Search Results

Search found 45013 results on 1801 pages for 'example'.

Page 363/1801 | < Previous Page | 359 360 361 362 363 364 365 366 367 368 369 370  | Next Page >

• Is there any point in using a volatile long?

  - by Adamski

  I occasionally use a volatile instance variable in cases where I have two threads reading from / writing to it and don't want the overhead (or potential deadlock risk) of taking out a lock; for example a timer thread periodically updating an int ID that is exposed as a getter on some class: public class MyClass { private volatile int id; public MyClass() { ScheduledExecutorService execService = Executors.newScheduledThreadPool(1); execService.scheduleAtFixedRate(new Runnable() { public void run() { ++id; } }, 0L, 30L, TimeUnit.SECONDS); } public int getId() { return id; } } My question: Given that the JLS only guarantees that 32-bit reads will be atomic is there any point in ever using a volatile long? (i.e. 64-bit). Caveat: Please do not reply saying that using volatile over synchronized is a case of pre-optimisation; I am well aware of how / when to use synchronized but there are cases where volatile is preferable. For example, when defining a Spring bean for use in a single-threaded application I tend to favour volatile instance variables, as there is no guarantee that the Spring context will initialise each bean's properties in the main thread.

  Read the article

• Facebook style messaging system schema design

  - by Jamie

  Hi all, I'm looking to implement a facebook style messaging system (thread messages) into a site of mine. Do you think this schema markup looks okay? Doctrine schema.yml: UserMessage: tableName: user_message actAs: [Timestampable] columns: id: { type: integer(10), primary: true, autoincrement: true } sender_id : { type: integer(10), notnull: true } sender_read: { type: boolean, default: 1 } subject: { type: string(255), notnull: true } message: { type: string(1000), notnull: true } hash: { type: string(32), notnull: true } relations: UserMessageRecipient as Recipient: type: many local: id foreign: message_id UserMessageReply as Reply: type: many local: id foreign: message_id UserMessageReply: tableName: user_message_reply columns: id: { type: integer(10), primary: true, autoincrement: true } user_message_id as message_id: { type: integer(10), notnull: true } message: { type: string(1000), notnull: true } sender_id: { type: integer(10), notnull: true } relations: UserMessage as Message: local: message_id foreign: id type: one UserMessageRecipient: tableName: user_message_recipient actAs: [Timestampable] columns: id: { type: integer(10), primary: true, autoincrement: true } user_message_id as message_id: { type: integer(10), notnull: true } recipient_id: { type: integer(10), notnull: true } recipient_read: { type: boolean, default: 0 } When I a new reply is made,i'll make sure the boolean for "recipient_read" for each recipient is set to false and of course i'll make sure sender_read is set to false too. I'm using a hash for the URL: http://example.com/user/messages/aadeb18f8bdaea49882ec4d2a8a3c062 (As the id will be starting from 1, i don't wish to have http://example.com/user/messages/1. Yeah, I could start incrementing from a bigger number, but i'd prefer to start at 1.) Is this a good way to go about it? Your thoughts and suggestions would be hugely appreciated. Thanks guys!

  Read the article

• Using list() to extract a data.table inside of a function

  - by Nathan VanHoudnos

  I must admit that the data.table J syntax confuses me. I am attempting to use list() to extract a subset of a data.table as a data.table object as described in Section 1.4 of the data.table FAQ, but I can't get this behavior to work inside of a function. An example: require(data.table) ## Setup some test data set.seed(1) test.data <- data.table( X = rnorm(10), Y = rnorm(10), Z = rnorm(10) ) setkey(test.data, X) ## Notice that I can subset the data table easily with literal names test.data[, list(X,Y)] ## X Y ## 1: -0.8356286 -0.62124058 ## 2: -0.8204684 -0.04493361 ## 3: -0.6264538 1.51178117 ## 4: -0.3053884 0.59390132 ## 5: 0.1836433 0.38984324 ## 6: 0.3295078 1.12493092 ## 7: 0.4874291 -0.01619026 ## 8: 0.5757814 0.82122120 ## 9: 0.7383247 0.94383621 ## 10: 1.5952808 -2.21469989 I can even write a function that will return a column of the data.table as a vector when passed the name of a column as a character vector: get.a.vector <- function( my.dt, my.column ) { ## Step 1: Convert my.column to an expression column.exp <- parse(text=my.column) ## Step 2: Return the vector return( my.dt[, eval(column.exp)] ) } get.a.vector( test.data, 'X') ## [1] -0.8356286 -0.8204684 -0.6264538 -0.3053884 0.1836433 0.3295078 ## [7] 0.4874291 0.5757814 0.7383247 1.5952808 But I cannot pull a similar trick for list(). The inline comments are the output from the interactive browser() session. get.a.dt <- function( my.dt, my.column ) { ## Step 1: Convert my.column to an expression column.exp <- parse(text=my.column) ## Step 2: Enter the browser to play around browser() ## Step 3: Verity that a literal X works: my.dt[, list(X)] ## << not shown >> ## Step 4: Attempt to evaluate the parsed experssion my.dt[, list( eval(column.exp)] ## Error in `rownames<-`(`*tmp*`, value = paste(format(rn, right = TRUE), (from data.table.example.R@1032mCJ#7) : ## length of 'dimnames' [1] not equal to array extent return( my.dt[, list(eval(column.exp))] ) } get.a.dt( test.data, "X" ) What am I missing? Update: Due to some confusion as to why I would want to do this I wanted to clarify. My use case is when I need to access a data.table column when when I generate the name. Something like this: set.seed(2) test.data[, X.1 := rnorm(10)] which.column <- 'X' new.column <- paste(which.column, '.1', sep="") get.a.dt( test.data, new.column ) Hopefully that helps.

  Read the article

• Google App engine Url Mapping using WSGIAppl and regx grouping Help Needed

  - by spidee

  Hi take this example from google docs class BrowseHandler(webapp.RequestHandler): > def get(self, category, product_id): > # Display product with given ID in the given category. > > > # Map URLs like /browse/(category)/(product_id) to > BrowseHandler. application = > webapp.WSGIApplication([(r'/browse/(.*)/(.*)', > BrowseHandler) > ], > debug=True) > > def main(): > run_wsgi_app(application) > > if __name__ == '__main__': > main() How can i change the regx groupings so that Product id is optional ie the url http://yourdomain.com/category will be sent to the browse handler in the current above example you must add a product id or at least the / after the category ie http://yourdomain.com/category/ r'/browse/(.)/(.)' Any ideas?

  Read the article

• summing functions handles in matlab

  - by user552231

  Hi I am trying to sum two function handles, but it doesn't work. for example: y1=@(x)(x*x); y2=@(x)(x*x+3*x); y3=y1+y2 The error I receive is "??? Undefined function or method 'plus' for input arguments of type 'function_handle'." This is just a small example, in reality I actually need to iteratively sum about 500 functions that are dependent on each other. EDIT The solution by Clement J. indeed works but I couldn't manage to generalize this into a loop and ran into a problem. I have the function s=@(x,y,z)((1-exp(-x*y)-z)*exp(-x*y)); And I have a vector v that contains 536 data points and another vector w that also contains 536 data points. My goal is to sum up s(v(i),y,w(i)) for i=1...536 Thus getting one function in the variable y which is the sum of 536 functions. The syntax I tried in order to do this is: sum=@(y)(s(v(1),y,z2(1))); for i=2:536 sum=@(y)(sum+s(v(i),y,z2(i))) end

  Read the article

• How much is too much memory allocation in NDK?

  - by Maximus

  The NDK download page notes that, "Typical good candidates for the NDK are self-contained, CPU-intensive operations that don't allocate much memory, such as signal processing, physics simulation, and so on." I came from a C background and was excited to try to use the NDK to operate most of my OpenGL ES functions and any native functions related to physics, animation of vertices, etc... I'm finding that I'm relying quite a bit on Native code and wondering if I may be making some mistakes. I've had no trouble with testing at this point, but I'm curious if I may run into problems in the future. For example, I have game struct defined (somewhat like is seen in the San-Angeles example). I'm loading vertex information for objects dynamically (just what is needed for an active game area) so there's quite a bit of memory allocation happening for vertices, normals, texture coordinates, indices and texture graphic data... just to name the essentials. I'm quite careful about freeing what is allocated between game areas. Would I be safer setting some caps on array sizes or should I charge bravely forward as I'm going now?

  Read the article

• Capturing wildcards in java generics

  - by Rollerball

  From this orcale java tutorial: The WildcardError example produces a capture error when compiled: import java.util.List; public class WildcardError { void foo(List<?> i) { i.set(0, i.get(0)); } } After this error demonstration, they fix the problem by using a helper method: public class WildcardFixed { void foo(List<?> i) { fooHelper(i); } // Helper method created so that the wildcard can be captured // through type inference. private <T> void fooHelper(List<T> l) { l.set(0, l.get(0)); } } First, they say that the list input parameter (i) is seen as an Object: In this example, the compiler processes the i input parameter as being of type Object. Why then i.get(0) does not return an Object? if it was already passed in as such? Furthermore what is the point of using a <?> when then you have to use an helper method using <T>. Would not be better using directly which can be inferred?

  Read the article

• Designing model/database for distance between any two locations (that may change)

  - by Yo Ludke

  We should create a web app which has a number of events each with a location (created as user-generated content, so the number of events will be increasingly large). The distance between any events should be available, for example to determine the top 5 closest events and such things. Users may change the locations of events. How should one design the database/model for this (in a scalable way)? I was thinking of doing it with a "distance table" (like so http://www.deutschland-tourist.info/images/entfernungstabelle.gif). Then every time, if a location changes, one row and one column have to be recalculated (this should be done with a delayed job, because it is not important to have the changes instantly). Possible problems in Scaling: Database to large (n² items for n events), too much calculation to be done. For example we should see if this is okay for 10.000 users. If each has created just one event, then this would be 100 million integers... Do you think this would be a good way to do it efficiently? How could one realize such a distance table with an rails model? Is it possible with a SQL databse? Would you start other approaches?

  Read the article

• Multiple submits in an HTML form

  - by StackOverflowNewbie

  I have an HTML form that needs multiple submit buttons, like this: <input type="submit" name="foo" value="1"/> <input type="submit" name="foo" value="2"/> <input type="submit" name="foo" value="3"/> The problem is that I want it to display on the button something other than what is in the value attribute (in the example above: 1, 2, 3). For example, I want to show "Bar" for the button with value="1". Is this possible? I've considered using the <button> tag, like this: <button name="foo" value="1">Bar</button> The problem with using <button> (from w3schools): If you use the element in an HTML form, different browsers may submit different values. Internet Explorer, prior version 9, will submit the text between the and tags, while other browsers will submit the content of the value attribute. Use the element to create buttons in an HTML form. Thoughts?

  Read the article

• Call any webservice from the same $.ajax() call

  - by Andreas

  Hi! Im creating a usercontrol which is controled client side, it has an javascript-file attatched to it. This control has a button and upon click a popup appears, this popup shows a list of my domain entities. My entities are fetched using a call to a webservice. Im trying to get this popup usercontrol to work on all my entities, therefore i have the need to call any webservice needed (one per entity for example) with the same $.ajax() call. I have hiddenfields for the webservice url in my usercontrol which you specify in the markup via a property. So far so good. The problem arise when i need some additional parameters to the webservice (other than pagesize and pageindex). Say for example that one webservice takes an additional parameter "Date". At the moment i have my parameters set up like this: var params = JSON.stringify({ pageSize: _this.pageSize, pageIndex: _this.pageIndex }); and then i call the webservice like so: $.ajax({ webserviceUrl, params, function(result) { //some logic }); }); What i want to do is to be able to add my extra parameters (Date) to "Param" when needed, the specification of these parameters will be done via properties of the usercontrol. So, bottom line, i have a set of default parameters and want to dynamically add optional extra parameters. How is this possible? Thanks in advance.

  Read the article

• ASP .NET Button event handlers do not fire on the first click, but on the second click after a PostB

  - by John

  Background: I am customizing an existing ASP .NET / C# application. It has it's own little "framework" and conventions for developers to follow when extending/customizing its functionality. I am currently extending some of it's administrative functionality, to which the framework provides a contract to enforce implementation of the GetAdministrationInterface() method, which returns System.Web.UI.Control. This method is called during the Page_Load() method of the page hosting the GUI interface. Problem: I have three buttons in my GUI, each of which have been assigned an Event Handler. My administration GUI loads up perfectly fine, but clicking any of the buttons doesn't do what I expect them to do. However, when I click them a second time, the buttons work. I placed breakpoints at the beginning of each event handler method and stepped through my code. On the first click, none of the event handlers were triggered. On the second click, they fired. Any ideas? Example of Button Definition (within GetAdministrationInterface) public override Control GetAdministrationInterface() { // more code... Button btn = new Button(); btn.Text = "Click Me!"; btn.Click += new EventHandler(Btn_Click); // more code... } Example of Event Handler Method Definition void Btn_Click(object sender, EventArgs e) { // Do Something } Page_Load Method that calls GetAdministrationInterface protected void Page_Load(object sender, System.EventArgs e) { if (!Page.IsAsync) { List<AdministrationInterface> interfaces = <DATABASE CALL>; foreach(AdministrationInteface ai in interfaces) { placeholderDiv.Controls.Add(ai.GetAdministrationInterface()); } } }

  Read the article

• string comparision and counting the key in target [closed]

  - by mesun

  Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

  Read the article

• Inversion of control domain objects construction problem

  - by Andrey

  Hello! As I understand IoC-container is helpful in creation of application-level objects like services and factories. But domain-level objects should be created manually. Spring's manual tells us: "Typically one does not configure fine-grained domain objects in the container, because it is usually the responsibility of DAOs and business logic to create/load domain objects." Well. But what if my domain "fine-grained" object depends on some application-level object. For example I have an UserViewer(User user, UserConstants constants) class. There user is domain object which cannot be injected, but UserViewer also needs UserConstants which is high-level object injected by IoC-container. I want to inject UserConstants from the IoC-container, but I also need a transient runtime parameter User here. What is wrong with the design? Thanks in advance! UPDATE It seems I was not precise enough with my question. What I really need is an example how to do this: create instance of class UserViewer(User user, UserService service), where user is passed as the parameter and service is injected from IoC. If I inject UserViewer viewer then how do I pass user to it? If I create UserViewer viewer manually then how do I pass service to it?

  Read the article

• Proper QUuid usage in Qt ? (7-Zip DLL usage problems (QLibrary, QUuid GUID conversion, interfaces))

  - by whipsnap

  Hi, I'm trying to write a program that would use 7-Zip DLL for reading files from inside archive files (7z, zip etc). Here's where I'm so far: #include QtCore/QCoreApplication #include QLibrary #include QUuid #include iostream using namespace std; #include "7z910/CPP/7zip/Archive/IArchive.h" #include "7z910/CPP/7zip/IStream.h" #include "MyCom.h" // {23170F69-40C1-278A-1000-000110070000} QUuid CLSID_CFormat7z(0x23170F69, 0x40C1, 0x278A, 0x10, 0x00, 0x00, 0x01, 0x10, 0x07, 0x00, 0x00); typedef int (*CreateObjectFunc)( const GUID *clsID, const GUID *interfaceID, void **outObject); void readFileInArchive() { QLibrary myLib("7z.dll"); CreateObjectFunc myFunction = (CreateObjectFunc)myLib.resolve("CreateObject"); if (myFunction == 0) { cout outArchive; myFunction(&CLSID_CFormat7z, &IID_IOutArchive, (void **)&outArchive); } int main(int argc, char *argv[]) { QCoreApplication a(argc, argv); readFileInArchive(); return a.exec(); } Trying to build that in Qt Creator will lead to following error: cannot convert 'QUuid*' to 'const GUID*' in argument passing How should QUuid be correctly used in this context? Also, being a C++ and Qt newbie I haven't yet quite grasped templates or interfaces, so overall I'm having trouble getting through these first steps. If someone could give tips or even example code on how for example an image file could be extracted from ZIP file (to be shown in Qt GUI later on*), I would highly appreciate that. My main goal at the moment is to write a program with GUI for selecting archive files containing image files (PNG, JPG etc) and displaying those files one at a time in the GUI. A Qt based CDisplayEx in short.

  Read the article

• python list/dict property best practice

  - by jterrace

  I have a class object that stores some properties that are lists of other objects. Each of the items in the list has an identifier that can be accessed with the id property. I'd like to be able to read and write from these lists but also be able to access a dictionary keyed by their identifier. Let me illustrate with an example: class Child(object): def __init__(self, id, name): self.id = id self.name = name class Teacher(object): def __init__(self, id, name): self.id = id self.name = name class Classroom(object): def __init__(self, children, teachers): self.children = children self.teachers = teachers classroom = Classroom([Child('389','pete')], [Teacher('829','bob')]) This is a silly example, but it illustrates what I'm trying to do. I'd like to be able to interact with the classroom object like this: #access like a list print classroom.children[0] #append like it's a list classroom.children.append(Child('2344','joe')) #delete from like it's a list classroom.children.pop(0) But I'd also like to be able to access it like it's a dictionary, and the dictionary should be automatically updated when I modify the list: #access like a dict print classroom.childrenById['389'] I realize I could just make it a dict, but I want to avoid code like this: classroom.childrendict[child.id] = child I also might have several of these properties, so I don't want to add functions like addChild, which feels very un-pythonic anyway. Is there a way to somehow subclass dict and/or list and provide all of these functions easily with my class's properties? I'd also like to avoid as much code as possible.

  Read the article

• How to start matching and saving matched from exact point in a text

  - by yuliya

  I have a text and I write a parser for it using regular expressions and perl. I can match what I need with two empty lines (I use regexp), because there is a pattern that allows recognize blocks of text after two empty lines. But the problem is that the whole text has Introduction part and some text in the end I do not need. Here is a code which matches text when it finds two empty lines #!/usr/bin/perl use strict; use warnings; my $file = 'first'; open(my $fh, '<', $file); my $empty = 0; my $block_num = 1; open(OUT, '>', $block_num . '.txt'); while (my $line = <$fh>) { chomp ($line); if ($line =~ /^\s*$/) { $empty++; } elsif ($empty == 2) { close(OUT); open(OUT, '>', ++$block_num . '.txt'); $empty = 0; } else { $empty = 0;} print OUT "$line\n"; } close(OUT); This is example of the text I need (it's really small :)) this is file example I think that I need to iterate over the text till the moment it will find the word LOREM IPSUM with regexps this kind "/^LOREM IPSUM/", because it is the point from which needed text starts(and save the text in one file when i reach the word). And I need to finish iterating over the text when INDEX word is fount or save the text in separate file. How could I implement it. Should I use next function to proceed with lines or what? BR, Yuliya

  Read the article

• error catching exception while System.out.print

  - by user1702633

  I have 2 classes, one that implements a double lookup( int i); and one where I use that lookup(int i) in solving a question, or in this case printing the lookup values. This case is for an array. So I read the exception documentation or google/textbook and come with the following code: public double lookup(int i) throws Exception { if( i > numItems) throw new Exception("out of bounds"); return items[i]; } and take it over to my class and try to print my set, where set is a name of the object type I define in the class above. public void print() { for (int i = 0; i < set.size() - 1; i++) { System.out.print(set.lookup(i) + ","); } System.out.print(set.lookup(set.size())); } I'm using two print()'s to avoid the last "," in the print, but am getting an unhandled exception Exception (my exception's name was Exception) I think I have to catch my exception in my print() but cannot find the correct formatting online. Do I have to write catch exception Exception? because that gives me a syntax error saying invalid type on catch. Sources like http://docs.oracle.com/javase/tutorial/essential/exceptions/ are of little help to me, I'm can't seem to grasp what the text is telling me. I'm also having trouble finding sources with multiple examples where I can actually understand the coding in the examples. so could anybody give me a source/example for the above catch phrase and perhaps a decent source of examples for new Java programmers? my book is horrendous and I cannot seem to find an understandable example for the above catch phrase online.

  Read the article

• The most expressive web app programming language/framework combination?

  - by Thor

  When concerned about creating web applications, I often ask myself how I can make the code easy to read and above all; how to make it easy to maintain. There has been alot of inventions in the last couple of years with probably millions of programmers sharing these thoughts. So, lets test if we can squeeze the distilled knowledge of millions of StackOverflow users for this ultimate answer: Which language/framework combination in the world right now is the most expressive to do common tasks? Please provide a simple example of simplicity, add a link to more information about the language, and no more than one entry per language/framework combination. Specifications: "Web application" in this context refers to applications that runs on a server and outputs HTML/Javascript/CSS for rendering on a client browser. Any server operating system is ok. "Language/Framework combination" can for example be like Java+Struts or Java+SpringWeb or Perl+CGI or Java+ZK "Most expressive" in this context is meant to be minimal code to do common tasks. "Common tasks" include simple output/input, i.e. form specifying, displaying and processing, as well as simply styling of output. I am more concerned about minimality than about complete functionality. A decent language design can have great potential even though it is not complete.

  Read the article

• javac will not compile enum, ( Windows Sun 1.6 --> OpenJDK 1.6)

  - by avgvstvs

  package com.scheduler.process; public class Process { public enum state { NOT_SUBMITTED, SUBMITTED, BLOCKED, READY, RUNNING, COMPLETED } private state currentState; public state getCurrentState() { return currentState; } public void setCurrentState(state currentState) { this.currentState = currentState; } } package com.scheduler.machine; import com.scheduler.process.Process; import com.scheduler.process.Process.state; public class Machine { com.scheduler.process.Process p = new com.scheduler.process.Process(); state s = state.READY; //fails if I don't also explicitly import Process.state p.setCurrentState(s); //says I need a declarator id after 's'... this is wrong. p.setCurrentState(state.READY); } Modified the example to try and direct to the issue. I cannot change the state on this code. Eclipse suggests importing Process.state like I had on my previous example, but this doesn't work either. This allows state s = state.READY but the call to p.setCurrentState(s); fails as does p.setCurrentState(state.READY);

  Read the article

• OCaml delimiters and scopes

  - by Jack

  Hello! I'm learning OCaml and although I have years of experience with imperative programming languages (C, C++, Java) I'm getting some problems with delimiters between declarations or expressions in OCaml syntax. Basically I understood that I have to use ; to concatenate expressions and the value returned by the sequence will be the one of last expression used, so for example if I have exp1; exp2; exp3 it will be considered as an expression that returns the value of exp3. Starting from this I could use let t = something in exp1; exp2; exp3 and it should be ok, right? When am I supposed to use the double semicol ;;? What does it exactly mean? Are there other delimiters that I must use to avoid syntax errors? I'll give you an example: let rec satisfy dtmc state pformula = match (state, pformula) with (state, `Next sformula) -> let s = satisfy_each dtmc sformula and adder a state = let p = 0.; for i = 0 to dtmc.matrix.rows do p <- p +. get dtmc.matrix i state.index done; a +. p in List.fold_left adder 0. s | _ -> [] It gives me syntax error on | but I don't get why.. what am I missing? This is a problem that occurs often and I have to try many different solutions until it suddently works :/ A side question: declaring with let instead that let .. in will define a var binding that lasts whenever after it has been defined? What I basically ask is: what are the delimiters I have to use and when I have to use them. In addition are there differences I should consider while using the interpreter ocaml instead that the compiler ocamlc? Thanks in advance!

  Read the article

• Eclipse > Javascript > Code highlighting not working with Object Notation

  - by Redsandro

  I am using Eclipse Helios with PDT, and when I am editing JavaScript files with the default JavaScript Editor (JSDT), code highlighting (Mark Occurrences) is not working for half of the code, for example JSON-style (or Object Literal if you will) declarations. Little example: Foo = {}; Foo.Bar = Foo.Bar || {}; Foo.Bar = { bar: function(str) { alert(str) }, baz: function(str) { this.bar(str); // This bar *is* highlighted though } }; Foo.Bar.baz('text'); No Bar, bar or baz is highlighted. For now, I humbly edit the JavaScript part of projects in Notepad++ because it just highlights every occurrence of whatever is currently selected. Is there a common practice for Eclipse JavaScript developers to get code highlighting work correctly, using the popular Object Literal notation? An option or update I missed? -update- I have found that code highlighting depends on the code being properly outlined. Altough commonly used, Object Literal outlining still seems rare in javascript editors. the Spket Javascript Editor does partial Object Literal outlining, and the Aptana Javascript Editor does full Object Literal outlining. But both loses other important functionality. A quest for the editor with the least loss of functionality is currently in progress in this question.

  Read the article

• Angular JS pagination after data loaded

  - by Federico Bucchi

  do you have any example of Angular JS elements pagination loaded from I file? I found this example: http://jsfiddle.net/SAWsA/11/ Now, instead of having this: $scope.items = [ {"id":"1","name":"name 1","description":"description 1","field3":"field3 1","field4":"field4 1","field5 ":"field5 1"}, {"id":"2","name":"name 2","description":"description 1","field3":"field3 2","field4":"field4 2","field5 ":"field5 2"}, {"id":"3","name":"name 3","description":"description 1","field3":"field3 3","field4":"field4 3","field5 ":"field5 3"}, {"id":"4","name":"name 4","description":"description 1","field3":"field3 4","field4":"field4 4","field5 ":"field5 4"}, {"id":"5","name":"name 5","description":"description 1","field3":"field3 5","field4":"field4 5","field5 ":"field5 5"}, {"id":"6","name":"name 6","description":"description 1","field3":"field3 6","field4":"field4 6","field5 ":"field5 6"}, {"id":"7","name":"name 7","description":"description 1","field3":"field3 7","field4":"field4 7","field5 ":"field5 7"}, {"id":"8","name":"name 8","description":"description 1","field3":"field3 8","field4":"field4 8","field5 ":"field5 8"}, {"id":"9","name":"name 9","description":"description 1","field3":"field3 9","field4":"field4 9","field5 ":"field5 9"}, {"id":"10","name":"name 10","description":"description 1","field3":"field3 10","field4":"field4 10","field5 ":"field5 10"}, {"id":"11","name":"name 11","description":"description 1","field3":"field3 11","field4":"field4 11","field5 ":"field5 11"}, {"id":"12","name":"name 12","description":"description 1","field3":"field3 12","field4":"field4 12","field5 ":"field5 12"}, {"id":"13","name":"name 13","description":"description 1","field3":"field3 13","field4":"field4 13","field5 ":"field5 13"}, {"id":"14","name":"name 14","description":"description 1","field3":"field3 14","field4":"field4 14","field5 ":"field5 14"}, {"id":"15","name":"name 15","description":"description 1","field3":"field3 15","field4":"field4 15","field5 ":"field5 15"}, {"id":"16","name":"name 16","description":"description 1","field3":"field3 16","field4":"field4 16","field5 ":"field5 16"}, {"id":"17","name":"name 17","description":"description 1","field3":"field3 17","field4":"field4 17","field5 ":"field5 17"}, {"id":"18","name":"name 18","description":"description 1","field3":"field3 18","field4":"field4 18","field5 ":"field5 18"}, {"id":"19","name":"name 19","description":"description 1","field3":"field3 19","field4":"field4 19","field5 ":"field5 19"}, {"id":"20","name":"name 20","description":"description 1","field3":"field3 20","field4":"field4 20","field5 ":"field5 20"} ]; I have to use something generated by: $http.get('/json/mocks/apps/applications.json') .then(function (result) { $scope.items = result.data.applications; }); How would you create the pagination waiting for the data loaded from $http.get?

  Read the article

• How to send KeyEvents through an input method service to a Dialog, or a Spinner menu?

  - by shutdown11

  I'm trying to implement an input method service that receives intents sent by a remote client, and in response to those sends an appropriate KeyEvent. I'm using in the input method service this method private void keyDownUp(int keyEventCode) { getCurrentInputConnection().sendKeyEvent( new KeyEvent(KeyEvent.ACTION_DOWN, keyEventCode)); getCurrentInputConnection().sendKeyEvent( new KeyEvent(KeyEvent.ACTION_UP, keyEventCode)); } to send KeyEvents as in the Simple Sofykeyboard Sample, and it works in the home, in Activities... but it doesn't works when a Dialog or the menu of a Spinner is in foreground. The events is sent to the parent activity behind the Dialog. Is there any way to send keys and control the device like using the hardware keys from an input method? Better explanation on what I'm trying to do: I am kind of writng an Input Method that allows to control the device from remote. I write in a client (a java application on my desktop pc) a command (for example "UP"), a server on the device with sendBroadcast() sends the intent with the information, and a receiver in the input method gets it and call keyDownUp with the keycode of the DPAD_UP key. It generally works, but when I go to an app that shows a dialog, the keyDownUp method don't sends the key event to the dialog, for example for select the yes or not buttons, but it keeps to control the activty behind the Dialog.

  Read the article

• Using virtualization infrastructure for J2EE application distribution- viable alternative?

  - by Dan

  Our company builds custom J2EE web solutions. At the moment, we use standard J2EE distribution mechanisms (ear/war archives). Application servers are generally administered by our clients' IT departments and since we do not have complete control over the environment, a lot of entropy can be introduced into the solution. For example: latest app. server patch not applied conflicting third party libraries inside the app. server root server runtime and tuning parameters not configured (for example, number of connections in database pool) We are looking into using virtualization infrastructure for J2EE application distribution. Instead of sending the ear/war archive, we’d send image with application server node and our application preinstalled. Some of the benefits are same as using with using virtualization infrastructure in general, namely better use of hardware resources. For us, it reduces the entropy of hosting infrastructure - distributing VM should be less affected by hosting environment. So far, the downside I see can be in application server licenses, here they will have to use dedicated servers for our solution, but this is generally already done that way. Also, there is a complexity with maintaining virtualization infrastructure, but this is often something IT departments have more experience with than with administering and fine-tuning J2EE solutions. Anyone has experience with this model? What are the downsides? Will we not just replace one type of complexity with other?

  Read the article

• Dealing with image upload on server

  - by user1073320

  I have got a the following problem: I have got multi-step form where in one step user upload image to server and then few steps further supplies other information, when this information is invalid no data should be commited - also the image should be deleted. I was thinking about PHP session, but I've read here PHP - Store Images in SESSION data? that it is inefficient way. Every time you proceed step in the form the image is reloaded (in the session) and as somebody mentioned "You will want it to only be as big as it needs to be and you need to delete it as soon as you don't need it because large pieces of information in the session will slow down the session startup." - here i got a question: will it slow down the stratup the session of user who upload file or sessions of all users? I have to mention that I'm looking for solution that doesn't rely on operating system scripts (cron or etc) - I have no permission to run such scripts. The perfect solution for me would be: saving image on disk (for example in some folder named after session id) then after the latest step of form move this image or delete depending on form validation. If user unexpectedly destroy the session (for example closing the browser) of course the folder with image should be deleted. In nutshell I need somethig like callback to event "destroying session".

  Read the article

< Previous Page | 359 360 361 362 363 364 365 366 367 368 369 370  | Next Page >