Search Results

Search found 13602 results on 545 pages for 'python decorators'.

Page 368/545 | < Previous Page | 364 365 366 367 368 369 370 371 372 373 374 375  | Next Page >

  • twisted reactor stops too early

    - by pygabriel
    I'm doing a batch script to connect to a tcp server and then exiting. My problem is that I can't stop the reactor, for example: cmd = raw_input("Command: ") # custom factory, the protocol just send a line reactor.connectTCP(HOST,PORT, CommandClientFactory(cmd) d = defer.Deferred() d.addCallback(lambda x: reactor.stop()) reactor.callWhenRunning(d.callback,None) reactor.run() In this code the reactor stops before that the tcp connection is done and the cmd is passed. How can I stop the reactor after that all the operation are finished?

    Read the article

  • How to build a Django form which requires a delay to be re-submitted ?

    - by pierre-guillaume-degans
    Hey, In order to avoid spamming, I would like to add a waiting time to re-submit a form (i.e. the user should wait a few seconds to submit the form, except the first time that this form is submitted). To do that, I added a timestamp to my form (and a security_hash field containing the timestamp plus the settings.SECRET_KEY which ensures that the timestamp is not fiddled with). This look like: class MyForm(forms.Form): timestamp = forms.IntegerField(widget=forms.HiddenInput) security_hash = forms.CharField(min_length=40, max_length=40, widget=forms.HiddenInput) # + some other fields.. # + methods to build the hash and to clean the timestamp... # (it is based on django.contrib.comments.forms.CommentSecurityForm) def clean_timestamp(self): """Make sure the delay is over (5 seconds).""" ts = self.cleaned_data["timestamp"] if not time.time() - ts > 5: raise forms.ValidationError("Timestamp check failed") return ts # etc... This works fine. However there is still an issue: the timestamp is checked the first time the form is submitted by the user, and I need to avoid this. Any idea to fix it ? Thank you ! :-)

    Read the article

  • Url open encoding

    - by badc0re
    I have the following code for urllib and BeautifulSoup: getSite = urllib.urlopen(pageName) # open current site getSitesoup = BeautifulSoup(getSite.read()) # reading the site content print getSitesoup.originalEncoding for value in getSitesoup.find_all('link'): # extract all <a> tags defLinks.append(value.get('href')) The result of it: /usr/lib/python2.6/site-packages/bs4/dammit.py:231: UnicodeWarning: Some characters could not be decoded, and were replaced with REPLACEMENT CHARACTER. "Some characters could not be decoded, and were " And when i try to read the site i get: ?7?e????0*"I??G?H????F??????9-??????;??E?YÞBs????????????4i???)?????^W?????`w?Ke??%??*9?.'OQB???V??@?????]???(P??^??q?$?S5???tT*?Z

    Read the article

  • Django says the "id may not be NULL" but why is it?

    - by Oli
    I'm going crazy today. I just tried to insert a new record and it threw back a "post_blogpost.id may not be NULL" error. Here's my model: class BlogPost(models.Model): title = models.CharField(max_length=100) slug = models.SlugField(max_length=100) who = models.ForeignKey(User, default=1) when = models.DateTimeField() intro = models.TextField(blank=True, null=True) content = models.TextField(blank=True, null=True) counter = models.PositiveIntegerField(default=0) published = models.BooleanField(default=False) css = models.TextField(blank=True, null=True) class Meta: ordering = ('-when', 'id') There are a number of functions beneath the model too but I won't include them in full here. Their names are: content_cache_key, clear_cache, __unicode__, reads, read, processed_content. I'm adding through the admin... And I'm running out of hair.

    Read the article

  • I am currently serving my static files in Django. How do I use Apache2 to do this?

    - by alex
    (r'^media/(?P<path>.*)$', 'django.views.static.serve',{'document_root': settings.MEDIA_ROOT}), As you can see, I have a directory called "media" under my Django project. I would like to delete this line in my urls.py and instead us Apache to serve my static files. What do I do to my Apache configs (which files do I change) in order to do this? By the way, I installed Apache2 like normal: sudo aptitude install apache2

    Read the article

  • split twice in the same expression?

    - by UcanDoIt
    Imagine I have the following: inFile = "/adda/adas/sdas/hello.txt" # that instruction give me hello.txt Name = inFile.name.split("/") [-1] # that one give me the name I want - just hello Name1 = Name.split(".") [0] Is there any chance to simplify that doing the same job in just one expression?

    Read the article

  • Preserving the dimensions of a slice from a Numpy 3d array

    - by Brendan
    I have a 3d array, a, of shape say a.shape = (10, 10, 10) When slicing, the dimensions are squeezed automatically i.e. a[:,:,5].shape = (10, 10) I'd like to preserve the number of dimensions but also ensure that the dimension that was squeezed is the one that shows 1 i.e. a[:,:,5].shape = (10, 10, 1) I have thought of re-casting the array and passing ndmin but that just adds the extra dimensions to the start of the shape tuple regardless of where the slice came from in the array a.

    Read the article

  • Web2py controllers with parameters?

    - by nickfranceschina
    I am building an app using Web2py framework... I don't want to have to use the request object to get all of the querystring parameters, instead I'd like to build my controller with named parameters and have the router unpack the querystring (or form data) dictionary into the named parameters and call my controller. so instead of a controller method of create_user(): where I would use the global request() object and look through the vars list... I would prefer instead to have create_user(first_name, last_name, email): like I see in other MVC platforms. is this possible in Web2py already? or is there a plugin for it? or do I need to add that myself?

    Read the article

  • [Django] How to find out whether a model's column is a foreign key?

    - by codethief
    I'm dynamically storing information in the database depending on the request: // table, id and column are provided by the request table_obj = getattr(models, table) record = table_obj.objects.get(pk=id) setattr(record, column, request.POST['value']) The problem is that request.POST['value'] sometimes contains a foreign record's primary key (i.e. an integer) whereas Django expects the column's value to be an object of type ForeignModel: Cannot assign "u'122'": "ModelA.b" must be a "ModelB" instance. Now, is there an elegant way to dynamically check whether b is a column containing foreign keys and what model these keys are linked to? (So that I can load the foreign record by it's primary key and assign it to ModelA?) Or doesn't Django provide information like this to the programmer so I really have to get my hands dirty and use isinstance() on the foreign-key column?

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • basic unique ModelForm field for Google App Engine

    - by Alexander Vasiljev
    I do not care about concurrency issues. It is relatively easy to build unique form field: from django import forms class UniqueUserEmailField(forms.CharField): def clean(self, value): self.check_uniqueness(super(UniqueUserEmailField, self).clean(value)) def check_uniqueness(self, value): same_user = users.User.all().filter('email', value).get() if same_user: raise forms.ValidationError('%s already_registered' % value) so one could add users on-the-fly. Editing existing user is tricky. This field would not allow to save user having other user email. At the same time it would not allow to save a user with the same email. What code do you use to put a field with uniqueness check into ModelForm?

    Read the article

  • Tkinter Packing Strangeness: Buttons packed above others

    - by Parand
    I'm sure I'm doing something obvious wrong here, but I can't see it. I end up with the "Should be on top" label packed at the bottom instead of at the top. What am I doing wrong? from Tkinter import * class SelectAction(Frame): buttons = {} def callback(self): print "Callback" def createWidgets(self): logo_label = Label(text="Should be on top").pack(fill=X) for name, text, callback in ( ('setup_account', 'Account Settings', self.callback), ('do_action', 'Do Something', self.callback), ): self.buttons[name] = Button(self, text=text, command=callback).pack(fill=X) def __init__(self, master=None): Frame.__init__(self, master) self.pack() self.createWidgets() if __name__ == "__main__": root = Tk() app = SelectAction(master=root) app.mainloop() root.destroy()

    Read the article

  • Google App Engine with local Django 1.1 gets Intermittent Failures

    - by Jon Watte
    I'm using the Windows Launcher development environment for Google App Engine. I have downloaded Django 1.1.2 source, and un-tarrred the "django" subdirectory to live within my application directory (a peer of app.yaml) At the top of each .py source file, I do this: import settings import os os.environ["DJANGO_SETTINGS_MODULE"] = 'settings' In my file settings.py (which lives at the root of the app directory, as well), I do this: DEBUG = True TEMPLATE_DIRS = ('html') INSTALLED_APPS = ('filters') import os os.environ["DJANGO_SETTINGS_MODULE"] = 'settings' from google.appengine.dist import use_library use_library('django', '1.1') from django.template import loader Yes, this looks a bit like overkill, doesn't it? I only use django.template. I don't explicitly use any other part of django. However, intermittently I get one of two errors: 1) Django complains that DJANGO_SETTINGS_MODULE is not defined. 2) Django complains that common.html (a template I'm extending in other templates) doesn't exist. 95% of the time, these errors are not encountered, and they randomly just start happening. Once in that state, the local server seems "wedged" and re-booting it generally fixes it. What's causing this to happen, and what can I do about it? How can I even debug it? Here is the traceback from the error: Traceback (most recent call last): File "C:\code\kwbudget\edit_budget.py", line 34, in get self.response.out.write(t.render(template.Context(values))) File "C:\code\kwbudget\django\template\__init__.py", line 165, in render return self.nodelist.render(context) File "C:\code\kwbudget\django\template\__init__.py", line 784, in render bits.append(self.render_node(node, context)) File "C:\code\kwbudget\django\template\__init__.py", line 797, in render_node return node.render(context) File "C:\code\kwbudget\django\template\loader_tags.py", line 71, in render compiled_parent = self.get_parent(context) File "C:\code\kwbudget\django\template\loader_tags.py", line 66, in get_parent raise TemplateSyntaxError, "Template %r cannot be extended, because it doesn't exist" % parent TemplateSyntaxError: Template u'common.html' cannot be extended, because it doesn't exist And edit_budget.py starts with exactly the lines that I included up top. All templates live in a directory named "html" in my root directory, and "html/common.html" exists. I know the template engine finds them, because I start out with "html/edit_budget.html" which extends common.html. It looks as if the settings module somehow isn't applied (because that's what adds html to the search path for templates).

    Read the article

  • Conditional operator in Mako using Pylons

    - by Antoine Leclair
    In PHP, I often use the conditional operator to add an attribute to an html element if it applies to the element in question. For example: <select name="blah"> <option value="1"<?= $blah == 1 ? ' selected="selected"' : '' ?>> One </option> <option value="2"<?= $blah == 2 ? ' selected="selected"' : '' ?>> Two </option> </select> I'm starting a project with Pylons using Mako for the templating. How can I achieve something similar? Right now, I see two possibilities that are not ideal. Solution 1: <select name="blah"> % if blah == 1: <option value="1" selected="selected">One</option> % else: <option value="1">One</option> % endif % if blah == 2: <option value="2" selected="selected">Two</option> % else: <option value="2">Two</option> % endif </select> Solution 2: <select name="blah"> <option value="1" % if blah == 1: selected="selected" % endif >One</option> <option value="2" % if blah == 2: selected="selected" % endif >Two</option> </select> In this particular case, the value is equal to the variable tested (value="1" = blah == 1), but I use the same pattern in other situations, like <?= isset($variable) ? ' value="$variable" : '' ?>. I am looking for a clean way to achieve this using Mako.

    Read the article

  • Removing specific ticks from matplotlib plot

    - by Jsg91
    I'm trying to remove the origin ticks from my plot below to stop them overlapping, alternatively just moving them away from each other would also be great I tried this: xticks = ax.xaxis.get_major_ticks() xticks[0].label1.set_visible(False) yticks = ax.yaxis.get_major_ticks() yticks[0].label1.set_visible(False) However this removed the first and last ticks from the y axis like so: Does anyone have an idea about how to do this? Any help would be greatly appreciated.

    Read the article

  • Rearranging a sequence

    - by sarah
    I'm have trouble rearranging sequences so the amount of letters in the given original sequence are the same in the random generated sequences. For example: If i have a string 'AAAC' I need that string rearranged randomly so the amount of A's and C's are the same.

    Read the article

  • how to make my method running on the template of google-app-engine..

    - by zjm1126
    the model is : class someModel(db.Model): name = db.StringProperty() def name_is_sss(self): return self.name=='sss' the view is : a=someModel() a.name='sss' path = os.path.join(os.path.dirname(__file__), os.path.join('templates', 'blog/a.html')) self.response.out.write(template.render(path, {'a':a})) and the html is : {{ a.name_is_sss }} the page shows : True so i want to make it more useful, and like this: the model: class someModel(db.Model): name = db.StringProperty() def name_is_x(self,x): return self.name==x the html is : {% a.name_is_x 'www'%} or {{ a.name_is_x 'www'}} but the error is : TemplateSyntaxError: Invalid block tag: 'a.name_is_x' or TemplateSyntaxError: Could not parse the remainder: 'www' so how to make my method running thanks

    Read the article

< Previous Page | 364 365 366 367 368 369 370 371 372 373 374 375  | Next Page >