Search Results

Search found 14399 results on 576 pages for 'python noob'.

Page 368/576 | < Previous Page | 364 365 366 367 368 369 370 371 372 373 374 375  | Next Page >

• Pylons error handling

  - by TJ Huffington

  Hello, I am just getting started with Pylons and am confused as to how to account for exceptions. What is the proper way to error check user input (ensure a correct email address, check that it doesn't yet exist in the database, etc ...)? Should these checks go inside the model classes or somewhere else? Sample code would be great.

  Read the article

• Multiprocessing Bomb

  - by iKarampa

  I was working the following example from Doug Hellmann tutorial on multiprocessing: import multiprocessing def worker(): """worker function""" print 'Worker' return if __name__ == '__main__': jobs = [] for i in range(5): p = multiprocessing.Process(target=worker) jobs.append(p) p.start() When I tried to run it outside the if statement: import multiprocessing def worker(): """worker function""" print 'Worker' jobs = [] for i in range(5): p = multiprocessing.Process(target=worker) jobs.append(p) p.start() It started spawning processes non-stop, without any way of to terminating it. Why would that happen? Why it did not generate 5 processes and exit? Why do I need the if statement?

  Read the article

• SQLAlchemy - SQLite for testing and Postgresql for devlopment - How to port?

  - by StackUnderflow

  I want to use sqlite memory database for all my testing and Postgresql for my development/production server. But the SQL syntax is not same in both dbs. for ex: SQLite has autoincrement, and Postgresql has serial Is it easy to port the SQL script from sqlite to postgresql... what are your solutions? If you want me to use standard SQL, how should I go about generating primary key in both the databases?

  Read the article

• CherryPy and RESTful web api

  - by hyperboreean

  What's the best approach of creating a RESTful web api in CherryPy? I've been looking around for a few days now and nothing seems great. For Django it seems that are lots of tools to do this, but not for CherryPy or I am not aware of them

  Read the article

• Purpose of SQLAlchemy over MySQLdb

  - by user299196

  Why do people use SQLAlchemy instead of MySQLdb? What advantages does it offer?

  Read the article

• How to get bit rotation function to accept any bit size?

  - by calccrypto

  i have these 2 functions i got from some other code def ROR(x, n): mask = (2L**n) - 1 mask_bits = x & mask return (x >> n) | (mask_bits << (32 - n)) def ROL(x, n): return ROR(x, 32 - n) and i wanted to use them in a program, where 16 bit rotations are required. however, there are also other functions that require 32 bit rotations, so i wanted to leave the 32 in the equation, so i got: def ROR(x, n, bits = 32): mask = (2L**n) - 1 mask_bits = x & mask return (x >> n) | (mask_bits << (bits - n)) def ROL(x, n, bits = 32): return ROR(x, bits - n) however, the answers came out wrong when i tested this set out. yet, the values came out correctly when the code is def ROR(x, n): mask = (2L**n) - 1 mask_bits = x & mask return (x >> n) | (mask_bits << (16 - n)) def ROL(x, n,bits): return ROR(x, 16 - n) what is going on and how do i fix this?

  Read the article

• How to replace empty string with zero in comma-separated string?

  - by dsaccount1

  "8,5,,1,4,7,,,,7,,1,9,3,6,,,8,6,3,9,,2,5,4,,,,,3,2,,,7,4,1,1,,4,,6,9,,5,,,,5,,,1,,6,3,,,6,5,,,,7,4,,1,7,6,,,,8,,5,,,7,1,,3,9," I'm doing a programming challenge where i need to parse this sequence into my sudoku script. Need to get the above sequence into 8,5,0,1,4,7,0,0,0,7,0,1,9,3,6,0,0,8......... I tried re but without success, help is appreciated, thanks.

  Read the article

• can this code running forever ??

  - by zjm1126

  from threading import Timer def hello(): print "hello, world" t = Timer(30.0, hello) t.start() i run only once, how to make it to running forever ? thanks

  Read the article

• How to change db in django depending on request.get_host()?

  - by Alexandr

  I am creating multisites platform. Anybody can make simple site, with my platform. I plan to use django multidb support. One db for one site. And i need to change db settings depending on request.get_host(). I think that i's not good idea. Prompt other decisions? How it is realised on various designers of sites?

  Read the article

• Dynamically setting the queryset of a ModelMultipleChoiceField to a custom recordset

  - by Daniel Quinn

  I've seen all the howtos about how you can set a ModelMultipleChoiceField to use a custom queryset and I've tried them and they work. However, they all use the same paradigm: the queryset is just a filtered list of the same objects. In my case, I'm trying to get the admin to draw a multiselect form that instead of using usernames as the text portion of the , I'd like to use the name field from my account class. Here's a breakdown of what I've got: # models.py class Account(models.Model): name = models.CharField(max_length=128,help_text="A display name that people understand") user = models.ForeignKey(User, unique=True) # Tied to the User class in settings.py class Organisation(models.Model): administrators = models.ManyToManyField(User) # admin.py from django.forms import ModelMultipleChoiceField from django.contrib.auth.models import User class OrganisationAdminForm(forms.ModelForm): def __init__(self, *args, **kwargs): from ethico.accounts.models import Account self.base_fields["administrators"] = ModelMultipleChoiceField( queryset=User.objects.all(), required=False ) super(OrganisationAdminForm, self).__init__(*args, **kwargs) class Meta: model = Organisation This works, however, I want queryset above to draw a selectbox with the Account.name property and the User.id property. This didn't work: queryset=Account.objects.all().order_by("name").values_list("user","name") It failed with this error: 'tuple' object has no attribute 'pk' I figured that this would be easy, but it's turned into hours of dead-ends. Anyone care to shed some light?

  Read the article

• Django: Determining if a user has voted or not

  - by TheLizardKing

  I have a long list of links that I spit out using the below code, total votes, submitted by, the usual stuff but I am not 100% on how to determine if the currently logged in user has voted on a link or not. I know how to do this from within my view but do I need to alter my below view code or can I make use of the way templates work to determine it? I have read http://stackoverflow.com/questions/1528583/django-vote-up-down-method but I don't quite understand what's going on ( and don't need any ofjavascriptery). Models (snippet): class Link(models.Model): category = models.ForeignKey(Category, blank=False, default=1) user = models.ForeignKey(User) created = models.DateTimeField(auto_now_add=True) modified = models.DateTimeField(auto_now=True) url = models.URLField(max_length=1024, unique=True, verify_exists=True) name = models.CharField(max_length=512) def __unicode__(self): return u'%s (%s)' % (self.name, self.url) class Vote(models.Model): link = models.ForeignKey(Link) user = models.ForeignKey(User) created = models.DateTimeField(auto_now_add=True) def __unicode__(self): return u'%s vote for %s' % (self.user, self.link) Views (snippet): links = Link.objects.select_related().annotate(votes=Count('vote')).order_by('-created')

  Read the article

• Simple pygtk and threads example please.

  - by wtzolt

  Hello, Can someone give me a simple example involving threads in this manner, please. Problem with my code is that when I click button One, GUI freezes until its finished. I want buttons to stay responsive when def is being executed. How can i fix that? class fun: wTree = None def __init__( self ): self.wTree = gtk.glade.XML( "ui.glade" ) dic = { "on_buttonOne" : self.one, "on_buttonTwo" : self.two, } self.wTree.signal_autoconnect( dic ) gtk.main() def sone(self, widget): time.sleep(1) print "1" time.sleep(1) print "2" time.sleep(1) print "3" def stwo(self, widget): time.sleep(1) print "4" time.sleep(1) print "5" time.sleep(1) print "6" do=fun() Pretty please, help me.

  Read the article

• Trouble with encoding and urllib

  - by Ockonal

  Hello, I'm loading web-page using urllib. Ther eis russian symbols, but page encoding is 'utf-8' 1 pageData = unicode(requestHandler.read()).decode('utf-8') UnicodeDecodeError: 'ascii' codec can't decode byte 0xd0 in position 262: ordinal not in range(128) 2 pageData = requestHandler.read() soupHandler = BeautifulSoup(pageData) print soupHandler.findAll(...) UnicodeEncodeError: 'ascii' codec can't encode characters in position 340-345: ordinal not in range(128)

  Read the article

• Matching strings

  - by Joy

  Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

  Read the article

• split twice in the same expression?

  - by UcanDoIt

  Imagine I have the following: inFile = "/adda/adas/sdas/hello.txt" # that instruction give me hello.txt Name = inFile.name.split("/") [-1] # that one give me the name I want - just hello Name1 = Name.split(".") [0] Is there any chance to simplify that doing the same job in just one expression?

  Read the article

• SQLAlchemy returns tuple not dictionary

  - by Ivan

  Hi everyone, I've updated SQLAlchemy to 0.6 but it broke everything. I've noticed it returns tuple not a dictionary anymore. Here's a sample query: query = session.query(User.id, User.username, User.email).filter(and_(User.id == id, User.username == username)).limit(1) result = session.execute(query).fetchone() This piece of code used to return a dictionary in 0.5. My question is how can I return a dictionary?

  Read the article

• How can I lookup an attribute in any scope by name?

  - by Wai Yip Tung

  How can I lookup an attribute in any scope by name? My first trial is to use globals() and locals(). e.g. >>> def foo(name): ... a=1 ... print globals().get(name), locals().get(name) ... >>> foo('a') None 1 >>> b=1 >>> foo('b') 1 None >>> foo('foo') <function foo at 0x014744B0> None So far so good. However it fails to lookup any built-in names. >>> range <built-in function range> >>> foo('range') None None >>> int <type 'int'> >>> foo('int') None None Any idea on how to lookup built-in attributes?

  Read the article

• redefine __and__ operator

  - by wiso

  Why I can't redefine the __and__ operator? class Cut(object): def __init__(self, cut): self.cut = cut def __and__(self, other): return Cut("(" + self.cut + ") && (" + other.cut + ")") a = Cut("a>0") b = cut("b>0") c = a and b print c.cut() I want (a>0) && (b>0), but I got b, that the usual behaviour of and

  Read the article

• How to classify NN/NNP/NNS obtained from POS tagged document as a product feature

  - by Shweta .......

  I'm planning to perform sentiment analysis on reviews of product features (collected from Amazon dataset). I have extracted review text from the dataset and performed POS tagging on that. I'm able to extract NN/NNP as well. But my doubt is how do I come to know that extracted words classify as features of the products? I know there are classifiers in nltk but I don't know how I should use it for my project. I'm assuming there are 2 ways of finding whether the extracted word is a product feature or not. One is to compare with a bag of words and find out if my word exists in that. Doubt: How do I create/get bag of words? Second way is to implement some kind of apriori algorithm to find out frequently occurring words as features. I would like to know which method is good and how to go about implementing it. Some pointers to available softwares or code snippets would be helpful! Thanks!

  Read the article

• How to set the size of a wx.aui.AuiManager Pane that is centered?

  - by aF

  Hello, I have three panes with the InfoPane center option. I want to know how to set their size. Using this code: import wx import wx.aui class MyFrame(wx.Frame): def __init__(self, parent, id=-1, title='wx.aui Test', pos=wx.DefaultPosition, size=(800, 600), style=wx.DEFAULT_FRAME_STYLE): wx.Frame.__init__(self, parent, id, title, pos, size, style) self._mgr = wx.aui.AuiManager(self) # create several text controls text1 = wx.TextCtrl(self, -1, 'Pane 1 - sample text', wx.DefaultPosition, wx.Size(200,150), wx.NO_BORDER | wx.TE_MULTILINE) text2 = wx.TextCtrl(self, -1, 'Pane 2 - sample text', wx.DefaultPosition, wx.Size(200,150), wx.NO_BORDER | wx.TE_MULTILINE) text3 = wx.TextCtrl(self, -1, 'Main content window', wx.DefaultPosition, wx.Size(200,150), wx.NO_BORDER | wx.TE_MULTILINE) # add the panes to the manager self._mgr.AddPane(text1, wx.CENTER) self._mgr.AddPane(text2, wx.CENTER) self._mgr.AddPane(text3, wx.CENTER) # tell the manager to 'commit' all the changes just made self._mgr.Update() self.Bind(wx.EVT_CLOSE, self.OnClose) def OnClose(self, event): # deinitialize the frame manager self._mgr.UnInit() # delete the frame self.Destroy() app = wx.App() frame = MyFrame(None) frame.Show() app.MainLoop() I want to know what is called when we change the size of the panes. If you tell me that, I can do the rest by myself :)

  Read the article

• Obtaining references to function objects on the execution stack from the frame object?

  - by Marcin

  Given the output of inspect.stack(), is it possible to get the function objects from anywhere from the stack frame and call these? If so, how? (I already know how to get the names of the functions.) Here is what I'm getting at: Let's say I'm a function and I'm trying to determine if my caller is a generator or a regular function? I need to call inspect.isgeneratorfunction() on the function object. And how do you figure out who called you? inspect.stack(), right? So if I can somehow put those together, I'll have the answer to my question. Perhaps there is an easier way to do this?

  Read the article

• Finding matching submatrics inside a matrix

  - by DaveO

  I have a 100x200 2D array expressed as a numpy array consisting of black (0) and white (255) cells. It is a bitmap file. I then have 2D shapes (it's easiest to think of them as letters) that are also 2D black and white cells. I know I can naively iterate through the matrix but this is going to be a 'hot' portion of my code so speed is an concern. Is there a fast way to perform this in numpy/scipy? I looked briefly at Scipy's correlate function. I am not interested in 'fuzzy matches', only exact matches. I also looked at some academic papers but they are above my head.

  Read the article

• Removing a node from a linked list

  - by lost_with_coding

  I would like to create a delete_node function that deletes the node at the location in the list as a count from the first node. So far this is the code I have: class node: def __init__(self): self.data = None # contains the data self.next = None # contains the reference to the next node class linked_list: def __init__(self): self.cur_node = None def add_node(self, data): new_node = node() # create a new node new_node.data = data new_node.next = self.cur_node # link the new node to the 'previous' node. self.cur_node = new_node # set the current node to the new one. def list_print(self): node = ll.cur_node while node: print node.data node = node.next def delete_node(self,location): node = ll.cur_node count = 0 while count != location: node = node.next count+=1 delete node ll = linked_list() ll.add_node(1) ll.add_node(2) ll.add_node(3) ll.list_print()

  Read the article

• How to allow resizing of QMessageBox in PyQt4

  - by Simeon Fitch

  I'm using the nice feature in QMessageBox to optionally show detailed text to the user. However, the window after expansion is still fairly small, and one immediately tries to resize the window so more of the details are visible. Even after setting what I think are the proper settings it won't allow resizing. Here's the relevant snippet of PyQt4 code: mb = QMessageBox() mb.setText("Results written to '%s'" % filename) mb.setDetailedText(str(myData)) mb.setSizePolicy(QSizePolicy.Expanding, QSizePolicy.Expanding) mb.setSizeGripEnabled(True) Am I missing a step and/or is this at all possible?

  Read the article

• How can I draw a log-normalized imshow plot with a colorbar representing the raw data in matplotlib

  - by Adam Fraser

  I'm using matplotlib to plot log-normalized images but I would like the original raw image data to be represented in the colorbar rather than the [0-1] interval. I get the feeling there's a more matplotlib'y way of doing this by using some sort of normalization object and not transforming the data beforehand... in any case, there could be negative values in the raw image. import matplotlib.pyplot as plt import numpy as np def log_transform(im): '''returns log(image) scaled to the interval [0,1]''' try: (min, max) = (im[im > 0].min(), im.max()) if (max > min) and (max > 0): return (np.log(im.clip(min, max)) - np.log(min)) / (np.log(max) - np.log(min)) except: pass return im a = np.ones((100,100)) for i in range(100): a[i] = i f = plt.figure() ax = f.add_subplot(111) res = ax.imshow(log_transform(a)) # the colorbar drawn shows [0-1], but I want to see [0-99] cb = f.colorbar(res) I've tried using cb.set_array, but that didn't appear to do anything, and cb.set_clim, but that rescales the colors completely. Thanks in advance for any help :)

  Read the article

< Previous Page | 364 365 366 367 368 369 370 371 372 373 374 375  | Next Page >