Search Results

Search found 20092 results on 804 pages for 'python import'.

Page 363/804 | < Previous Page | 359 360 361 362 363 364 365 366 367 368 369 370  | Next Page >

• Is there a programmatic way to transform a sequence of image files into a PDF?

  - by Salim Fadhley

  I have a sequence of JPG images. Each of the scans is already cropped to the exact size of one page. They are sequential pages of a valuable and out of print book. The publishing application requires that these pages be submitted as a single PDF file. I could take each of these images and just past them into a word-processor (e.g. OpenOffice) - unfortunately the problem here is that it's a very big book and I've got quite a few of these books to get through. It would obviously be time-consuming. This is volunteer work! My second idea was to use LaTeX - I could make a very simple document that consists of nothing more than a series of in-line image includes. I'm sure that this approach could be made to work, it's just a little on the complex side for something which seems like a very simple job. It occurred to me that there must be a simpler way - so any suggestions? I'm on Ubuntu 9.10, my primary programming language is Python, but if the solution is super-simple I'd happily adopt any technology that works.

  Read the article

• why does cx_oracle execute() not like my string now?

  - by Frank Stallone

  I've downloaded cx_oracle some time ago and wrote a script to convert data to XML. I've had to reisntall my OS and grabbed the latest version of cx_Oracle (5.0.3) and all of the sudden my code is broken. The first thing was that cx_Oracle.connect wanted unicode rather string for the username and password, that was very easy to fix. But now it keeps failing on the cursor.execute and tells me my string is not a string even when type() tells me it is a string. Here is a test script I initally used ages ago and worked fine on my old version but does not work on cx_Oracle now. import cx_Oracle ip = 'url.to.oracle' port = 1521 SID = 'mysid' dsn_tns = cx_Oracle.makedsn(ip, port, SID) connection = cx_Oracle.connect(u'name', u'pass', dsn_tns) cursor = connection.cursor() cursor.arraysize = 50 sql = "select isbn, title_code from core_isbn where rownum<=20" print type(sql) cursor.execute(sql) for isbn, title_code in cursor.fetchall(): print "Values from DB:", isbn, title_code cursor.close() connection.close() When I run that I get: Traceback (most recent call last): File "C:\NetBeansProjects\Python\src\db_temp.py", line 48, in cursor.execute(sql) TypeError: expecting None or a string Does anyone know what I may be doing wrong?

  Read the article

• How to achieve interaction between GUI class with logic class

  - by volting

  Im new to GUI programming, and haven't done much OOP. Im working on a basic calculator app to help me learn GUI design and to brush up on OOP. I understand that anything GUI related should be kept seperate from the logic, but Im unsure how to implement interaction between logic an GUI classes when needed i.e. basically passing variables back and forth... Im using TKinter and when I pass a tkinter variable to my logic it only seems to hold the string PY_VAR0. def on_equal_btn_click(self): self.entryVariable.set(self.entryVariable.get() + "=") calculator = Calc(self.entryVariable) self.entryVariable.set(calculator.calculate()) Im sure that im probably doing something fundamentally wrong and probabaly really stupid, I spent a considerable amount of time experimenting (and searching for answers online) but Im getting no where. Any help would be appreciated. Thanks, V The Full Program (well just enough to show the structure..) import Tkinter class Gui(Tkinter.Tk): def __init__(self,parent): Tkinter.Tk.__init__(self,parent) self.parent = parent self.initialize() def initialize(self): self.grid() self.create_widgets() """ grid config """ #self.grid_columnconfigure(0,weight=1,pad=0) self.resizable(False, False) def create_widgets(self): """row 0 of grid""" """Create Text Entry Box""" self.entryVariable = Tkinter.StringVar() self.entry = Tkinter.Entry(self,width=30,textvariable=self.entryVariable) self.entry.grid(column=0,row=0, columnspan = 3 ) self.entry.bind("<Return>", self.on_press_enter) """create equal button""" equal_btn = Tkinter.Button(self,text="=",width=4,command=self.on_equal_btn_click) equal_btn.grid(column=3, row=0) """row 1 of grid""" """create number 1 button""" number1_btn = Tkinter.Button(self,text="1",width=8,command=self.on_number1_btn_click) number1_btn.grid(column=0, row=1) . . . def on_equal_btn_click(self): self.entryVariable.set(self.entryVariable.get() + "=") calculator = Calc(self.entryVariable) self.entryVariable.set(calculator.calculate()) class Calc(): def __init__(self, equation): self.equation = equation def calculate(self): #TODO: parse string and calculate... return self.equation if __name__ == "__main__": app = Gui(None) app.title('Calculator') app.mainloop()

  Read the article

• Ubuntu + virtualenv = a mess? virtualenv hates dist-packages, wants site-packages

  - by lostincode

  Can someone please explain to me what is going on with python in ubuntu 9.04? I'm trying to spin up virtualenv, and the --no-site-packages flag seems to do nothing with ubuntu. I installed virtualenv 1.3.3 with easy_install (which I've upgraded to setuptools 0.6c9) and everything seems to be installed to /usr/local/lib/python2.6/dist-packages I assume that when installing a package using apt-get, it's placed in /usr/lib/python2.6/dist-packages/ ? The issue is, there is a /usr/local/lib/python2.6/site-packages as well that just sits there being empty. It would seem (by looking at the path in a virtualenv) that this is the folder virtualenv uses as backup. Thus even thought I omit --no-site-packages, I cant access my local systems packages from any of my virtualenv's. So my questions are: How do I get virtualenv to point to one of the dist-packages? Which dist-packages should I point it to? /usr/lib/python2.6/dist-packages or /usr/local/lib/python2.6/dist-packages/ What is the point of /usr/lib/python2.6/site-packages? There's nothing in there! Is it first come first serve on the path? If I have a newer version of package XYZ installed in /usr/local/lib/python2.6/dist-packages/ and and older one (from ubuntu repos/apt-get) in /usr/lib/python2.6/dist-packages, which one gets imported when I import xyz? I'm assuming this is based on the path list, yes? Why the hell is this so confusing? Is there something I'm missing here? Where is it defined that easy_install should install to /usr/local/lib/python2.6/dist-packages? Will this affect pip as well? Thanks to anyone who can clear this up!

  Read the article

• Creating collaborative whiteboard drawing application

  - by Steven Sproat

  I have my own drawing program in place, with a variety of "drawing tools" such as Pen, Eraser, Rectangle, Circle, Select, Text etc. It's made with Python and wxPython. Each tool mentioned above is a class, which all have polymorphic methods, such as left_down(), mouse_motion(), hit_test() etc. The program manages a list of all drawn shapes -- when a user has drawn a shape, it's added to the list. This is used to manage undo/redo operations too. So, I have a decent codebase that I can hook collaborative drawing into. Each shape could be changed to know its owner -- the user who drew it, and to only allow delete/move/rescale operations to be performed on shapes owned by one person. I'm just wondering the best way to develop this. One person in the "session" will have to act as the server, I have no money to offer free central servers. Somehow users will need a way to connect to servers, meaning some kind of "discover servers" browser...or something. How do I broadcast changes made to the application? Drawing in realtime and broadcasting a message on each mouse motion event would be costly in terms of performance and things get worse the more users there are at a given time. Any ideas are welcome, I'm not too sure where to begin with developing this (or even how to test it)

  Read the article

• Get active window title in X

  - by dutt

  I'm trying to get the title of the active window. The application is a background task so if the user has Eclipse open the function returns "Eclipse - blabla", so it's not getting the window title of my own window. I'm developing this in Python 2.6 using PyQt4. My current solution, borrowed and slightly modified from an old answer here at SO, looks like this: def get_active_window_title(): title = '' root_check = '' root = Popen(['xprop', '-root'], stdout=PIPE) if root.stdout != root_check: root_check = root.stdout for i in root.stdout: if '_NET_ACTIVE_WINDOW(WINDOW):' in i: id_ = i.split()[4] id_w = Popen(['xprop', '-id', id_], stdout=PIPE) for j in id_w.stdout: if 'WM_ICON_NAME(STRING)' in j: if title != j.split()[2]: return j.split("= ")[1].strip(' \n\"') It works for most windows, but not all. For example it can't find my kopete chat windows, or the name of the application i'm currently developing. My next try looks like this: def get_active_window_title(self): screen = wnck.screen_get_default() if screen == None: return "Could not get screen" window = screen.get_active_window() if window == None: return "Could not get window" title = window.get_name() return title; But for some reason window is always None. Does somebody have a better way of getting the current window title, or how to modify one of my ways, that works for all windows? Edit: In case anybody is wondering this is the way I found that seems to work for all windows. def get_active_window_title(self): root_check = '' root = Popen(['xprop', '-root'], stdout=PIPE) if root.stdout != root_check: root_check = root.stdout for i in root.stdout: if '_NET_ACTIVE_WINDOW(WINDOW):' in i: id_ = i.split()[4] id_w = Popen(['xprop', '-id', id_], stdout=PIPE) id_w.wait() buff = [] for j in id_w.stdout: buff.append(j) for line in buff: match = re.match("WM_NAME\((?P<type>.+)\) = (?P<name>.+)", line) if match != None: type = match.group("type") if type == "STRING" or type == "COMPOUND_TEXT": return match.group("name") return "Active window not found"

  Read the article

• can I put my sqlite connection and cursor in a function?

  - by steini

  I was thinking I'd try to make my sqlite db connection a function instead of copy/pasting the ~6 lines needed to connect and execute a query all over the place. I'd like to make it versatile so I can use the same function for create/select/insert/etc... Below is what I have tried. The 'INSERT' and 'CREATE TABLE' queries are working, but if I do a 'SELECT' query, how can I work with the values it fetches outside of the function? Usually I'd like to print the values it fetches and also do other things with them. When I do it like below I get an error Traceback (most recent call last): File "C:\Users\steini\Desktop\py\database\test3.py", line 15, in <module> for row in connection('testdb45.db', "select * from users"): ProgrammingError: Cannot operate on a closed database. So I guess the connection needs to be open so I can get the values from the cursor, but I need to close it so the file isn't always locked. Here's my testing code: import sqlite3 def connection (db, arg): conn = sqlite3.connect(db) conn.execute('pragma foreign_keys = on') cur = conn.cursor() cur.execute(arg) conn.commit() conn.close() return cur connection('testdb.db', "create table users ('user', 'email')") connection('testdb.db', "insert into users ('user', 'email') values ('joey', 'foo@bar')") for row in connection('testdb45.db', "select * from users"): print row How can I make this work?

  Read the article

• Approach for parsing file and creating dynamic data structure for use by another program

  - by user275633

  All, Background: I have a customer who has some build scripts for their datacenter based on python that I've inherited. I did not work on the original design so I'm sort of limited to some degree on what I can and can't change. That said, my customer has a properties file that they use in their datacenter. Some of the values are used to build their servers and unfortunately they have other applications that also use these values so I cannot change them to make it easier for me. What I want to do is make the scripts more dynamic to distribute more hosts so that I don't have to keep updating the scripts in the future and can just add more hosts to the property file. Unfortunately I can't change the current property file and have to work with it. The property file looks something like this: projectName.ClusterNameServer1.sslport=443 projectName.ClusterNameServer1.port=80 projectName.ClusterNameServer1.host=myHostA projectName.ClusterNameServer2.sslport=443 projectName.ClusterNameServer2.port=80 projectName.ClusterNameServer2.host=myHostB In their deployment scripts they basically have alot of if projectName.ClusterNameServerX where X is some number of entries defined and then do something, e.g.: if projectName.ClusterNameServer1.host != "" do X if projectName.ClusterNameServer2.host != "" do X if projectName.ClusterNameServer3.host != "" do X Then when they add another host (say Serve4) they've added another if statement. Question: What I would like to do is make the scripts more dynamic and parse the properties file and put what I need into some data structure to pass to the deployment scripts and then just iterate over the structure and do my deployment that way so I don't have to constantly add a bunch of if some host# do something. I'm just curious to feed some suggestions as to what others would do to parse the file and what sort of data structure would they use and how they would group things together by ClusterNameServer# or something else. Thanks

  Read the article

• Wrong values reported by pyPDF for various box regions

  - by romor

  Using pyPdf, for most files I get matched results concerning various box's dimensions compared to what Acrobat reports. However for some files I get different values reported by pyPdf and Acrobat, like: pyPdf: artBox: 595.3 x 841.9 bleedBox: 595.3 x 841.9 cropBox: 595.3 x 841.9 trimBox: 517.3 x 754 Acrobat: artBox: 439.35 x 666.13 pt bleedBox: 439.35 x 666.13 pt cropBox: 439.35 x 666.13 pt trimBox: 439.35 x 666.13 pt I thought it's units issue, but then ratio between widths and heights doesn't match also, not mentioning trimBox mismatch Correct results are those reported by Acrobat of course. Does someone know why is this and is there a way I get correct dimensions by using pyPdf? Thanks couple of minutes later... After reading this question: Are PDF box coordinates relative or absolute? I figured I didn't considered uper left corner to be different then 0 (zero). It turned out that box starts at 77.95 x 87.87, so if we reduce reported values of trimBox by this values correct result is obtained. artBox: 0 x 0 bleedBox: 0 x 0 cropBox: 0 x 0 trimBox: 77.95 x 87.87 Other boxes seem with misleading values or I misinterpret them. Snippet: from pyPdf import PdfFileReader pdfread = PdfFileReader(file('my.pdf', 'rb')) page = 1 width = pdfread.getPage(page).trimBox[2]-pdfread.getPage(page).trimBox[0] height = pdfread.getPage(page).trimBox[3] - pdfread.getPage(page).trimBox[1] print width, height

  Read the article

• Problems with Getting Remote Contents using Google App Engine

  - by dade

  Here is the client side code. It is running insdide a Google Gadgets var params = {}; params[gadgets.io.RequestParameters.CONTENT_TYPE] = gadgets.io.ContentType.JSON; var url = "http://invplatformtest.appspot.com/getrecent/"; gadgets.io.makeRequest(url, response, params); The response function is: function response(obj) { var r = obj.data; alert(r['name']); } while on the server end, the python code sending the JSON is: class GetRecent(webapp.RequestHandler): def get(self): self.response.out.write({'name':'geocities'}) #i know this is where the problem is so how do i encode json in GAE? which is just supposed to send back a Json encoded string but when i run this, the javascript throws the following error: r is null alert(r['name']); If i were recieving just TEXT contents and my server send TEXT everything works fine. I only get this problem when am trying to send JSON. Where exactly is the problem? Am i encoding the JSON the wrong way on AppEngine? I tried using the JSON library but it looks as if this is not supported. Where is the problem exactly? :(

  Read the article

• "Function object is unsubscriptable" in basic integer to string mapping function

  - by IanWhalen

  I'm trying to write a function to return the word string of any number less than 1000. Everytime I run my code at the interactive prompt it appears to work without issue but when I try to import wordify and run it with a test number higher than 20 it fails as "TypeError: 'function' object is unsubscriptable". Based on the error message, it seems the issue is when it tries to index numString (for example trying to extract the number 4 out of the test case of n = 24) and the compiler thinks numString is a function instead of a string. since the first line of the function is me defining numString as a string of the variable n, I'm not really sure why that is. Any help in getting around this error, or even just help in explaining why I'm seeing it, would be awesome. def wordify(n): # Convert n to a string to parse out ones, tens and hundreds later. numString = str(n) # N less than 20 is hard-coded. if n < 21: return numToWordMap(n) # N between 21 and 99 parses ones and tens then concatenates. elif n < 100: onesNum = numString[-1] ones = numToWordMap(int(onesNum)) tensNum = numString[-2] tens = numToWordMap(int(tensNum)*10) return tens+ones else: # TODO pass def numToWordMap(num): mapping = { 0:"", 1:"one", 2:"two", 3:"three", 4:"four", 5:"five", 6:"six", 7:"seven", 8:"eight", 9:"nine", 10:"ten", 11:"eleven", 12:"twelve", 13:"thirteen", 14:"fourteen", 15:"fifteen", 16:"sixteen", 17:"seventeen", 18:"eighteen", 19:"nineteen", 20:"twenty", 30:"thirty", 40:"fourty", 50:"fifty", 60:"sixty", 70:"seventy", 80:"eighty", 90:"ninety", 100:"onehundred", 200:"twohundred", 300:"threehundred", 400:"fourhundred", 500:"fivehundred", 600:"sixhundred", 700:"sevenhundred", 800:"eighthundred", 900:"ninehundred", } return mapping[num] if __name__ == '__main__': pass

  Read the article

• tk: how to invoke it just to display something, and return to the main program?

  - by max

  Sorry for the noob question but I really don't understand this. I'm using python / tkinter and I want to display something (say, a canvas with a few shapes on it), and keep it displayed until the program quits. I understand that no widgets would be displayed until I call tkinter.tk.mainloop(). However, if I call tkinter.tk.mainloop(), I won't be able to do anything else until the user closes the main window. I don't need to monitor any user input events, just display some stuff. What's a good way to do this without giving up control to mainloop? EDIT: Is this sample code reasonable: class App(tk.Tk): def __init__(self, sim): self.sim = sim # link to the simulation instance self.loop() def loop(): self.redraw() # update all the GUI to reflect new simulation state sim.next_step() # advance simulation another step self.after(0, self.loop) def redraw(): # get whatever we need from self.sim, and put it on the screen EDIT2 (added after_idle): class App(tk.Tk): def __init__(self, sim): self.sim = sim # link to the simulation instance self.after_idle(self.preloop) def preloop(): self.after(0, self.loop) def loop(): self.redraw() # update all the GUI to reflect new simulation state sim.next_step() # advance simulation another step self.after_idle(self.preloop) def redraw(): # get whatever we need from self.sim, and put it on the screen

  Read the article

• pyOpenSSL and the WantReadError

  - by directedition

  I have a socket server that I am trying to move over to SSL on python 2.5, but I've run into a snag with pyOpenSSL. I can't find any good tutorials on using it, so I'm operating largely on guesses. Here is how my server sets up the socket: ctx = SSL.Context(SSL.SSLv23_METHOD) ctx.use_privatekey_file ("mykey.pem") ctx.use_certificate_file("mycert.pem") sock = SSL.Connection(ctx, socket.socket(socket.AF_INET, socket.SOCK_STREAM)) sock.setsockopt(socket.SOL_SOCKET, socket.SO_REUSEADDR, 1) addr = ('', int(8081)) sock.bind(addr) sock.listen(5) Here is how it accepts clients: sock.setblocking(0) while True: if len(select([sock], [], [], 0.25)[0]): client_sock, client_addr = sock.accept() client = ClientGen(client_sock) And here is how it sends/receives from the connected sockets: while True: (r, w, e) = select.select([sock], [sock], [], 0.25) if len(r): bytes = sock.recv(1024) if len(w): n_bytes = sock.send(self.message) It's compacted, but you get the general idea. The problem is, once the send/receive loop starts, it dies right away, before anything has been sent or received (that I can see anyway): Traceback (most recent call last): File "ClientGen.py", line 50, in networkLoop n_bytes = sock.send(self.message WantReadError The manual's description of the 'WantReadError' is very vague, saying it can come from just about anywhere. What am I doing wrong?

  Read the article

• Merging similar dictionaries in a list together

  - by WonderSteve

  New to python here. I've been pulling my hair for hours and still can't figure this out. I have a list of dictionaries: [ {'FX0XST001.MID5': '195', 'Name': 'Firmicutes', 'Taxonomy ID': '1239', 'Type': 'phylum'} {'FX0XST001.MID13': '4929', 'Name': 'Firmicutes', 'Taxonomy ID': '1239','Type': 'phylum'}, {'FX0XST001.MID6': '826', 'Name': 'Firmicutes', 'Taxonomy ID': '1239', 'Type': 'phylum'}, . . . . {'FX0XST001.MID6': '125', 'Name': 'Acidobacteria', 'Taxonomy ID': '57723', 'Type': 'phylum'} {'FX0XST001.MID25': '70', 'Name': 'Acidobacteria', 'Taxonomy ID': '57723', 'Type': 'phylum'} {'FX0XST001.MID40': '40', 'Name': 'Acidobacteria', 'Taxonomy ID': '57723', 'Type': 'phylum'} ] I want to merge the dictionaries in the list based on their Type, Name, and Taxonomy ID [ {'FX0XST001.MID5': '195', 'FX0XST001.MID13': '4929', 'FX0XST001.MID6': '826', 'Name': 'Firmicutes', 'Taxonomy ID': '1239', 'Type': 'phylum'} . . . . {'FX0XST001.MID6': '125', 'FX0XST001.MID25': '70', 'FX0XST001.MID40': '40', 'Name': 'Acidobacteria', 'Taxonomy ID': '57723', 'Type': 'phylum'}] I have the data structure setup like this because I need to write the data to CSV using csv.DictWriter later. Would anyone kindly point me to the right direction?

  Read the article

• string comparision and counting the key in target [closed]

  - by mesun

  Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

  Read the article

• Problems with i18n using django translation on App-Engine with Korean and Hindi

  - by Greg

  I've got a setup based on the post here, and it works perfectly. Adding more languages to the mix, it recognises them fine, except for Korean (ko) and Hindi (hi). Chinese/Japanese/Hebrew are all fine, so nothing to do with encodings/charsets I don't think. Taking a look into the django code inside the app-engine SDK, I notice that all the languages that I'm using except for ko and hi are ones that ship with django - in the default settings.py and inside the locale folder they are missing. If I copy one of the locale folders inside the /usr/local/google_appengine/lib/django[...]/conf/locale and rename it to be 'ko', then it starts working in my app, but I won't be able to replicate this modification when I deploy to app-engine, so need a bit of help understanding what I might be doing wrong. my settings.py is definitely being taken into account, as if I remove languages from there then they stop working (as they should). If I copied the django modules into my app, under 'lib' there say, could I use those instead of the ones app-engine tries to use, maybe? I'm brand new to python/django/app-engine, and developing on a Mac with Leopard, if that makes any difference. I have the latest app-engine SDK as of tuesday.

  Read the article

• Faster Insertion of Records into a Table with SQLAlchemy

  - by Kyle Brandt

  I am parsing a log and inserting it into either MySQL or SQLite using SQLAlchemy and Python. Right now I open a connection to the DB, and as I loop over each line, I insert it after it is parsed (This is just one big table right now, not very experienced with SQL). I then close the connection when the loop is done. The summarized code is: log_table = schema.Table('log_table', metadata, schema.Column('id', types.Integer, primary_key=True), schema.Column('time', types.DateTime), schema.Column('ip', types.String(length=15)) .... engine = create_engine(...) metadata.bind = engine connection = engine.connect() .... for line in file_to_parse: m = line_regex.match(line) if m: fields = m.groupdict() pythonified = pythoninfy_log(fields) #Turn them into ints, datatimes, etc if use_sql: ins = log_table.insert(values=pythonified) connection.execute(ins) parsed += 1 My two questions are: Is there a way to speed up the inserts within this basic framework? Maybe have a Queue of inserts and some insertion threads, some sort of bulk inserts, etc? When I used MySQL, for about ~1.2 million records the insert time was 15 minutes. With SQLite, the insert time was a little over an hour. Does that time difference between the db engines seem about right, or does it mean I am doing something very wrong?

  Read the article

• Add a value to an element in a list of sets

  - by Kapelson

  Hello. I'm using python, and I have a list of sets, constructed like this: list = [set([])]*n ...where n is the number of sets I want in the list. I want to add a value to a specific set in the list. Say, the second set. I tried list[1].add(value) But this instead adds the value to each set in the list. This behaviour is pretty non-intuitive to me. Through further tests, I think I've found the problem: the list apparently contains 10 instances of the same set, or ten pointers to the same set, or something. Constructing the list through repeated calls of list.append(set([])) allowed me to use the syntax above to add elements to single sets. So my question is this: what exactly is going on in my first list-construction technique? It is clear I don't understand the syntax so well. Also, is there a better way to intialize an n-element list? I've been using this syntax for a while and this is my first problem with it.

  Read the article

• Insertion sort invariant assertion fails

  - by user1661211

  In the following code at the end of the for loop I use the assert function in order to test that a[i+1] is greater than or equal to a[i] but I get the following error (after the code below). Also in c++ the assert with the following seems to work just fine but in python (the following code) it does not seem to work...anyone know why? import random class Sorting: #Precondition: An array a with values. #Postcondition: Array a[1...n] is sorted. def insertion_sort(self,a): #First loop invariant: Array a[1...i] is sorted. for j in range(1,len(a)): key = a[j] i = j-1 #Second loop invariant: a[i] is the greatest value from a[i...j-1] while i >= 0 and a[i] > key: a[i+1] = a[i] i = i-1 a[i+1] = key assert a[i+1] >= a[i] return a def random_array(self,size): b = [] for i in range(0,size): b.append(random.randint(0,1000)) return b sort = Sorting() print sort.insertion_sort(sort.random_array(10)) The Error: Traceback (most recent call last): File "C:\Users\Albaraa\Desktop\CS253\Programming 1\Insertion_Sort.py", line 27, in <module> print sort.insertion_sort(sort.random_array(10)) File "C:\Users\Albaraa\Desktop\CS253\Programming 1\Insertion_Sort.py", line 16, in insertion_sort assert a[i+1] >= a[i] AssertionError

  Read the article

• django multiprocess problem

  - by iKiR

  I have django application, running under lighttpd via fastcgi. FCGI running script looks like: python manage.py runfcgi socket=<path>/main.socket method=prefork \ pidfile=<path>/server.pid \ minspare=5 maxspare=10 maxchildren=10 maxrequests=500 \ I use SQLite. So I have 10 proccess, which all work with the same DB. Next I have 2 views: def view1(request) ... obj = MyModel.objects.get_or_create(id=1) obj.param1 = <some value> obj.save () def view2(request) ... obj = MyModel.objects.get_or_create(id=1) obj.param2 = <some value> obj.save () And If this views are executed in two different threads sometimes I get MyModel instance in DB with id=1 and updated either param1 or param2 (BUT not both) - it depends on which process was the first. (of course in real life id changes, but sometimes 2 processes execute these two views with same id) The question is: What should I do to get instance with updated param1 and param2? I need something for merging changes in different processes. One decision is create interprocess lock object but in this case I will get sequence executing views and they will not be able to be executed simultaneously, so I ask help

  Read the article

• What's the best way to send user-inputted text via AJAX to Google App Engine?

  - by Cuga

  I'm developing in Google App Engine (python sdk) and I want to use jQuery to send an Ajax request to store an answer to a question. What is the best way to send this data to the server? Currently I have: function storeItem(question_id) { var answerInputControl = ".input_answer_"+question_id; var answer_text = $(answerInputControl).text(); $.ajax({ type: "POST", url: "store_answer.html", data: "question="+question_id, success: function(responseText){ alert("Retrieved: " + responseText); } }); } This takes a question Id and provides it to the server via the query string. But on the server-side, I'm unable to access the content of the answer control which I want to store. Without Ajax, I'm able to perform this operation with the following: class StoreAnswers(webapp.RequestHandler): def post(self): question_id = self.request.get("question_id") answer_text = self.request.get("input_answer" + question_id) But when doing this call through Ajax, my answer_text is empty. Do I need to send the contents of this control as part of the data with the Ajax request? Do I add the control itself to the query string? Its contents? Does it matter that the content might be a few hundred characters long? Is this the most-recommended practice? If sending it as a query string, what's the best way to escape the content so that a malicious user doesn't harm the system?

  Read the article

• Extended slice that goes to beginning of sequence with negative stride

  - by recursive

  Bear with me while I explain my question. Skip down to the bold heading if you already understand extended slice list indexing. In python, you can index lists using slice notation. Here's an example: >>> A = list(range(10)) >>> A[0:5] [0, 1, 2, 3, 4] You can also include a stride, which acts like a "step": >>> A[0:5:2] [0, 2, 4] The stride is also allowed to be negative, meaning the elements are retrieved in reverse order: >>> A[5:0:-1] [5, 4, 3, 2, 1] But wait! I wanted to see [4, 3, 2, 1, 0]. Oh, I see, I need to decrement the start and end indices: >>> A[4:-1:-1] [] What happened? It's interpreting -1 as being at the end of the array, not the beginning. I know you can achieve this as follows: >>> A[4::-1] [4, 3, 2, 1, 0] But you can't use this in all cases. For example, in a method that's been passed indices. My question is: Is there any good pythonic way of using extended slices with negative strides and explicit start and end indices that include the first element of a sequence? This is what I've come up with so far, but it seems unsatisfying. >>> A[0:5][::-1] [4, 3, 2, 1, 0]

  Read the article

• Django: Create custom template tag -> ImportError

  - by Alexander Scholz

  I'm sorry to ask this again, but I tried several solutions from stack overflow and some tutorials and I couldn't create a custom template tag yet. All I get is ImportError: No module named test_tag when I try to start the server via python manage.py runserver. I created a very basic template tag (found here: django templatetag?) like so: My folder structure: demo manage.py test __init__.py settings.py urls.py ... templatetags __init__.py test_tag.py test_tag.py: from django import template register = template.Library() @register.simple_tag def test_tag(input): if "foo" == input: return "foo" if "bar" == input: return "bar" if "baz" == input: return "baz" return "" index.html: {% load test_tag %} <html> <head> ... </head> <body> {% cms_toolbar %} {% foobarbaz "bar" %} {% foobarbaz "elephant" %} {% foobarbaz "foo" %} </body> </html> and my settings.py: INSTALLED_APPS = ( ... 'test_tag', ... ) Please let me know if you need further information from my settings.py and what I did wrong so I can't even start my server. (If I delete 'test_tag' from installed apps I can start the server but I get the error that test_tag is not known, of course). Thanks

  Read the article

• How to insert several thousand columns into sqlite3?

  - by user291071

  Similar to my last question, but I ran into problem lets say I have a simple dictionary like below but its Big, when I try inserting a big dictionary using the methods below I get operational error for the c.execute(schema) for too many columns so what should be my alternate method to populate an sql databases columns? Using the alter table command and add each one individually? import sqlite3 con = sqlite3.connect('simple.db') c = con.cursor() dic = { 'x1':{'y1':1.0,'y2':0.0}, 'x2':{'y1':0.0,'y2':2.0,'joe bla':1.5}, 'x3':{'y2':2.0,'y3 45 etc':1.5} } # 1. Find the unique column names. columns = set() for _, cols in dic.items(): for key, _ in cols.items(): columns.add(key) # 2. Create the schema. col_defs = [ # Start with the column for our key name '"row_name" VARCHAR(2) NOT NULL PRIMARY KEY' ] for column in columns: col_defs.append('"%s" REAL NULL' % column) schema = "CREATE TABLE simple (%s);" % ",".join(col_defs) c.execute(schema) # 3. Loop through each row for row_name, cols in dic.items(): # Compile the data we have for this row. col_names = cols.keys() col_values = [str(val) for val in cols.values()] # Insert it. sql = 'INSERT INTO simple ("row_name", "%s") VALUES ("%s", "%s");' % ( '","'.join(col_names), row_name, '","'.join(col_values) )

  Read the article

• Repeated host lookups failing in urllib2

  - by reve_etrange

  I have code which issues many HTTP GET requests using Python's urllib2, in several threads, writing the responses into files (one per thread). During execution, it looks like many of the host lookups fail (causing a name or service unknown error, see appended error log for an example). Is this due to a flaky DNS service? Is it bad practice to rely on DNS caching, if the host name isn't changing? I.e. should a single lookup's result be passed into the urlopen? Exception in thread Thread-16: Traceback (most recent call last): File "/usr/lib/python2.6/threading.py", line 532, in __bootstrap_inner self.run() File "/home/da/local/bin/ThreadedDownloader.py", line 61, in run page = urllib2.urlopen(url) # get the page File "/usr/lib/python2.6/urllib2.py", line 126, in urlopen return _opener.open(url, data, timeout) File "/usr/lib/python2.6/urllib2.py", line 391, in open response = self._open(req, data) File "/usr/lib/python2.6/urllib2.py", line 409, in _open '_open', req) File "/usr/lib/python2.6/urllib2.py", line 369, in _call_chain result = func(*args) File "/usr/lib/python2.6/urllib2.py", line 1170, in http_open return self.do_open(httplib.HTTPConnection, req) File "/usr/lib/python2.6/urllib2.py", line 1145, in do_open raise URLError(err) URLError: <urlopen error [Errno -2] Name or service not known>

  Read the article

< Previous Page | 359 360 361 362 363 364 365 366 367 368 369 370  | Next Page >