Search Results

Search found 14399 results on 576 pages for 'python noob'.

Page 369/576 | < Previous Page | 365 366 367 368 369 370 371 372 373 374 375 376  | Next Page >

  • ImportError and Django driving me crazy

    - by John Peebles
    OK, I have the following directory structure (it's a django project): - project -- app and within the app folder, there is a scraper.py file which needs to reference a class defined within models.py I'm trying to do the following: import urllib2 import os import sys import time import datetime import re import BeautifulSoup sys.path.append('/home/userspace/Development/') os.environ['DJANGO_SETTINGS_MODULE'] = 'project.settings' from project.app.models import ClassName and this code just isn't working. I get an error of: Traceback (most recent call last): File "scraper.py", line 14, in from project.app.models import ClassName ImportError: No module named project.app.models This code above used to work, but broke somewhere along the line and I'm extremely confused as to why I'm having problems. On SnowLeopard using python2.5.

    Read the article

  • SQLAlchemy returns tuple not dictionary

    - by Ivan
    Hi everyone, I've updated SQLAlchemy to 0.6 but it broke everything. I've noticed it returns tuple not a dictionary anymore. Here's a sample query: query = session.query(User.id, User.username, User.email).filter(and_(User.id == id, User.username == username)).limit(1) result = session.execute(query).fetchone() This piece of code used to return a dictionary in 0.5. My question is how can I return a dictionary?

    Read the article

  • How to replace empty string with zero in comma-separated string?

    - by dsaccount1
    "8,5,,1,4,7,,,,7,,1,9,3,6,,,8,6,3,9,,2,5,4,,,,,3,2,,,7,4,1,1,,4,,6,9,,5,,,,5,,,1,,6,3,,,6,5,,,,7,4,,1,7,6,,,,8,,5,,,7,1,,3,9," I'm doing a programming challenge where i need to parse this sequence into my sudoku script. Need to get the above sequence into 8,5,0,1,4,7,0,0,0,7,0,1,9,3,6,0,0,8......... I tried re but without success, help is appreciated, thanks.

    Read the article

  • uWSGI with Cherokee: first steps

    - by Steve
    Has anyone tried using uWSGI with Cherokee? Can you share your experiences and what documents you relied upon the most? I am trying to get started from the documentation on both (uWSGI and Cherokee) websites. Nothing works yet. I am using Ubuntu 10.04.

    Read the article

  • Raising events and object persistence in Django

    - by Mridang Agarwalla
    Hi, I have a tricky Django problem which didn't occur to me when I was developing it. My Django application allows a user to sign up and store his login credentials for a sites. The Django application basically allows the user to search this other site (by scraping content off it) and returns the result to the user. For each query, it does a couple of queries of the other site. This seemed to work fine but sometimes, the other site slaps me with a CAPTCHA. I've written the code to get the CAPTCHA image and I need to return this to the user so he can type it in but I don't know how. My search request (the query, the username and the password) in my Django application gets passed to a view which in turn calls the backend that does the scraping/search. When a CAPTCHA is detected, I'd like to raise a client side event or something on those lines and display the CAPTCHA to the user and wait for the user's input so that I can resume my search. I would somehow need to persist my backend object between calls. I've tried pickling it but it doesn't work because I get the Can't pickle 'lock' object error. I don't know to implement this though. Any help/ideas? Thanks a ton.

    Read the article

  • How can I lookup an attribute in any scope by name?

    - by Wai Yip Tung
    How can I lookup an attribute in any scope by name? My first trial is to use globals() and locals(). e.g. >>> def foo(name): ... a=1 ... print globals().get(name), locals().get(name) ... >>> foo('a') None 1 >>> b=1 >>> foo('b') 1 None >>> foo('foo') <function foo at 0x014744B0> None So far so good. However it fails to lookup any built-in names. >>> range <built-in function range> >>> foo('range') None None >>> int <type 'int'> >>> foo('int') None None Any idea on how to lookup built-in attributes?

    Read the article

  • Pygame Sprite/Font rendering issues

    - by Grimless
    Hey guys. Here's my problem: I have a game class that maintains a HUD overlay that has a bunch of elements, including header and footer background sprites. Everything was working fine until I added a 1024x128 footer sprite. Now two of my text labels will not render, despite the fact that they DO exist in my Group and self.elements array. Is there something I'm missing? When I take out the footerHUDImage line, all of the labels render correctly and everything works fine. When I add the footerHUDImage, two of the labels (the first two) no longer render and the third only sometimes renders. HELP PLEASE! Here is the code: class AoWHUD (object): def __init__(self, screen, delegate, dataSource): self.delegate = delegate self.dataSource = dataSource self.elements = [] headerHudImage = KJRImage("HUDBackground.png") self.elements.append(headerHudImage) headerHudImage.userInteractionEnabled = True footerHUDImage = KJRImage("ControlsBackground.png") self.elements.append(footerHUDImage) footerHUDImage.rect.bottom = screen.get_rect().height footerHUDImage.userInteractionEnabled = True lumberMessage = "Lumber: " + str(self.dataSource.lumber) lumberLabel = KJRLabel(lumberMessage, size = 48, color = (240, 200, 10)) lumberLabel.rect.topleft = (_kSpacingMultiple * 0, 0) self.elements.append(lumberLabel) stoneMessage = "Stone: " + str(self.dataSource.stone) stoneLabel = KJRLabel(stoneMessage, size = 48, color = (240, 200, 10)) stoneLabel.rect.topleft = (_kSpacingMultiple * 1, 0) self.elements.append(stoneLabel) metalMessage = "Metal: " + str(self.dataSource.metal) metalLabel = KJRLabel(metalMessage, size = 48, color = (240, 200, 10)) metalLabel.rect.topleft = (_kSpacingMultiple * 2, 0) self.elements.append(metalLabel) foodMessage = "Food: " + str(len(self.dataSource.units)) + "/" + str(self.dataSource.food) foodLabel = KJRLabel(foodMessage, size = 48, color = (240, 200, 10)) foodLabel.rect.topleft = (_kSpacingMultiple * 3, 0) self.elements.append(foodLabel) self.selectionSprites = {32 : pygame.image.load("Selected32.png").convert_alpha(), 64 : pygame.image.load("Selected64.png")} self._sprites_ = pygame.sprite.Group() for e in self.elements: self._sprites_.add(e) print self.elements def draw(self, screen): if self.dataSource.resourcesChanged: lumberMessage = "Lumber: " + str(self.dataSource.lumber) stoneMessage = "Stone: " + str(self.dataSource.stone) metalMessage = "Metal: " + str(self.dataSource.metal) foodMessage = "Food: " + str(len(self.dataSource.units)) + "/" + str(self.dataSource.food) self.elements[2].setText(lumberMessage) self.elements[2].rect.topleft = (_kSpacingMultiple * 0, 0) self.elements[3].setText(stoneMessage) self.elements[3].rect.topleft = (_kSpacingMultiple * 1, 0) self.elements[4].setText(metalMessage) self.elements[4].rect.topleft = (_kSpacingMultiple * 2, 0) self.elements[5].setText(foodMessage) self.elements[5].rect.topleft = (_kSpacingMultiple * 3, 0) self.dataSource.resourcesChanged = False self._sprites_.draw(screen) if self.delegate.selectedUnit: theSelectionSprite = self.selectionSprites[self.delegate.selectedUnit.rect.width] screen.blit(theSelectionSprite, self.delegate.selectedUnit.rect)

    Read the article

  • split twice in the same expression?

    - by UcanDoIt
    Imagine I have the following: inFile = "/adda/adas/sdas/hello.txt" # that instruction give me hello.txt Name = inFile.name.split("/") [-1] # that one give me the name I want - just hello Name1 = Name.split(".") [0] Is there any chance to simplify that doing the same job in just one expression?

    Read the article

  • Obtaining references to function objects on the execution stack from the frame object?

    - by Marcin
    Given the output of inspect.stack(), is it possible to get the function objects from anywhere from the stack frame and call these? If so, how? (I already know how to get the names of the functions.) Here is what I'm getting at: Let's say I'm a function and I'm trying to determine if my caller is a generator or a regular function? I need to call inspect.isgeneratorfunction() on the function object. And how do you figure out who called you? inspect.stack(), right? So if I can somehow put those together, I'll have the answer to my question. Perhaps there is an easier way to do this?

    Read the article

  • CherryPy and RESTful web api

    - by hyperboreean
    What's the best approach of creating a RESTful web api in CherryPy? I've been looking around for a few days now and nothing seems great. For Django it seems that are lots of tools to do this, but not for CherryPy or I am not aware of them

    Read the article

  • Returning Database Blobs in TurboGears 2.x / FCGI / Lighttpd extremely slow

    - by Tom
    Hey everyone, I am running a TG2 App on lighttpd via flup/fastcgi. We are reading images (~30kb each) from BlobFields in a MySQL database and return those images with a custom mime type via a controller method. Caching these images on the hard disk makes no sense because they change with every request, the only reason we cache these in the DB is that creating these images is quite expensive and the data used to create the images is also present in plain text on the website. Now to the problem itself: When returning such an image, things get extremely slow. The code runs totally fine on paster itself with no visible delay, but as soon as its running via fcgi/lighttpd the described phenomenon happens. I profiled the method of my controller that returns my blob, and the entire method runs in a few miliseconds, but when "return" executes, the entire app hangs for roughly 10 seconds. We could not reproduce the same error with PHP on FCGI. This only seems to happen with Turbogears or Pylons. Here for your consideration the concerned piece of source code: @expose(content_type=CUSTOM_CONTENT_TYPE) def return_img(self, img_id): """ Return a DB persisted image when requested """ img = model.Images.by_id(img_id) #get image from DB response.headers['content-type'] = 'image/png' return img.data # this causes the app to hang for 10 seconds

    Read the article

  • Django says the "id may not be NULL" but why is it?

    - by Oli
    I'm going crazy today. I just tried to insert a new record and it threw back a "post_blogpost.id may not be NULL" error. Here's my model: class BlogPost(models.Model): title = models.CharField(max_length=100) slug = models.SlugField(max_length=100) who = models.ForeignKey(User, default=1) when = models.DateTimeField() intro = models.TextField(blank=True, null=True) content = models.TextField(blank=True, null=True) counter = models.PositiveIntegerField(default=0) published = models.BooleanField(default=False) css = models.TextField(blank=True, null=True) class Meta: ordering = ('-when', 'id') There are a number of functions beneath the model too but I won't include them in full here. Their names are: content_cache_key, clear_cache, __unicode__, reads, read, processed_content. I'm adding through the admin... And I'm running out of hair.

    Read the article

  • asyncore callbacks launching threads... ok to do?

    - by sbartell
    I'm unfamiliar with asyncore, and have very limited knowledge of asynchronous programming except for a few intro to twisted tutorials. I am most familiar with threads and use them in all my apps. One particular app uses a couchdb database as its interface. This involves longpolling the db looking for changes and updates. The module I use for couchdb is couchdbkit. It uses an asyncore loop to watch for these changes and send them to a callback. So, I figure from this callback is where I launch my worker threads. It seems a bit crude to mix asynchronous and threaded programming. I really like couchdbkit, but would rather not introduce issues into my program. So, my question is, is it safe to fire threads from an async callback? Here's some code... {{{ def dispatch(change): global jobs, db_url # jobs is my queue db = Database(db_url) work_order = db.get(change['id']) # change is an id to the document that changed. # i need to get the actual document (workorder) worker = Worker(work_order, db) # fire the thread jobs.append[worker] worker.start() return main() . . . consumer.wait(cb=dispatch, since=update_seq, timeout=10000) #wait constains the asyncloop. }}}

    Read the article

  • Prepopulate drop-box according to another drop-box choice in Django Admin

    - by onorua
    I have models like this: class User(models.Model): Switch = models.ForeignKey(Switch, related_name='SwitchUsers') Port = models.ForeignKey(Port) class Switch(models.Model): Name = models.CharField(max_length=50) class Port(models.Model): PortNum = models.PositiveIntegerField() Switch = models.ForeignKey(Switch, related_name = "Ports") When I'm in Admin interface and choose Switch from Switches available, I would like to have Port prepopulated accordingly with Ports from the related Switch. As far as I understand I need to create some JS script to prepopulate it. Unfortunately I don't have this experience, and I would like to keep things simple as it possible and don't rewrite all Django admin interface. Just add this functionality for one Field. Could you please help me with my problem? Thank you.

    Read the article

  • Filter zipcodes by proximity in Django with the Spherical Law of Cosines

    - by spiffytech
    I'm trying to handle proximity search for a basic store locater in Django. Rather than haul PostGIS around with my app just so I can use GeoDjango's distance filter, I'd like to use the Spherical Law of Cosines distance formula in a model query. I'd like all of the calculations to be done in the database in one query, for efficiency. An example MySQL query from The Internet implementing the Spherical Law of Cosines like this: SELECT id, ( 3959 * acos( cos( radians(37) ) * cos( radians( lat ) ) * cos( radians( lng ) - radians(-122) ) + sin( radians(37) ) * sin( radians( lat ) ) ) ) AS distance FROM stores HAVING distance < 25 ORDER BY distance LIMIT 0 , 20; The query needs to reference the Zipcode ForeignKey for each store's lat/lng values. How can I make all of this work in a Django model query?

    Read the article

  • twisted reactor stops too early

    - by pygabriel
    I'm doing a batch script to connect to a tcp server and then exiting. My problem is that I can't stop the reactor, for example: cmd = raw_input("Command: ") # custom factory, the protocol just send a line reactor.connectTCP(HOST,PORT, CommandClientFactory(cmd) d = defer.Deferred() d.addCallback(lambda x: reactor.stop()) reactor.callWhenRunning(d.callback,None) reactor.run() In this code the reactor stops before that the tcp connection is done and the cmd is passed. How can I stop the reactor after that all the operation are finished?

    Read the article

  • Django: Applying Calculations To A Query Set

    - by TheLizardKing
    I have a QuerySet that I wish to pass to a generic view for pagination: links = Link.objects.annotate(votes=Count('vote')).order_by('-created')[:300] This is my "hot" page which lists my 300 latest submissions (10 pages of 30 links each). I want to now sort this QuerySet by an algorithm that HackerNews uses: (p - 1) / (t + 2)^1.5 p = votes minus submitter's initial vote t = age of submission in hours Now because applying this algorithm over the entire database would be pretty costly I am content with just the last 300 submissions. My site is unlikely to be the next digg/reddit so while scalability is a plus it is required. My question is now how do I iterate over my QuerySet and sort it by the above algorithm? For more information, here are my applicable models: class Link(models.Model): category = models.ForeignKey(Category, blank=False, default=1) user = models.ForeignKey(User) created = models.DateTimeField(auto_now_add=True) modified = models.DateTimeField(auto_now=True) url = models.URLField(max_length=1024, unique=True, verify_exists=True) name = models.CharField(max_length=512) def __unicode__(self): return u'%s (%s)' % (self.name, self.url) class Vote(models.Model): link = models.ForeignKey(Link) user = models.ForeignKey(User) created = models.DateTimeField(auto_now_add=True) def __unicode__(self): return u'%s vote for %s' % (self.user, self.link) Notes: I don't have "downvotes" so just the presence of a Vote row is an indicator of a vote or a particular link by a particular user.

    Read the article

  • How small is *too small* for an opensource project?

    - by Adam Lewis
    I have a fair number of smaller projects / libraries that I have been using over the past 2 years. I am thinking about moving them to Google Code to make it easier to share with co-workers and easier to import them into new projects on my own environments. The are things like a simple FSMs, CAN (Controller Area Network) drivers, and GPIB drivers. Most of them are small (less than 500 lines), so it makes me wonder are these types of things too small for a stand alone open-source project? Note that I would like to make it opensource because it does not give me, or my company, any real advantage.

    Read the article

  • How to make scipy.interpolate give a an extrapolated result beyond the input range?

    - by Salim Fadhley
    I'm trying to port a program which uses a hand-rolled interpolator (developed by a mathematitian colleage) over to use the interpolators provided by scipy. I'd like to use or wrap the scipy interpolator so that it has as close as possible behavior to the old interpolator. A key difference between the two functions is that in our original interpolator - if the input value is above or below the input range, our original interpolator will extrapolate the result. If you try this with the scipy interpolator it raises a ValueError. Consider this program as an example: import numpy as np from scipy import interpolate x = np.arange(0,10) y = np.exp(-x/3.0) f = interpolate.interp1d(x, y) print f(9) print f(11) # Causes ValueError, because it's greater than max(x) Is there a sensible way to make it so that instead of crashing, the final line will simply do a linear extrapolate, continuing the gradients defined by the first and last two pouints to infinity. Note, that in the real software I'm not actually using the exp function - that's here for illustration only!

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

< Previous Page | 365 366 367 368 369 370 371 372 373 374 375 376  | Next Page >