scheduler.process.Process.state; public class Machine { com.scheduler.process.Process p = new com.scheduler.process.Process(); state s = state.READY; //fails if I don't also explicitly import Process.state p.setCurrentState(s); //says I need a declarator id after 's'... this is wrong. p.setCurrentState(state.READY); } Modified the example to try and direct to the issue. I cannot change the state on this code. Eclipse suggests importing Process.state like I had on my previous example, but this doesn't work either. This allows state s = state.READY but the call to p.setCurrentState(s); fails as does p.setCurrentState(state.READY);

    Read the article

  • What to call factory-like (java) methods used with immutable objects

    - by StaxMan
    When creating classes for "immutable objects" immutable meaning that state of instances can not be changed; all fields assigned in constructor) in Java (and similar languages), it is sometimes useful to still allow creation of modified instances. That is, using an instance as base, and creating a new instance that differs by just one property value; other values coming from the base instance. To give a simple example, one could have class like: public class Circle { final double x, y; // location final double radius; public Circle(double x, double y, double r) { this.x = x; this.y = y; this.r = r; } // method for creating a new instance, moved in x-axis by specified amount public Circle withOffset(double deltaX) { return new Circle(x+deltaX, y, radius); } } So: what should method "withOffset" be called? (note: NOT what its name ought to be -- but what is this class of methods called). Technically it is kind of a factory method, but somehow that does not seem quite right to me, since often factories are just given basic properties (and are either static methods, or are not members of the result type but factory type). So I am guessing there should be a better term for such methods. Since these methods can be used to implement "fluent interface", maybe they could be "fluent factory methods"? Better suggestions? EDIT: as suggested by one of answers, java.math.BigDecimal is a good example with its 'add', 'subtract' (etc) methods. Also: I noticed that there's this question (by Jon Skeet no less) that is sort of related (although it asks about specific name for method)

    Read the article

  • MVC design for archived data view

    - by Hemant Tank
    Implementation of a standard archive process in ASP.Net MVC. Backend SQL Server 2005 We've an existing web app built in MVC. We've an Entity "Claim" and it has some child entities like ClaimDetails, Files, etc... A pretty standard setup in DB. Each entity has its own table and are linked via FK. Now, we need to have an "Archive" feature in web app which will allow admin to archive a Claim and its child entities. An archived Claim shud become readonly when visited again. Here're some points on which I need your valued opinion - To keep it simple and scalable (for a few million records) for now we plan to simply add a bit field "Archived" to the Claim table in db. And change the behavior accordingly in the web app. We've a 'Manage claim' page which renders a bunch of diff views for Claim and its child entities. Now, for a readonly view we can either use the same views or have a separate set of views. What do you suggest? At controller level, we can identify archived claim and select which view to render. At model level, though it'd be great to be able to use the same model used for Manage Claim - but it might not get us the "text" of some lookup fields. For example, Claim.BrandId is rendered as a dropdown in Manage claim (requires only BrandId) but for readonly view we need 'BrandText'. Any existing ref or architecture level example would be great. Here's my prev SO post but its more about db level changes: Design a process to archive data (SQL Server 2005) Thank you.

    Read the article

  • How to Populate a 'Tree' structure 'Declaratively'

    - by mackenir
    I want to define a 'node' class/struct and then declare a tree of these nodes in code in such a way that the way the code is formatted reflects the tree structure, and there's not 'too much' boiler plate in the way. Note that this isn't a question about data structures, but rather about what features of C++ I could use to arrive at a similar style of declarative code to the example below. Possibly with C++0X this would be easier as it has more capabilities in the area of constructing objects and collections, but I'm using Visual Studio 2008. Example tree node type: struct node { string name; node* children; node(const char* name, node* children); node(const char* name); }; What I want to do: Declare a tree so its structure is reflected in the source code node root = node("foo", [ node("child1"), node("child2", [ node("grand_child1"), node("grand_child2"), node("grand_child3" ]), node("child3") ]); NB: what I don't want to do: Declare a whole bunch of temporary objects/colls and construct the tree 'backwards' node grandkids[] = node[3] { node("grand_child1"), node("grand_child2"), node("grand_child3" }; node kids[] = node[3] { node("child1"), node("child2", grandkids) node("child3") }; node root = node("foo", kids);

    Read the article

  • Drools - Doing Complex Stuff inside a Rule Condition or Consequence

    - by mfcabrera
    Hello, In my company we are planning to use Drools a BRE for couple of projects. Now we trying to define some best-practices. My question is what should be and shouldn't be done inside a Rule Condition/Consequence. Given that we can write Java directly or call methods (for example From a Global object in the Working Memory). Example. Given a Rule that evaluates a generic Object (e.g. Person) have property set to true. Now, that specific propertie can only be defined for that Object going to the database and fetching that info. So we have two ways of implementing that: Alternative A: Go to the database and fetch the object property (true/false, a code) Insert the Object in the working memory Evaluate the rule Alternative B: Insert a Global Object that has a method that connects to the database and check for the property for the given object. Insert the Object to eval in Working Memory In the rule, call the Global Object and perform the access to the database Which of those is considered better? I really like A, but sometimes B is more straightforward, however what would happen if something like a Exception from the Database is raised? I have seen the alternative B implemented in the Drools 5.0 Book from Packt Publishing,however they are doing a mocking and they don't talk about the actual implications of going to the database at all. Thank you,

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Boost program will not working on Linux

    - by Martin Lauridsen
    Hi SOF, I have this program which uses Boost::Asio for sockets. I pretty much altered some code from the Boost examples. The program compiles and runs just like it should on Windows in VS. However, when I compile the program on Linux and run it, I get a Segmentation fault. I posted the code here The command I use to compile it is this: c++ -I/appl/htopopt/Linux_x86_64/NTL-5.4.2/include -I/appl/htopopt/Linux_x86_64/boost_1_43_0/include mpqs.cpp mpqs_polynomial.cpp mpqs_host.cpp -o mpqs_host -L/appl/htopopt/Linux_x86_64/NTL-5.4.2/lib -lntl -L/appl/htopopt/Linux_x86_64/gmp-4.2.1/lib -lgmp -lm -L/appl/htopopt/Linux_x86_64/boost_1_43_0/lib -lboost_system -lboost_thread -static -lpthread By commenting out code, I have found out that I get the Segmentation fault due to the following line: boost::asio::io_service io_service; Can anyone provide any assistance, as to what may be the problem (and the solution)? Thanks! Edit: I tried changing the program to a minimal example, using no other libraries or headers, just boost/asio.hpp: #define DEBUG 0 #include <boost/asio.hpp> int main(int argc, char* argv[]) { boost::asio::io_service io_service; return 0; } I also removed other library inclusions and linking on compilation, however this minimal example still gives me a segmentation fault.

    Read the article

  • Google App engine Url Mapping using WSGIAppl and regx grouping Help Needed

    - by spidee
    Hi take this example from google docs class BrowseHandler(webapp.RequestHandler): > def get(self, category, product_id): > # Display product with given ID in the given category. > > > # Map URLs like /browse/(category)/(product_id) to > BrowseHandler. application = > webapp.WSGIApplication([(r'/browse/(.*)/(.*)', > BrowseHandler) > ], > debug=True) > > def main(): > run_wsgi_app(application) > > if __name__ == '__main__': > main() How can i change the regx groupings so that Product id is optional ie the url http://yourdomain.com/category will be sent to the browse handler in the current above example you must add a product id or at least the / after the category ie http://yourdomain.com/category/ r'/browse/(.)/(.)' Any ideas?

    Read the article

  • C/C++ macro/template blackmagic to generate unique name.

    - by anon
    Macros are fine. Templates are fine. Pretty much whatever it works is fine. The example is OpenGL; but the technique is C++ specific and relies on no knowledge of OpenGL. Precise problem: I want an expression E; where I do not have to specify a unique name; such that a constructor is called where E is defined, and a destructor is called where the block E is in ends. For example, consider: class GlTranslate { GLTranslate(float x, float y, float z); { glPushMatrix(); glTranslatef(x, y, z); } ~GlTranslate() { glPopMatrix(); } }; Manual solution: { GlTranslate foo(1.0, 0.0, 0.0); // I had ti give it a name ..... } // auto popmatrix Now, I have this not only for glTranslate, but lots of other PushAttrib/PopAttrib calls too. I would prefer not to have to come up with a unique name for each var. Is there some trick involving macros templates ... or something else that will automatically create a variable who's constructor is called at point of definition; and destructor called at end of block? Thanks!

    Read the article

  • ctrl+click or shift+click not always firing the onclick event

    - by Erik
    Hi, I recently discovered that different browsers handle the onclick event differently when the control of shift key is pressed. Same thing for following links with the middle mouse button. <a href="http://www.example.com/" onclick="alert('onclick');">go to example.com</a> Onclick browser support table Mouse Keyboard Chrome Firefox Safari Opera IE5.5 IE6 IE7 IE8 IE9 Left None yes yes yes yes yes yes yes yes yes Left Ctrl yes yes yes yes ? yes no no ? Left Shift yes yes yes yes ? yes yes yes ? Middle None yes no yes no ? N/A no no ? Can someone please fill in the question marks for me? Also; I'm wondering if the behaviour differs for each version of Chrome, Firefox, Safari and Opera. Finding a logical pattern in this behaviour would be even nicer, but I don't think there is :). Thanks a lot.

    Read the article

  • Expandable paragraphs with HTML and CSS

    - by user3704175
    I was wondering if anyone here would be as so kind as to help me out a bit. I am looking to make expandable paragraphs for my client's website. They would like to keep all of the content from their site, which is pretty massive, and they want a total overhaul of the design. They mainly wan tot keep it for SEO purposes. Anyhow, I thought it would be helpful for the both of use if there is some way to use expandable paragraphs, you know, with a "read more..." link after a certain line of text. I know that there are some JQuery and Java solutions for this, but we really would like to stay away from those options, if at all possible. When would like HTML and CSS, if we can. Here is kind of an example: HEADING HERE Paragraph with a bunch of text. I would like this to appear in a pre-determined line. For example, maybe the start of the paragraph goes on for, let's say, three lines and then we have the [read more...] When the visitor clicks "read more", we would like the rest of the content to just expand to reveal the article in its entirety. I would like for the content to already be on the page, so it just expands. I don't want it to be called in from another file or anything, if that makes sense. Thank you in advance for any and all help. It will be greatly appreciated! Testudo

    Read the article

  • ASP .NET Button event handlers do not fire on the first click, but on the second click after a PostB

    - by John
    Background: I am customizing an existing ASP .NET / C# application. It has it's own little "framework" and conventions for developers to follow when extending/customizing its functionality. I am currently extending some of it's administrative functionality, to which the framework provides a contract to enforce implementation of the GetAdministrationInterface() method, which returns System.Web.UI.Control. This method is called during the Page_Load() method of the page hosting the GUI interface. Problem: I have three buttons in my GUI, each of which have been assigned an Event Handler. My administration GUI loads up perfectly fine, but clicking any of the buttons doesn't do what I expect them to do. However, when I click them a second time, the buttons work. I placed breakpoints at the beginning of each event handler method and stepped through my code. On the first click, none of the event handlers were triggered. On the second click, they fired. Any ideas? Example of Button Definition (within GetAdministrationInterface) public override Control GetAdministrationInterface() { // more code... Button btn = new Button(); btn.Text = "Click Me!"; btn.Click += new EventHandler(Btn_Click); // more code... } Example of Event Handler Method Definition void Btn_Click(object sender, EventArgs e) { // Do Something } Page_Load Method that calls GetAdministrationInterface protected void Page_Load(object sender, System.EventArgs e) { if (!Page.IsAsync) { List<AdministrationInterface> interfaces = <DATABASE CALL>; foreach(AdministrationInteface ai in interfaces) { placeholderDiv.Controls.Add(ai.GetAdministrationInterface()); } } }

    Read the article

  • Proper QUuid usage in Qt ? (7-Zip DLL usage problems (QLibrary, QUuid GUID conversion, interfaces))

    - by whipsnap
    Hi, I'm trying to write a program that would use 7-Zip DLL for reading files from inside archive files (7z, zip etc). Here's where I'm so far: #include QtCore/QCoreApplication #include QLibrary #include QUuid #include iostream using namespace std; #include "7z910/CPP/7zip/Archive/IArchive.h" #include "7z910/CPP/7zip/IStream.h" #include "MyCom.h" // {23170F69-40C1-278A-1000-000110070000} QUuid CLSID_CFormat7z(0x23170F69, 0x40C1, 0x278A, 0x10, 0x00, 0x00, 0x01, 0x10, 0x07, 0x00, 0x00); typedef int (*CreateObjectFunc)( const GUID *clsID, const GUID *interfaceID, void **outObject); void readFileInArchive() { QLibrary myLib("7z.dll"); CreateObjectFunc myFunction = (CreateObjectFunc)myLib.resolve("CreateObject"); if (myFunction == 0) { cout outArchive; myFunction(&CLSID_CFormat7z, &IID_IOutArchive, (void **)&outArchive); } int main(int argc, char *argv[]) { QCoreApplication a(argc, argv); readFileInArchive(); return a.exec(); } Trying to build that in Qt Creator will lead to following error: cannot convert 'QUuid*' to 'const GUID*' in argument passing How should QUuid be correctly used in this context? Also, being a C++ and Qt newbie I haven't yet quite grasped templates or interfaces, so overall I'm having trouble getting through these first steps. If someone could give tips or even example code on how for example an image file could be extracted from ZIP file (to be shown in Qt GUI later on*), I would highly appreciate that. My main goal at the moment is to write a program with GUI for selecting archive files containing image files (PNG, JPG etc) and displaying those files one at a time in the GUI. A Qt based CDisplayEx in short.

    Read the article

  • How much is too much memory allocation in NDK?

    - by Maximus
    The NDK download page notes that, "Typical good candidates for the NDK are self-contained, CPU-intensive operations that don't allocate much memory, such as signal processing, physics simulation, and so on." I came from a C background and was excited to try to use the NDK to operate most of my OpenGL ES functions and any native functions related to physics, animation of vertices, etc... I'm finding that I'm relying quite a bit on Native code and wondering if I may be making some mistakes. I've had no trouble with testing at this point, but I'm curious if I may run into problems in the future. For example, I have game struct defined (somewhat like is seen in the San-Angeles example). I'm loading vertex information for objects dynamically (just what is needed for an active game area) so there's quite a bit of memory allocation happening for vertices, normals, texture coordinates, indices and texture graphic data... just to name the essentials. I'm quite careful about freeing what is allocated between game areas. Would I be safer setting some caps on array sizes or should I charge bravely forward as I'm going now?

    Read the article

  • How do I check to see if a scalar has a compiled regex in it with Perl?

    - by Robert P
    Let's say I have a subroutine/method that a user can call to test some data that (as an example) might look like this: sub test_output { my ($self, $test) = @_; my $output = $self->long_process_to_get_data(); if ($output =~ /\Q$test/) { $self->assert_something(); } else { $self->do_something_else(); } } Normally, $test is a string, which we're looking for anywhere in the output. This was an interface put together to make calling it very easy. However, we've found that sometimes, a straight string is problematic - for example, a large, possibly varying number of spaces...a pattern, if you will. Thus, I'd like to let them pass in a regex as an option. I could just do: $output =~ $test if I could assume that it's always a regex, but ah, but the backwards compatibility! If they pass in a string, it still needs to test it like a raw string. So in that case, I'll need to test to see if $test is a regex. Is there any good facility for detecting whether or not a scalar has a compiled regex in it?

    Read the article

  • lapply slower than for-loop when used for a BiomaRt query. Is that expected?

    - by ptocquin
    I would like to query a database using BiomaRt package. I have loci and want to retrieve some related information, let say description. I first try to use lapply but was surprise by the time needed for the task to be performed. I thus tried a more basic for-loop and get a faster result. Is that expected or is something wrong with my code or with my understanding of apply ? I read other posts dealing with *apply vs for-loop performance (Here, for example) and I was aware that improved performance should not be expected but I don't understand why performance here is actually lower. Here is a reproducible example. 1) Loading the library and selecting the database : library("biomaRt") athaliana <- useMart("plants_mart_14") athaliana <- useDataset("athaliana_eg_gene",mart=athaliana) 2) Querying the database : loci <- c("at1g01300", "at1g01800", "at1g01900", "at1g02335", "at1g02790", "at1g03220", "at1g03230", "at1g04040", "at1g04110", "at1g05240" ) I create a function for the use in lapply : foo <- function(loci) { getBM("description","tair_locus",loci,athaliana) } When I use this function on the first element : > system.time(foo(cwp_loci[1])) utilisateur système écoulé 0.020 0.004 1.599 When I use lapply to retrieve the data for all values : > system.time(lapply(loci, foo)) utilisateur système écoulé 0.220 0.000 16.376 I then created a new function, adding a for-loop : foo2 <- function(loci) { for (i in loci) { getBM("description","tair_locus",loci[i],athaliana) } } Here is the result : > system.time(foo2(loci)) utilisateur système écoulé 0.204 0.004 10.919 Of course, this will be applied to a big list of loci, so the best performing option is needed. I thank you for assistance. EDIT Following recommendation of @MartinMorgan Simply passing the vector loci to getBM greatly improves the query efficiency. Simpler is better. > system.time(lapply(loci, foo)) utilisateur système écoulé 0.236 0.024 110.512 > system.time(foo2(loci)) utilisateur système écoulé 0.208 0.040 116.099 > system.time(foo(loci)) utilisateur système écoulé 0.028 0.000 6.193

    Read the article

< Previous Page | 359 360 361 362 363 364 365 366 367 368 369 370  | Next Page >