Search Results

Search found 25180 results on 1008 pages for 'post processing'.

Page 366/1008 | < Previous Page | 362 363 364 365 366 367 368 369 370 371 372 373  | Next Page >

  • Cannot get a session with Facebook app? (using its Graph API)

    - by Jian Lin
    I have really simple few lines of Facebook app, using the new Facebook API: <pre> <?php require 'facebook.php'; // Create our Application instance. $facebook = new Facebook(array( 'appId' => '117676584930569', 'secret' => '**********', // hidden here on the post... 'cookie' => true, )); var_dump($facebook); ?> but it is giving me the following output: http://apps.facebook.com/woolaladev/i2.php would give out object(Facebook)#1 (6) { ["appId:protected"]=> string(15) "117676584930569" ["apiSecret:protected"]=> string(32) "**********" <--- just hidden on this post ["session:protected"]=> NULL <--- Session is NULL for some reason ["sessionLoaded:protected"]=> bool(false) ["cookieSupport:protected"]=> bool(true) ["baseDomain:protected"]=> string(0) "" } Session is NULL for some reason, but I am logged in and can access my home and profile and run other apps on Facebook (to see that I am logged on). I am following the sample on: http://github.com/facebook/php-sdk/blob/master/examples/example.php http://github.com/facebook/php-sdk/blob/master/src/facebook.php (download using raw URL: wget http://github.com/facebook/php-sdk/raw/master/src/facebook.php ) Trying on both hosting companies at dreamhost.com and netfirms.com, and the results are the same.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • ASP.net AppendHeader not working in ASP MVC

    - by Chao
    I'm having problems getting AppendHeader to work properly if I am also using an authorize filter. I'm using an actionfilter for my AJAX actions that applies Expires, Last-Modified, Cache-Control and Pragma (though while testing I have tried including it in the action method itself with no change in results). If I don't have an authorize filter the headers work fine. Once I add the filter the headers I tried to add get stripped. The headers I want to add Response.AppendHeader("Expires", "Sun, 19 Nov 1978 05:00:00 GMT"); Response.AppendHeader("Last-Modified", String.Format("{0:r}", DateTime.Now)); Response.AppendHeader("Cache-Control", "no-store, no-cache, must-revalidate"); Response.AppendHeader("Cache-Control", "post-check=0, pre-check=0"); Response.AppendHeader("Pragma", "no-cache"); An example of the headers from a correct page: Server ASP.NET Development Server/9.0.0.0 Date Mon, 14 Jun 2010 17:22:24 GMT X-AspNet-Version 2.0.50727 X-AspNetMvc-Version 2.0 Pragma no-cache Expires Sun, 19 Nov 1978 05:00:00 GMT Last-Modified Mon, 14 Jun 2010 18:22:24 GMT Cache-Control no-store, no-cache, must-revalidate, post-check=0, pre-check=0 Content-Type text/html; charset=utf-8 Content-Length 352 Connection Close And from an incorrect page: Server ASP.NET Development Server/9.0.0.0 Date Mon, 14 Jun 2010 17:27:34 GMT X-AspNet-Version 2.0.50727 X-AspNetMvc-Version 2.0 Pragma no-cache, no-cache Cache-Control private, s-maxage=0 Content-Type text/html; charset=utf-8 Content-Length 4937 Connection Close

    Read the article

  • Use localeURL middleware with apache prefix

    - by Olivier R.
    Good morning everyone, I Got a question about localeURL usage. Everything works great for me with url like this : www.mysite.com/ If I type www.mysite.com/ in adress bar, it turns correctly in www.mysite.com/en/ for example. If I use the view change_locale, it's also all right (ie change www.mysite.com/en/ in www.mysite.com/fr/). But my application use apache as server, and use a prefix for the site, that gives url like this : www.mysite.com/prefix/ If I type www.mysite.com/prefix/ in the adress bar, the adress turns into www.mysite.com/en/ without prefix (so 404) I change code of view to manage our settings.SERVER_PREFIX value : def change_locale(request) : """ Redirect to a given url while changing the locale in the path The url and the locale code need to be specified in the request parameters. O. Rochaix; Taken from localeURL view, and tuned to manage : - SERVER_PREFIX from settings.py """ next = request.REQUEST.get('next', None) if not next: next = request.META.get('HTTP_REFERER', None) if not next: next = settings.SERVER_PREFIX + '/' next = urlsplit(next).path prefix = False if settings.SERVER_PREFIX!="" and next.startswith(settings.SERVER_PREFIX) : prefix = True next = "/" + next.lstrip(settings.SERVER_PREFIX) _, path = utils.strip_path (next) if request.method == 'POST': locale = request.POST.get('locale', None) if locale and check_for_language(locale): path = utils.locale_path(path, locale) if prefix : path = settings.SERVER_PREFIX + path response = http.HttpResponseRedirect(path) return response with this customized view, i'm able to correctly change language, but i'm not sure that's the right way of doing stuff. Is there any option on localeURL to manage prefix of apache ?

    Read the article

  • Fork or copy a users browser session in IE

    - by jmoeller
    Is it possible to fork a users session (or do something similar) in a Internet Explorer plugin? I want to process the page the user is on when they click a button in the toolbar. To avoid interrupting the users browsing, I'd like to "copy" everything so I can parse and process the page in the background. The processing can involve things such as loading the content of the result links on a Google search, if that's where the button was clicked. So - what I basically want is to imitate "Ctrl+N" but hide the window from the user, so they won't be interrupted. As you can see, if you fill out and submit the form on http://www.snee.com/xml/crud/posttest.html and press "Ctrl+N", everything posted will still appear in the new window, but it won't post the data twice. I was thinking of somehow copying the IWebBrowser2, but: I'm not sure if that's possible (I haven't been able to find any information on MSDN) I don't know if it copies the sessions as well. Creating a new instance of the IWebBrowser2 and simply navigating to the current URL isn't a valid solution as POST-variables of course doesn't get carried over.

    Read the article

  • How does overlayViewTouched notification work in the MoviePlayer sample code

    - by Jonathan
    Hi, I have a question regarding the MoviePlayer sample code provided by apple. I don't understand how the overlayViewTouch notification works. The NSlog message I added to it does not get sent when I touch the view (not button). // post the "overlayViewTouch" notification and will send // the overlayViewTouches: message - (void)overlayViewTouches:(NSNotification *)notification { NSLog(@"overlay view touched"); // Handle touches to the overlay view (MyOverlayView) here... } I can, however, get the NSlog notification if I place it in -(void)touchesBegan in "MyOverlayView.m". Which makes me think it is recognizing touches but not sending a notification. // Handle any touches to the overlay view - (void)touchesBegan:(NSSet *)touches withEvent:(UIEvent *)event { UITouch* touch = [touches anyObject]; if (touch.phase == UITouchPhaseBegan) { NSLog(@"overlay touched(from touchesBegan") // IMPORTANT: // Touches to the overlay view are being handled using // two different techniques as described here: // // 1. Touches to the overlay view (not in the button) // // On touches to the view we will post a notification // "overlayViewTouch". MyMovieViewController is registered // as an observer for this notification, and the // overlayViewTouches: method in MyMovieViewController // will be called. // // 2. Touches to the button // // Touches to the button in this same view will // trigger the MyMovieViewController overlayViewButtonPress: // action method instead. NSNotificationCenter *nc = [NSNotificationCenter defaultCenter]; [nc postNotificationName:OverlayViewTouchNotification object:nil]; } } Can anyone shed light on what I am missing or doing wrong? Thank you.

    Read the article

  • sysprep failure on Windows Server 2008

    - by dushyantp
    Before deploying a Azure VM Role, we need to perform %windir%\system32\sysprep\sysprep.exe /generalize /oobe /shutdown But in my case the sysprep fails with the log file %windir%\system32\sysprep\Panther\setuperr.txt saying: 2012-07-05 08:03:57, Error [0x0f0073] SYSPRP RunExternalDlls:Not running DLLs; either the machine is in an invalid state or we couldn't update the recorded state, dwRet = 31 2012-07-05 08:03:57, Error [0x0f00ae] SYSPRP WinMain:Hit failure while processing sysprep cleanup external providers; hr = 0x8007001f I do not always want to create a new image. Is there any work around? I followed the instructions in MS support here and tried: %windir%\system32\sysprep\sysprep.exe /generalize /oobe /shutdown /unattend:.\unattend.xml It did not work. Under certain circumstances, I need to tear down the VM Image from azure and re-deploy with some more changes. So sysprep has to run almost twice every week.

    Read the article

  • What is meant by the terms CPU, Core, Die and Package?

    - by lovesh
    Now this might sound like too many previous questions, but I am really confused about these terms. I was trying to understand how "dual core" is different from "Core 2 Duo", and I came across some answers. For example, this answer states: Core 2 Duo has two cores inside a single physical package and dual core is 2 cpu in a package 2 cpu's in a die = 2 cpu's made together 2 cpu's in package = 2 cpu's on small board or linked in some way Now, is a core different from a CPU? What I understand is there is something that does all the heavy computation, decision making, math and other stuff (aka "processing") is called a CPU. Now what is a Core? And what is a processor when somebody says he has got a Core 2 Duo? And in this context what is a Package and what is a Die? I still don't understand the difference between Core 2 Duo and Dual Core. And can somebody explain hyper-threading (symmetric multi-threading) too if they are super generous?

    Read the article

  • How to make gVim transparent on Ubuntu 10.10?

    - by trolle3000
    I have a .gvimrc file that works fine on OS X 10.6, but won't work on Ubuntu. It contains a line that reads set transparency=15, and when i run gVim it reports: Error detected while processing /home/user/.gvimrc: line 25: E518: Unknown option: transparency=15 Any ideas to make gVim transparent by default? Chers! The whole .gvimrc file for completion: " Turn on line numbers set number " Change colorscheme colorscheme ir_black " Turns on the tab bar always set showtabline=2 " Number of horizontal lines on the screen set lines=60 " GUI Option to remove the Toolbar (T) set guioptions-=T " Sets the percent transparency set transparency=15

    Read the article

  • Mobile Intel® GMA 4500MHD boost

    - by Andy Smith
    My machine has a Mobile Intel® GMA 4500MHD integrated graphics chipset. The machine is currently running 64 bit windows 7 premium with 3GB of ram (1x1gb and 1x2gb). I note that the Mobile Intel® GMA 4500MHD shares the physical memory to process the graphics. now, the total available graphics memory can be up to 1,340 MB with a 32-bit operating system and 3 GB system memory or 1,759 MB with a 64-bit operating system and 4 GB system memory. I am considering investing in a 4GB stick to replace the 1gb stick bringing the total up to 6gb, mainly for an increase in graphics processing ability. Can anyone let me know what sort of power (if any over the 4gb) I could expect by upgrading to 6GB?

    Read the article

  • Cucumber Error: Socket Error for Test Environment Host in REST API

    - by tmo256
    I posted this to the Cucumber group with no replies, which makes me wonder if this is actually a cucumber issue or not. I'm pretty new to cucumber, and there are a number of things I really don't quite understand about how the cucumber environment is set up and executed within the test environment. I have a REST API rails app I'm testing with cucumber, using the RestClient gem to generate a post to controller create action. When I run the feature with a hard-coded URL pointing to a running localhost server (my local dev server environment; replacing tickets_url with "http:// localhost/tickets" in the snippet below), my cucumber steps execute as expected. However, when the resource URL resolves to the cucumber host I'm declaring, I get a socket error exception. getaddrinfo: nodename nor servname provided, or not known (SocketError) From the steps file: When /^POS Adapter sends JSON data to the Tickets resource$/ do ticket = { :ticket = { ... } } host! "test.host" puts tickets_url RestClient.post tickets_url, ticket.to_json, :content_type = :json, :accepts = :json end (the "puts" statement prints "http://test.host/tickets") Using the following gems: cucumber-0.6.1 webrat-0.6.0 rest-client-1.2.0 I should also say I have a similar set up in another rails app, using test.host as my host, and it seems to work fine. I'd appreciate any insight on what I might be missing in my configuration or what this could be related to.

    Read the article

  • How to troubleshoot down terminal service/CITRIX sessions, when the process just won't terminate?

    - by Chad
    Running a CITRIX presentation server farm, version 4.5.6 on Windows 2003 sp2. In the CITRIX Access Management Console, I sometimes get a session that shows it's in a down state - but has none of the normal info associated with it (user name, applications, client name, idle time, etc...). It does say which servers it's on, so I check out that server's terminal services manager. I can see the down session but cannot reset it. I get: (Error 7024 - the requested operation cannot be completed because the terminal connection is currently busy processing a connect, disconnect, reset, or delete operation.) So I go to the task manager and look up the processes running under that session id. I see it's one of my published apps, but when I try to end the process - it simply does nothing and the process remains. Any way to get rid of these sessions without a server reboot?

    Read the article

  • Which hosting will let me execute my own EXE with PHP?

    - by guitar-
    I have a task that PHP (or any server-side scripting language) isn't practical for. It involves a lot of file I/O, processing, etc. and it will execute a lot faster using the program I made in C instead of PHP. Do any hosts allow you to upload your own EXE files and run them on the server using PHP's exec, shell_exec, etc. functions? Do you need a dedicated server to do this? Also, I don't know if Facebook's PHP HipHop is out yet, but I really don't want to use that.

    Read the article

  • Can't run node.js script on server reboot

    - by webstyle
    I need to listen events on port 3240 and I'm using node.js for that purpose. I need to execute my script with forever tool. I also need to run forever on server reboot. When I run forever glh.js everything works: forever list says there is a running process. But when I'm trying to run forever on server reboot I can't get it working. I've created a file in /etc/init.d with the following content: #!/bin/bash /var/www/yan/data/gitlabhook/runglh.sh &>/var/www/yan/data/gitlabhook/runglh.log When I reboot the server, the output log is the following (the same as when I run it manually via console): info: Forever processing file: glh.js But in this case forever doesn't start a process. forever list outputs: info: No forever processes running

    Read the article

  • regular expression to remove original message from reply mail using in java ?

    - by ravi ravi
    In my forum, users can reply through email. I am handling mails from their reply. When they are replying the original message getting appended. I want to get only the reply message not the original message. I have to write regular expression for gmail & hotmail. I written regex for gmail as follows : \n.wrote:(?s).--End of Post-- It is removing the original message except date. I want to remove the date also. before removing the original message : " hi 33 On Tue, May 11, 2010 at 4:18 PM, Mmmmm, Rrrrr wrote: The following update has been posted to this discussion: test as user 222 [$MESSAGE_SIGNATURE_HEADER$] --End of Post-- " When I use the above regex it is filtering as follows : " hi 33 On Tue, May 11, 2010 at 4:18 PM, Mmmmm, Rrrrr " Here i want only the actual message 'hi 33' not that date. How can I filter the date using above regex? Also I need regex for Hotmail also. I appreciate for any reply. Thanks in advance.

    Read the article

  • error handler isn't called when file is uploaded via ajax using jQuery form plugin

    - by scompt.com
    Here's my test case. If the form is posted, a 500 error response is sent. If not, the form is sent. If the file input tag is commented out, the error handler is called. If the file input tag is present, the error handler isn't called. I think this might have something to do with the fact that jQuery needs to use an iframe to handle the upload and iframes don't seem to respond to the error handler. Edit: If I add iframe: true to the options passed to ajaxSubmit to force the use of an iframe, the non-file-upload case stops working also, so it definitely has to do with the iframe. Edit2: I'm using the jQuery Form Plugin. <?php if($_SERVER['REQUEST_METHOD'] == 'POST') { header('HTTP/1.1 500 Internal Server Error'); die; } else {?> <html><head> <script type='text/javascript' src='http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js?ver=2.9.2'></script> <script type='text/javascript' src='http://github.com/malsup/form/raw/master/jquery.form.js?v2.43'></script> <script type="text/javascript"> jQuery(document).ready(function() { jQuery('a').click(function() {jQuery('form').ajaxSubmit({error: function(){alert('error handler called');}})}); }); </script> </head><body> <form method="POST"> <input type="text" name="mytext" /> <input type="file" name="myfile" /><!-- comment this element out --> <input type="hidden" name="blah" value="blah" /> <a>submit</a> </form> </body></html> <?php } Is there any way to get the error handler to be called in both situations?

    Read the article

  • Copying files within a Workgroup

    - by Andrew La Grange
    I have three boxes operating in a Windows Server workgroup within a closed network. (No Domain / No AD) There are several derivations of the scenario that I'm about to outline, but I'm sure I will be able to retool the solution as and when I need. Essentially the boxes are: 2 x Windows Server 2008 R2 x64 Standard 1 x Windows Server 2000 Standard I need to be able to schedule the copying/and-or/moving of files from various directories and each of the boxes. Each box has a different username and password for the administrator. I have PowerShell 2.0 on the two Win2K8 boxes (obviously). Previously I have used mapped network drives to copy the files, and cmd line batches, but I'd much rather use Powershell if possible (with Shares and/or $ notation). However the Copy-Item cmdlet doesn't seem to be processing the Credential correctly. Perhaps some Powershell gurus out there might be able to help me. Essentially I'd like to schedule a PS run of script to push backup files onto my WIn2k box (old fileserver) periodically.

    Read the article

  • How can I attach a file using Wordpress custom fields / meta boxes?

    - by shipshape
    I am using Wordpress's add_meta_box() function to add customized meta fields to the Add New Post page, like this. I want one of these fields to allow the user to upload a file, so that a single image, pdf, audio file, or video can be associated with the post. The closest example I've seen is this one. Unfortunately it does not suit my needs, as I want my file to be processed by Wordpress's Media Uploader - so it should appear in the Media Library afterwards, and thumbnails should be generated according to the Media settings. I think ideally there would be a way to tap into Wordpress's existing Add Media dialog, and simply output the URL of the uploaded file into a text box, but I don't see how to do that. This question is similar, but the answers are a little clunky - I would like to keep this super simple for my end users. How can I accomplish this? Please do not recommend plugins such as Flutter or Magic Fields - I have tried these and they do not suit my purposes (I want the images to be processed by Wordpress's Media Uploader). I am using Wordpress 3.0-alpha. Thanks!

    Read the article

  • RedirectToAction and validate MVC 2

    - by Dan
    Hi, my problem is the View where the user typed, the validation. I have to take RedirectToAction on the site because on the site upload a file. Thats my code. My model class public class Person { [Required(ErrorMessage= "Please enter name")] public string name { get; set; } } My View <%@ Page Title="" Language="C#" MasterPageFile="~/Views/Shared/Site.Master" Inherits="System.Web.Mvc.ViewPage<MvcWebRole1.Models.Person>" %> Name <h2>Information Data</h2> <%= Html.ValidationSummary() %> <%using (Html.BeginForm ("upload","Home", FormMethod.Post, new{ enctype ="multipart/form-data" })) {%> <fieldset> <legend>Fields</legend> <p> <label for="name">name:</label> <%= Html.TextBox("name") %> <%= Html.ValidationMessage("name", "*") %> </p> </fieldset> <% } %> and the Controller [AcceptVerbs(HttpVerbs.Post)] public ActionResult upload(FormCollection form) { Person lastname = new Person(); lastname.name = form["name"]; return RedirectToAction("Index"); } Thx for answer my question In advance

    Read the article

  • Prototype's Ajax.Updater not actually updating on IE7.

    - by Ben S
    I am trying to submit a form using Ajax.Updater and have the result of that update a div element in my page. Everything works great in IE6, FF3, Chrome and Opera. However, In IE7 it sporadically works, but more often than not, it just doesn't seem to do anything. Here's the javascript: function testcaseHistoryUpdate(testcase, form) { document.body.style.cursor = 'wait'; var param = Form.serialize(form); new Ajax.Updater("content", "results/testcaseHistory/" + testcase, { onComplete: function(transport) {document.body.style.cursor = 'auto'}, parameters: param, method: 'post' } ); } I've verified using alert() calls that param is set to what I expect. I've read in many places that IE7 caches aggressively and that it might be the root cause, however every after adding the following to my php response, it still doesn't work. header("Last-Modified: " . gmdate("D, d M Y H:i:s") . " GMT"); header("Cache-Control: no-store, no-cache, must-revalidate"); header("Cache-Control: post-check=0, pre-check=0", false); header("Pragma: no-cache"); To further try to fix a caching issue I've tried adding a bogus parameter which just gets filled with a random value to have different parameters for every call, but that didn't help. I've also found this, where UTF-8 seemed to be causing an issue with IE7, but my page is clearly marked: <meta http-equiv="Content-Type" content="text/html; charset=iso-8859-1" /> Does anyone have any idea what could be wrong with IE7 as opposed to the other browsers I tested to cause this kind of issue?

    Read the article

  • Verifying existence of name and password in NSUserDefaults to Skip a login/Screen

    - by Michael Robinson
    I have a Tabbar/Tableview App that modally loads a Login/Signup view when the app loads, I have set up a Root.plist in a settings bundle for the name and password and have successfully retrieved the items. I want to be able to do two things: 1) Do a test to see if the NSUserDefault Strings are empty and if so load the Login/Signup view. 2) If the strings are available then use the string contents to login to my Webservice. Thanks in advance. Here is my LoginViewController .m : @synthesize usernameField; @synthesize passwordField; @synthesize loginButton; @synthesize loginIndicator; @synthesize usernameLabel; @synthesize passwordLabel; -(void)refreshFields { NSUserDefaults *defaults = [NSUserDefaults standardUserDefaults]; usernameLabel.text = [defaults objectForKey:kUsernameKey]; passwordLabel.text = [defaults objectForKey:kPasswordKey]; } - (void)viewDidAppear:(BOOL)animated { [self refreshFields]; [super viewDidAppear:animated]; } - (void)viewDidLoad { [super viewDidLoad]; [self refreshFields]; [self.navigationController setNavigationBarHidden:YES animated:NO]; } - (IBAction) login: (id) sender { { NSString *post =[NSString stringWithFormat:@"username=%@&password=%@",usernameField.text, passwordField.text]; NSString *hostStr = @"http:~iphone_login.php?"; hostStr = [hostStr stringByAppendingString:post]; NSData *dataURL = [NSData dataWithContentsOfURL: [ NSURL URLWithString: hostStr ]]; NSString *serverOutput = [[NSString alloc] initWithData:dataURL encoding: NSASCIIStringEncoding]; NSLog(@"Site: %@",hostStr); NSLog(@"Site: %@",serverOutput); if([serverOutput isEqualToString:@"Yes"]){ UIAlertView *alertsuccess = [[UIAlertView alloc] initWithTitle:@"Congrats" message:@"You are authorized " delegate:self cancelButtonTitle:@"OK" otherButtonTitles:nil, nil]; [alertsuccess show]; [alertsuccess release];

    Read the article

  • Django Cannot set values on a ManyToManyField which specifies an intermediary model

    - by dana
    i am using a m2m and a through table, and when i was trying to save, my error was: Cannot set values on a ManyToManyField which specifies an intermediary model so, i've modified my code, so that when i save the form, to insert data into the 'through' table too.But now, i'm having another error. (i've bolded the lines where i think i am wrong) i have in models.py: class Classroom(models.Model): user = models.ForeignKey(User, related_name = 'classroom_creator') classname = models.CharField(max_length=140, unique = True) date = models.DateTimeField(auto_now=True) open_class = models.BooleanField(default=True) members = models.ManyToManyField(User,related_name="list of invited members", through = 'Membership') class Membership(models.Model): accept = models.BooleanField(User) date = models.DateTimeField(auto_now = True) classroom = models.ForeignKey(Classroom, related_name = 'classroom_membership') member = models.ForeignKey(User, related_name = 'user_membership') and in def save_classroom(request): if request.method == 'POST': form = ClassroomForm(request.POST, request.FILES, user = request.user) **classroom_instance = Classroom member_instance = Membership** if form.is_valid(): new_obj = form.save(commit=False) new_obj.user = request.user r = Relations.objects.filter(initiated_by = request.user) membership = Membership.objects.create(**classroom = classroom_instance, member = member_instance,date=datetime.datetime.now())** new_obj.save() form.save_m2m() return HttpResponseRedirect('/classroom/classroom_view/{{user}}/') else: form = ClassroomForm(user = request.user) return render_to_response('classroom/classroom_form.html', { 'form': form, }, context_instance=RequestContext(request)) but i don't seem to initialise okay the classroom_instance and menber_instance.My error os: Cannot assign "": "Membership.classroom" must be a "Classroom" instance. Thanks!

    Read the article

  • How to log in to craigslist using c#

    - by kosikiza
    i m using the following code to log in to craigslist, but haven't succeeded yet. string formParams = string.Format("inputEmailHandle={0}&inputPassword={1}", "[email protected]", "removed"); //string postData = "[email protected]&inputPassword=removed"; string uri = "https://accounts.craigslist.org/"; HttpWebRequest request = (HttpWebRequest)WebRequest.Create(uri); request.KeepAlive = true; request.ProtocolVersion = HttpVersion.Version10; request.Method = "POST"; byte[] postBytes = Encoding.ASCII.GetBytes(formParams); request.ContentType = "application/x-www-form-urlencoded"; request.ContentLength = postBytes.Length; Stream requestStream = request.GetRequestStream(); requestStream.Write(postBytes, 0, postBytes.Length); requestStream.Close(); HttpWebResponse response = (HttpWebResponse)request.GetResponse(); cookyHeader = response.Headers["Set-cookie"]; string pageSource; string getUrl = "https://post.craigslist.org/del"; WebRequest getRequest = WebRequest.Create(getUrl); getRequest.Headers.Add("Cookie", cookyHeader); WebResponse getResponse = getRequest.GetResponse(); using (StreamReader sr = new StreamReader(getResponse.GetResponseStream())) { pageSource = sr.ReadToEnd(); }

    Read the article

  • Which Message Queue should I choose (must run on Linux)

    - by MHS
    There are many open source Message queues for Linux, and I need some help deciding what I should go for. My problem is simple - I get sent a list of files that needs to be processed. Each job can't be split up, but they are self contained and can be spread to multiple computers. I'm thinking of solving this using a message queue. Multiple clients send a message to a central queue. Each queue has a number of subscribers that will take jobs from that queue when they have finished processing the current job. Ideally it should have the following qualities Message queue must be able to store unprocessed messages in case of a shutdown/reboot A job can only be processed by a single subscriber (don't want duplicate jobs) The subscribers should be able to send jobs of their own, that will be processed by a different set of subscribers. Can anyone suggest a simple to use message queue?

    Read the article

  • Posting XML form data to a RESTful Server with Javascript or PHP

    - by pjs-worker
    Hi folks, I've been given the task of posting to a RESTful server. I'm new to the official "REST" but I've played with the concept before. However, this time I have an XML Payload example file that I am supposed to post. I'm struggling to figure out how the two relate. Can you help? Right now I can post to a specific site, say www.pcpost.com/schema/Application I can generate the URL for the inital, ie: postApplication?userid=4&... Being relatively new to web programming, I find that don't know how to take the following and interface it with the server. I'm at least familiar with Javascript and PHP. If this is impossible with those two types, I can learn whatever would be best. Thanks for your help on this. C <?xml version=\"1.0\" ?> <Application xmlns="http://www.pcpost.com/schema/Application" SchemaVersion="1.0" ProgramId="8" ApplicationDate="2009-08-29"> <Vendors> <Vendor Role="Applicant" Company="Test Company" Contact="Smith, John"/> <Vendor Role="Seller" Company="Test Company" Contact="Doe, Jane"/> <Vendor Role="Installer" Company="Test Company" Contact="Funk, Carl"/> </Vendors> <Participants> <Participant TaxStatus="Individual" Sector="Commercial"> <Roles> <Role>Host Customer</Role> </Roles> </Participants> </Application>

    Read the article

< Previous Page | 362 363 364 365 366 367 368 369 370 371 372 373  | Next Page >