Search Results

Search found 14399 results on 576 pages for 'python noob'.

Page 369/576 | < Previous Page | 365 366 367 368 369 370 371 372 373 374 375 376  | Next Page >

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • etree.findall: 'OR'-lookup?

    - by piquadrat
    I want to find all stylesheet definitions in a XHTML file with lxml.etree.findall. This could be as simple as elems = tree.findall('link[@rel="stylesheet"]') + tree.findall('style') But the problem with CSS style definitions is that the order matters, e.g. <link rel="stylesheet" type="text/css" href="/media/css/first.css" /> <style>body:{font-size: 10px;}</style> <link rel="stylesheet" type="text/css" href="/media/css/second.css" /> if the contents of the style tag is applied after the rules in the two link tags, the result may be completely different from the one where the rules are applied in order of definition. So, how would I do a lookup that inlcudes both link[@rel="stylesheet"] and style?

    Read the article

  • Dynamically add items to Tkinter Canvas

    - by nick369
    I'm attempting to learn Tkinter with the goal of being able to create a 'real-time' scope to plot data. As a test, I'm trying to draw a polygon on the canvas every time the 'draw' button is pressed. The triangle position is randomized. I have two problems: There is a triangle on the canvas as soon as the program starts, why and how do I fix this? It doesn't draw any triangles when I press the button, at least none that I can see. CODE from Tkinter import * from random import randint class App: def __init__(self,master): #frame = Frame(master) #frame.pack(side = LEFT) self.plotspc = Canvas(master,height = 100, width = 200, bg = "white") self.plotspc.grid(row=0,column = 2, rowspan = 5) self.button = Button(master, text = "Quit", fg = "red", \ command = master.quit) self.button.grid(row=0,column=0) self.drawbutton = Button(master, text = "Draw", command = \ self.pt([50,50])) self.drawbutton.grid(row = 0, column = 1) def pt(self, coords): coords[0] = coords[0] + randint(-20,20) coords[1] = coords[1] + randint(-20,20) x = (0,5,10) y = (0,10,0) xp = [coords[0] + xv for xv in x] yp = [coords[1] + yv for yv in y] ptf = zip(xp,yp) self.plotspc.create_polygon(*ptf) if _name_ == "_main_": root = Tk() app = App(root) root.mainloop() The code is formatting strangely within the code tags, I have no idea how to fix this.

    Read the article

  • Most efficient way to update attribute of one instance

    - by Begbie00
    Hi all - I'm creating an arbitrary number of instances (using for loops and ranges). At some event in the future, I need to change an attribute for only one of the instances. What's the best way to do this? Right now, I'm doing the following: 1) Manage the instances in a list. 2) Iterate through the list to find a key value. 3) Once I find the right object within the list (i.e. key value = value I'm looking for), change whatever attribute I need to change. for Instance within ListofInstances: if Instance.KeyValue == SearchValue: Instance.AttributeToChange = 10 This feels really inefficient: I'm basically iterating over the entire list of instances, even through I only need to change an attribute in one of them. Should I be storing the Instance references in a structure more suitable for random access (e.g. dictionary with KeyValue as the dictionary key?) Is a dictionary any more efficient in this case? Should I be using something else? Thanks, Mike

    Read the article

  • Prepopulate drop-box according to another drop-box choice in Django Admin

    - by onorua
    I have models like this: class User(models.Model): Switch = models.ForeignKey(Switch, related_name='SwitchUsers') Port = models.ForeignKey(Port) class Switch(models.Model): Name = models.CharField(max_length=50) class Port(models.Model): PortNum = models.PositiveIntegerField() Switch = models.ForeignKey(Switch, related_name = "Ports") When I'm in Admin interface and choose Switch from Switches available, I would like to have Port prepopulated accordingly with Ports from the related Switch. As far as I understand I need to create some JS script to prepopulate it. Unfortunately I don't have this experience, and I would like to keep things simple as it possible and don't rewrite all Django admin interface. Just add this functionality for one Field. Could you please help me with my problem? Thank you.

    Read the article

  • How to make scipy.interpolate give a an extrapolated result beyond the input range?

    - by Salim Fadhley
    I'm trying to port a program which uses a hand-rolled interpolator (developed by a mathematitian colleage) over to use the interpolators provided by scipy. I'd like to use or wrap the scipy interpolator so that it has as close as possible behavior to the old interpolator. A key difference between the two functions is that in our original interpolator - if the input value is above or below the input range, our original interpolator will extrapolate the result. If you try this with the scipy interpolator it raises a ValueError. Consider this program as an example: import numpy as np from scipy import interpolate x = np.arange(0,10) y = np.exp(-x/3.0) f = interpolate.interp1d(x, y) print f(9) print f(11) # Causes ValueError, because it's greater than max(x) Is there a sensible way to make it so that instead of crashing, the final line will simply do a linear extrapolate, continuing the gradients defined by the first and last two pouints to infinity. Note, that in the real software I'm not actually using the exp function - that's here for illustration only!

    Read the article

  • Returning Database Blobs in TurboGears 2.x / FCGI / Lighttpd extremely slow

    - by Tom
    Hey everyone, I am running a TG2 App on lighttpd via flup/fastcgi. We are reading images (~30kb each) from BlobFields in a MySQL database and return those images with a custom mime type via a controller method. Caching these images on the hard disk makes no sense because they change with every request, the only reason we cache these in the DB is that creating these images is quite expensive and the data used to create the images is also present in plain text on the website. Now to the problem itself: When returning such an image, things get extremely slow. The code runs totally fine on paster itself with no visible delay, but as soon as its running via fcgi/lighttpd the described phenomenon happens. I profiled the method of my controller that returns my blob, and the entire method runs in a few miliseconds, but when "return" executes, the entire app hangs for roughly 10 seconds. We could not reproduce the same error with PHP on FCGI. This only seems to happen with Turbogears or Pylons. Here for your consideration the concerned piece of source code: @expose(content_type=CUSTOM_CONTENT_TYPE) def return_img(self, img_id): """ Return a DB persisted image when requested """ img = model.Images.by_id(img_id) #get image from DB response.headers['content-type'] = 'image/png' return img.data # this causes the app to hang for 10 seconds

    Read the article

  • Am I mocking this helper function right in my Django test?

    - by CppLearner
    lib.py from django.core.urlresolvers import reverse def render_reverse(f, kwargs): """ kwargs is a dictionary, usually of the form {'args': [cbid]} """ return reverse(f, **kwargs) tests.py from lib import render_reverse, print_ls class LibTest(unittest.TestCase): def test_render_reverse_is_correct(self): #with patch('webclient.apps.codebundles.lib.reverse') as mock_reverse: with patch('django.core.urlresolvers.reverse') as mock_reverse: from lib import render_reverse mock_f = MagicMock(name='f', return_value='dummy_views') mock_kwargs = MagicMock(name='kwargs',return_value={'args':['123']}) mock_reverse.return_value = '/natrium/cb/details/123' response = render_reverse(mock_f(), mock_kwargs()) self.assertTrue('/natrium/cb/details/' in response) But instead, I get File "/var/lib/graphyte-webclient/graphyte-webenv/lib/python2.6/site-packages/django/core/urlresolvers.py", line 296, in reverse "arguments '%s' not found." % (lookup_view_s, args, kwargs)) NoReverseMatch: Reverse for 'dummy_readfile' with arguments '('123',)' and keyword arguments '{}' not found. Why is it calling reverse instead of my mock_reverse (it is looking up my urls.py!!) The author of Mock library Michael Foord did a video cast here (around 9:17), and in the example he passed the mock object request to the view function index. Furthermore, he patched POll and assigned an expected return value. Isn't that what I am doing here? I patched reverse? Thanks.

    Read the article

  • Django says the "id may not be NULL" but why is it?

    - by Oli
    I'm going crazy today. I just tried to insert a new record and it threw back a "post_blogpost.id may not be NULL" error. Here's my model: class BlogPost(models.Model): title = models.CharField(max_length=100) slug = models.SlugField(max_length=100) who = models.ForeignKey(User, default=1) when = models.DateTimeField() intro = models.TextField(blank=True, null=True) content = models.TextField(blank=True, null=True) counter = models.PositiveIntegerField(default=0) published = models.BooleanField(default=False) css = models.TextField(blank=True, null=True) class Meta: ordering = ('-when', 'id') There are a number of functions beneath the model too but I won't include them in full here. Their names are: content_cache_key, clear_cache, __unicode__, reads, read, processed_content. I'm adding through the admin... And I'm running out of hair.

    Read the article

  • Filter zipcodes by proximity in Django with the Spherical Law of Cosines

    - by spiffytech
    I'm trying to handle proximity search for a basic store locater in Django. Rather than haul PostGIS around with my app just so I can use GeoDjango's distance filter, I'd like to use the Spherical Law of Cosines distance formula in a model query. I'd like all of the calculations to be done in the database in one query, for efficiency. An example MySQL query from The Internet implementing the Spherical Law of Cosines like this: SELECT id, ( 3959 * acos( cos( radians(37) ) * cos( radians( lat ) ) * cos( radians( lng ) - radians(-122) ) + sin( radians(37) ) * sin( radians( lat ) ) ) ) AS distance FROM stores HAVING distance < 25 ORDER BY distance LIMIT 0 , 20; The query needs to reference the Zipcode ForeignKey for each store's lat/lng values. How can I make all of this work in a Django model query?

    Read the article

  • Qt/PyQt dialog with toggable fullscreen mode - problem on Windows

    - by Guard
    I have a dialog created in PyQt. It's purpose and functionality don't matter. The init is: class MyDialog(QWidget, ui_module.Ui_Dialog): def __init__(self, parent=None): super(MyDialog, self).__init__(parent) self.setupUi(self) self.installEventFilter(self) self.setWindowFlags(Qt.Dialog | Qt.WindowTitleHint) self.showMaximized() Then I have event filtering method: def eventFilter(self, obj, event): if event.type() == QEvent.KeyPress: key = event.key() if key == Qt.Key_F11: if self.isFullScreen(): self.setWindowFlags(self._flags) if self._state == 'm': self.showMaximized() else: self.showNormal() self.setGeometry(self._geometry) else: self._state = 'm' if self.isMaximized() else 'n' self._flags = self.windowFlags() self._geometry = self.geometry() self.setWindowFlags(Qt.Tool | Qt.FramelessWindowHint) self.showFullScreen() return True elif key == Qt.Key_Escape: self.close() return QWidget.eventFilter(self, obj, event) As can be seen, Esc is used for dialog hiding, and F11 is used for toggling full-screen. In addition, if the user changed the dialog mode from the initial maximized to normal and possibly moved the dialog, it's state and position are restored after exiting the full-screen. Finally, the dialog is created on the MainWindow action triggered: d = MyDialog(self) d.show() It works fine on Linux (Ubuntu Lucid), but quite strange on Windows 7: if I go to the full-screen from the maximized mode, I can't exit full-screen (on F11 dialog disappears and appears in full-screen mode again. If I change the dialog's mode to Normal (by double-clicking its title), then go to full-screen and then return back, the dialog is shown in the normal mode, in the correct position, but without the title line. Most probably the reason for both cases is the same - the setWindowFlags doesn't work. But why? Is it also possible that it is the bug in the recent PyQt version? On Ubuntu I have 4.6.x from apt, and on Windows - the latest installer from the riverbank site.

    Read the article

  • twisted reactor stops too early

    - by pygabriel
    I'm doing a batch script to connect to a tcp server and then exiting. My problem is that I can't stop the reactor, for example: cmd = raw_input("Command: ") # custom factory, the protocol just send a line reactor.connectTCP(HOST,PORT, CommandClientFactory(cmd) d = defer.Deferred() d.addCallback(lambda x: reactor.stop()) reactor.callWhenRunning(d.callback,None) reactor.run() In this code the reactor stops before that the tcp connection is done and the cmd is passed. How can I stop the reactor after that all the operation are finished?

    Read the article

  • Rearranging a sequence

    - by sarah
    I'm have trouble rearranging sequences so the amount of letters in the given original sequence are the same in the random generated sequences. For example: If i have a string 'AAAC' I need that string rearranged randomly so the amount of A's and C's are the same.

    Read the article

  • asyncore callbacks launching threads... ok to do?

    - by sbartell
    I'm unfamiliar with asyncore, and have very limited knowledge of asynchronous programming except for a few intro to twisted tutorials. I am most familiar with threads and use them in all my apps. One particular app uses a couchdb database as its interface. This involves longpolling the db looking for changes and updates. The module I use for couchdb is couchdbkit. It uses an asyncore loop to watch for these changes and send them to a callback. So, I figure from this callback is where I launch my worker threads. It seems a bit crude to mix asynchronous and threaded programming. I really like couchdbkit, but would rather not introduce issues into my program. So, my question is, is it safe to fire threads from an async callback? Here's some code... {{{ def dispatch(change): global jobs, db_url # jobs is my queue db = Database(db_url) work_order = db.get(change['id']) # change is an id to the document that changed. # i need to get the actual document (workorder) worker = Worker(work_order, db) # fire the thread jobs.append[worker] worker.start() return main() . . . consumer.wait(cb=dispatch, since=update_seq, timeout=10000) #wait constains the asyncloop. }}}

    Read the article

  • unit test for proxy checking

    - by zubin71
    Proxy configuration of a machine can be easily fetched using def check_proxy(): import urllib2 http_proxy = urllib2.getproxies().get('http') I need to write a test for the above written function. In order to do that I need to:- Set the system-wide proxy to an invalid URL during the test(sounds like a bad idea). Supply an invalid URL to http_proxy. How can I achieve either of the above?

    Read the article

  • I get a 400 Bad Request error while using django-piston

    - by Cheezo
    Hello, I am trying to use Piston to provide REST support to Django. I have implemented my handlers as per the documentation provided . The problem is that i can "read" and "delete" my resource but i cannot "create" or "update". Each time i hit the relevant api i get a 400 Bad request Error. I have extended the Resource class for csrf by using this commonly available code snippet: class CsrfExemptResource(Resource): """A Custom Resource that is csrf exempt""" def init(self, handler, authentication=None): super(CsrfExemptResource, self).init(handler, authentication) self.csrf_exempt = getattr(self.handler, 'csrf_exempt', True) My class (code snippet) looks like this: user_resource = CsrfExemptResource(User) class User(BaseHandler): allowed_methods = ('GET', 'POST', 'PUT', 'DELETE') @require_extended def create(self, request): email = request.GET['email'] password = request.GET['password'] phoneNumber = request.GET['phoneNumber'] firstName = request.GET['firstName'] lastName = request.GET['lastName'] self.createNewUser(self, email,password,phoneNumber,firstName,lastName) return rc.CREATED Please let me know how can i get the create method to work using the POST operation?

    Read the article

< Previous Page | 365 366 367 368 369 370 371 372 373 374 375 376  | Next Page >