Search Results

Search found 13602 results on 545 pages for 'python decorators'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 366/545 | < Previous Page | 362 363 364 365 366 367 368 369 370 371 372 373  | Next Page >

  • Is using os.path.abspath to validate an untrusted filename's location secure?

    - by mcmt
    I don't think I'm missing anything. Then again I'm kind of a newbie. def GET(self, filename): name = urllib.unquote(filename) full = path.abspath(path.join(STATIC_PATH, filename)) #Make sure request is not tricksy and tries to get out of #the directory, e.g. filename = "../.ssh/id_rsa". GET OUTTA HERE assert full[:len(STATIC_PATH)] == STATIC_PATH, "bad path" return open(full).read() Edit: I realize this will return the wrong HTTP error code if the file doesn't exist (at least under web.py). I will fix this.

    Read the article

  • How to get bit rotation function to accept any bit size?

    - by calccrypto
    i have these 2 functions i got from some other code def ROR(x, n): mask = (2L**n) - 1 mask_bits = x & mask return (x >> n) | (mask_bits << (32 - n)) def ROL(x, n): return ROR(x, 32 - n) and i wanted to use them in a program, where 16 bit rotations are required. however, there are also other functions that require 32 bit rotations, so i wanted to leave the 32 in the equation, so i got: def ROR(x, n, bits = 32): mask = (2L**n) - 1 mask_bits = x & mask return (x >> n) | (mask_bits << (bits - n)) def ROL(x, n, bits = 32): return ROR(x, bits - n) however, the answers came out wrong when i tested this set out. yet, the values came out correctly when the code is def ROR(x, n): mask = (2L**n) - 1 mask_bits = x & mask return (x >> n) | (mask_bits << (16 - n)) def ROL(x, n,bits): return ROR(x, 16 - n) what is going on and how do i fix this?

    Read the article

  • I am currently serving my static files in Django. How do I use Apache2 to do this?

    - by alex
    (r'^media/(?P<path>.*)$', 'django.views.static.serve',{'document_root': settings.MEDIA_ROOT}), As you can see, I have a directory called "media" under my Django project. I would like to delete this line in my urls.py and instead us Apache to serve my static files. What do I do to my Apache configs (which files do I change) in order to do this? By the way, I installed Apache2 like normal: sudo aptitude install apache2

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • I am trying to move a rectangle in Pygame using coordinates but won't work

    - by user1821449
    this is my code import pygame from pygame.locals import * import sys pygame.init() pygame.display.set_caption("*no current mission*") size = (1280, 750) screen = pygame.display.set_mode(size) clock = pygame.time.Clock() bg = pygame.image.load("bg1.png") guy = pygame.image.load("hero_stand.png") rect = guy.get_rect() x = 10 y = 10 while True: for event in pygame.event.get(): if event.type == pygame.QUIT: sys.exit() if event.type == KEYDOWN: _if event.key == K_RIGHT: x += 5 rect.move(x,y)_ rect.move(x,y) screen.blit(bg,(0,0)) screen.blit(guy, rect) pygame.display.flip() it is just a simple test to see if i can get a rectangle to move. Everything seems to work except the code I put in italic.

    Read the article

  • method __getattr__ is not inherited from parent class

    - by ??????
    Trying to subclass mechanize.Browser class: from mechanize import Browser class LLManager(Browser, object): IS_AUTHORIZED = False def __init__(self, login = "", passw = "", *args, **kwargs): super(LLManager, self).__init__(*args, **kwargs) self.set_handle_robots(False) But when I make something like this: lm["Widget[LinksList]_link_1_title"] = anc then I get an error: Traceback (most recent call last): File "<pyshell#8>", line 1, in <module> lm["Widget[LinksList]_link_1_title"] = anc TypeError: 'LLManager' object does not support item assignment Browser class have overridden method __getattr__ as shown: def __getattr__(self, name): # pass through _form.HTMLForm methods and attributes form = self.__dict__.get("form") if form is None: raise AttributeError( "%s instance has no attribute %s (perhaps you forgot to " ".select_form()?)" % (self.__class__, name)) return getattr(form, name) Why my class or instance don't get this method as in parent class?

    Read the article

  • How come my South migrations doesn't work for Django?

    - by TIMEX
    First, I create my database. create database mydb; I add "south" to installed Apps. Then, I go to this tutorial: http://south.aeracode.org/docs/tutorial/part1.html The tutorial tells me to do this: $ py manage.py schemamigration wall --initial >>> Created 0001_initial.py. You can now apply this migration with: ./manage.py migrate wall Great, now I migrate. $ py manage.py migrate wall But it gives me this error... django.db.utils.DatabaseError: (1146, "Table 'fable.south_migrationhistory' doesn't exist") So I use Google (which never works. hence my 870 questions asked on Stackoverflow), and I get this page: http://groups.google.com/group/south-users/browse_thread/thread/d4c83f821dd2ca1c Alright, so I follow that instructions >> Drop database mydb; >> Create database mydb; $ rm -rf ./wall/migrations $ py manage.py syncdb But when I run syncdb, Django creates a bunch of tables. Yes, it creates the south_migrationhistory table, but it also creates my app's tables. Synced: > django.contrib.admin > django.contrib.auth > django.contrib.contenttypes > django.contrib.sessions > django.contrib.sites > django.contrib.messages > south > fable.notification > pagination > timezones > fable.wall > mediasync > staticfiles > debug_toolbar Not synced (use migrations): - (use ./manage.py migrate to migrate these) Cool....now it tells me to migrate these. So, I do this: $ py manage.py migrate wall The app 'wall' does not appear to use migrations. Alright, so fine. I'll add wall to initial migrations. $ py manage.py schemamigration wall --initial Then I migrate: $ py manage.py migrate wall You know what? It gives me this BS: _mysql_exceptions.OperationalError: (1050, "Table 'wall_content' already exists") Sorry, this is really pissing me off. Can someone help ? thanks. How do I get South to work and sync correctly with everything?

    Read the article

  • Unable to control requests for static files on Google App Engine

    - by dan
    My simple GAE app is not redirecting to the /static directory for requests when url is multiple levels. Dir structure: /app/static/css/main.css App: I have two handlers one for /app and one for /app/new app.yaml: handlers: - url: /static static_dir: static - url: /app/static/(.*) static_dir: static\1 - url: /app/.* script: app.py login: required HTML: Description: When page is loaded from /app HTTP request for main.css is successful GET /static/css/main.css But when page is loaded from /app/new I see the following request: GET /app/static/css/main.cs That's when I tried adding the /app/static/(.*) in the app.yaml but it is not having any effect.

    Read the article

  • Why does my buffered GraphicsContext application have a flickering problem?

    - by Bibendum
    import wx class MainFrame(wx.Frame): def __init__(self,parent,title): wx.Frame.__init__(self, parent, title=title, size=(640,480)) self.mainPanel=DoubleBufferTest(self,-1) self.Show(True) class DoubleBufferTest(wx.Panel): def __init__(self,parent=None,id=-1): wx.Panel.__init__(self,parent,id,style=wx.FULL_REPAINT_ON_RESIZE) self.SetBackgroundColour("#FFFFFF") self.timer = wx.Timer(self) self.timer.Start(100) self.Bind(wx.EVT_TIMER, self.update, self.timer) self.Bind(wx.EVT_PAINT,self.onPaint) def onPaint(self,event): event.Skip() dc = wx.MemoryDC() dc.SelectObject(wx.EmptyBitmap(640, 480)) gc = wx.GraphicsContext.Create(dc) gc.PushState() gc.SetBrush(wx.Brush("#CFCFCF")) bgRect=gc.CreatePath() bgRect.AddRectangle(0,0,640,480) gc.FillPath(bgRect) gc.PopState() dc2=wx.PaintDC(self) dc2.Blit(0,0,640,480,dc,0,0) def update(self,event): self.Refresh() app = wx.App(False) f=MainFrame(None,"Test") app.MainLoop() I've come up with this code to draw double buffered GraphicsContext content onto a panel, but there's a constant flickering across the window. I've tried different kinds of paths, like lines and curves but it's still there and I don't know what's causing it.

    Read the article

  • Not able to pass multiple override parameters using nose-testconfig 0.6 plugin in nosetests

    - by Jaikit
    Hi, I am able to override multiple config parameters using nose-testconfig plugin only if i pass the overriding parameters on commandline. e.g. nosetests -c nose.cfg -s --tc=jack.env1:asl --tc=server2.env2:abc But when I define the same thing inside nose.cfg, than only the value for last parameter is modified. e.g. tc = server2.env2:abc tc = jack.env1:asl I checked the plugin code. It looks fine to me. I am pasting the part of plugin code below: parser.add_option( "--tc", action="append", dest="overrides", default = [], help="Option:Value specific overrides.") configure: if options.overrides: self.overrides = [] overrides = tolist(options.overrides) for override in overrides: keys, val = override.split(":") if options.exact: config[keys] = val else: ns = ''.join(['["%s"]' % i for i in keys.split(".") ]) # BUG: Breaks if the config value you're overriding is not # defined in the configuration file already. TBD exec('config%s = "%s"' % (ns, val)) Let me know if any one has any clue.

    Read the article

  • Simple way to create possible case

    - by bugbug
    I have lists of data such as a = [1,2,3,4] b = ["a","b","c","d","e"] c = ["001","002","003"] And I want to create new another list that was mixed from all possible case of a,b,c like this d = ["1a001","1a002","1a003",...,"4e003"] Is there any module or method to generate d without write many for loop?

    Read the article

  • How to build a Django form which requires a delay to be re-submitted ?

    - by pierre-guillaume-degans
    Hey, In order to avoid spamming, I would like to add a waiting time to re-submit a form (i.e. the user should wait a few seconds to submit the form, except the first time that this form is submitted). To do that, I added a timestamp to my form (and a security_hash field containing the timestamp plus the settings.SECRET_KEY which ensures that the timestamp is not fiddled with). This look like: class MyForm(forms.Form): timestamp = forms.IntegerField(widget=forms.HiddenInput) security_hash = forms.CharField(min_length=40, max_length=40, widget=forms.HiddenInput) # + some other fields.. # + methods to build the hash and to clean the timestamp... # (it is based on django.contrib.comments.forms.CommentSecurityForm) def clean_timestamp(self): """Make sure the delay is over (5 seconds).""" ts = self.cleaned_data["timestamp"] if not time.time() - ts > 5: raise forms.ValidationError("Timestamp check failed") return ts # etc... This works fine. However there is still an issue: the timestamp is checked the first time the form is submitted by the user, and I need to avoid this. Any idea to fix it ? Thank you ! :-)

    Read the article

  • initialize a numpy array

    - by Curious2learn
    Is there way to initialize a numpy array of a shape and add to it? I will explain what I need with a list example. If I want to create a list of objects generated in a loop, I can do: a = [] for i in range(5): a.append(i) I want to do something similar with a numpy array. I know about vstack, concatenate etc. However, it seems these require two numpy arrays as inputs. What I need is: big_array # Initially empty. This is where I don't know what to specify for i in range(5): array i of shape = (2,4) created. add to big_array The big_array should have a shape (10,4). How to do this? Thanks for your help.

    Read the article

  • Condition checking vs. Exception handling

    - by Aidas Bendoraitis
    When is exception handling more preferable than condition checking? There are many situations where I can choose using one or the other. For example, this is a summing function which uses a custom exception: # module mylibrary class WrongSummand(Exception): pass def sum_(a, b): """ returns the sum of two summands of the same type """ if type(a) != type(b): raise WrongSummand("given arguments are not of the same type") return a + b # module application using mylibrary from mylibrary import sum_, WrongSummand try: print sum_("A", 5) except WrongSummand: print "wrong arguments" And this is the same function, which avoids using exceptions # module mylibrary def sum_(a, b): """ returns the sum of two summands if they are both of the same type """ if type(a) == type(b): return a + b # module application using mylibrary from mylibrary import sum_ c = sum_("A", 5) if c is not None: print c else: print "wrong arguments" I think that using conditions is always more readable and manageable. Or am I wrong? What are the proper cases for defining APIs which raise exceptions and why?

    Read the article

  • need help in site classification

    - by goh
    hi guys, I have to crawl the contents of several blogs. The problem is that I need to classify whether the blogs the authors are from a specific school and is talking about the school's stuff. May i know what's the best approach in doing the crawling or how should i go about the classification?

    Read the article

  • How to replace empty string with zero in comma-separated string?

    - by dsaccount1
    "8,5,,1,4,7,,,,7,,1,9,3,6,,,8,6,3,9,,2,5,4,,,,,3,2,,,7,4,1,1,,4,,6,9,,5,,,,5,,,1,,6,3,,,6,5,,,,7,4,,1,7,6,,,,8,,5,,,7,1,,3,9," I'm doing a programming challenge where i need to parse this sequence into my sudoku script. Need to get the above sequence into 8,5,0,1,4,7,0,0,0,7,0,1,9,3,6,0,0,8......... I tried re but without success, help is appreciated, thanks.

    Read the article

  • SQLAlchemy returns tuple not dictionary

    - by Ivan
    Hi everyone, I've updated SQLAlchemy to 0.6 but it broke everything. I've noticed it returns tuple not a dictionary anymore. Here's a sample query: query = session.query(User.id, User.username, User.email).filter(and_(User.id == id, User.username == username)).limit(1) result = session.execute(query).fetchone() This piece of code used to return a dictionary in 0.5. My question is how can I return a dictionary?

    Read the article

  • Scrapy Not Returning Additonal Info from Scraped Link in Item via Request Callback

    - by zoonosis
    Basically the code below scrapes the first 5 items of a table. One of the fields is another href and clicking on that href provides more info which I want to collect and add to the original item. So parse is supposed to pass the semi populated item to parse_next_page which then scrapes the next bit and should return the completed item back to parse Running the code below only returns the info collected in parse If I change the return items to return request I get a completed item with all 3 "things" but I only get 1 of the rows, not all 5. Im sure its something simple, I just can't see it. class ThingSpider(BaseSpider): name = "thing" allowed_domains = ["somepage.com"] start_urls = [ "http://www.somepage.com" ] def parse(self, response): hxs = HtmlXPathSelector(response) items = [] for x in range (1,6): item = ScrapyItem() str_selector = '//tr[@name="row{0}"]'.format(x) item['thing1'] = hxs.select(str_selector")]/a/text()').extract() item['thing2'] = hxs.select(str_selector")]/a/@href').extract() print 'hello' request = Request("www.nextpage.com", callback=self.parse_next_page,meta={'item':item}) print 'hello2' request.meta['item'] = item items.append(item) return items def parse_next_page(self, response): print 'stuff' hxs = HtmlXPathSelector(response) item = response.meta['item'] item['thing3'] = hxs.select('//div/ul/li[1]/span[2]/text()').extract() return item

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 362 363 364 365 366 367 368 369 370 371 372 373  | Next Page >