Search Results

Search found 7034 results on 282 pages for 'inverse match'.

Page 37/282 | < Previous Page | 33 34 35 36 37 38 39 40 41 42 43 44  | Next Page >

  • How to Get the F# Name of a Module, Function, etc. From Quoted Expression Match

    - by Stephen Swensen
    I continue to work on a printer for F# quoted expressions, it doesn't have to be perfect, but I'd like to see what is possible. The active patterns in Microsoft.FSharp.Quotations.Patterns and Microsoft.FSharp.Quotations.DerivedPatterns used for decomposing quoted expressions will typically provide MemberInfo instances when appropriate, these can be used to obtain the name of a property, function, etc. and their "declaring" type, such as a module or static class. The problem is, I only know how to obtain the CompiledName from these instances but I'd like the F# name. For example, > <@ List.mapi (fun i j -> i+j) [1;2;3] @> |> (function Call(_,mi,_) -> mi.DeclaringType.Name, mi.Name);; val it : string * string = ("ListModule", "MapIndexed") How can this match be rewritten to return ("List", "mapi")? Is it possible?

    Read the article

  • How to generate random strings that match a given regexp?

    - by Pies
    Duplicate: Random string that matches a regexp No, it isn't. I'm looking for an easy and universal method, one that I could actually implement. That's far more difficult than randomly generating passwords. I want to create an application that takes a regular expression, and shows 10 randomly generated strings that match that expression. It's supposed to help people better understand their regexps, and to decide i.e. if they're secure enough for validation purposes. Does anyone know of an easy way to do that? One obvious solution would be to write (or steal) a regexp parser, but that seems really over my head. I repeat, I'm looking for an easy and universal way to do that. Edit: Brute force approach is out of the question. Assuming the random strings would just be [a-z0-9]{10} and 1 million iterations per second, it would take 65 years to iterate trough the space of all 10-char strings.

    Read the article

  • HELP!! Implementing a search to match the specified author and displaying a book by the specified publisher

    - by Brian
    Hey guys! So i'm having problems with my assignment. I successfully got it to run multiple last names by the author, but now, I need to find all books by author, which means searching the collection for all books that match the specified author and I also need to find all books by publisher, which displays a list of books by the specified publisher. How would I implement this? Would I use string or vector? Any help will be much appreciated!

    Read the article

  • What's the fastest way to search a very long list of words for a match in actionscript 3?

    - by Nuthman
    So I have a list of words (the entire English dictionary). For a word matching game, when a player moves a piece I need to check the entire dictionary to see if the the word that the player made exists in the dictionary. I need to do this as quickly as possible. simply iterating through the dictionary is way too slow. What is the quickest algorithm in AS3 to search a long list like this for a match, and what datatype should I use? (ie array, object, Dictionary etc)

    Read the article

  • How to select parent object of a hyperlink whose href match the requested page/file name using jQuer

    - by ARS
    How to select parent object of a hyperlink whose href match the requested page/file name using jQuery? I have following code <div> <div class="menu-head"> <a href="empdet.aspx">employees</a> <a href="custdet.aspx">customers</a> </div> <div class="menu-head"> <a href="depdet.aspx">departments</a> </div> <div> I want a Jquery to change the color of the parent div corresponding a hyperlink. If the user is browsing custdet.aspx the respective parent div background should be changed to red. Edit: I have a method to retrieve the file name. I just need the right selector to select the parent.

    Read the article

  • How to specify "PG-USERNAME" in pg_ident.conf so that it'll match any database user ?

    - by felace
    I need to restrict a specific unix user so that it can login with only a few select postgres usernames (with password prompt), but allowing every other user to use whatever pg username they want. Assuming restrUnixUser is the unix user name and restrUser is one of the postgres users it may use, and AllowedDB is the only database they should connect to : pg_hba.conf : local AllowedDB restrUser password local all restrUser reject local all all ident map=exceptrestrUser And pg_ident.conf : exceptrestrUser /^(?!restrUnixUser).*$ user1 exceptrestrUser /^(?!restrUnixUser).*$ user2 exceptrestrUser /^(?!restrUnixUser).*$ postgres does what I exactly want to do right now, however, I'll probably add a lot more users so I wonder if there is something like mapname unixuserpattern allpgusers that'll match with whatever username used to login by any unix user matching the pattern.

    Read the article

  • Can we match Any to a generic type? [Scala 2.8]

    - by Jus12
    Please point me to correct link if this has been answered before. I have this code: def getResult(a:Any):Any = a def getAnswer[T](i:Int) = { val result = getResult(i) result match { case t:T => Some(t) case _ => None } } This gives me a unchecked warning and everything matches to T. For instance, when I do getAnswer[Int](2), I get Some(2) (as expected). However, if I do getAnswer[String](2), I also get Some(2) which is not expected (I need None). Is there any way to work around type erasure and somehow get getAnswer to work correctly (i.e., return Some(result) if and only if the result is of type T)? Thanks in advance.

    Read the article

  • Regular expression help

    - by DJPB
    I there I'm working on a C# app, and I get a string with a date or part of a date and i need to take day, month and year for that string ex: string example='31-12-2010' string day = Regex.Match(example, "REGULAR EXPRESSION FOR DAY").ToString(); string month = Regex.Match(example, "REGULAR EXPRESSION FOR MONTH").ToString() string year = Regex.Match(example, "REGULAR EXPRESSION FOR YEAR").ToString() day = "31" month = "12" year = "2010" ex2: string example='12-2010' string month = Regex.Match(example, "REGULAR EXPRESSION FOR MONTH").ToString() string year = Regex.Match(example, "REGULAR EXPRESSION FOR YEAR").ToString() month = "12" year = "2010" any idea? tks

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • RemoveAll Dictionary Extension Method

    - by João Angelo
    Removing from a dictionary all the elements where the keys satisfy a set of conditions is something I needed to do more than once so I implemented it as an extension method to the IDictionary<TKey, TValue> interface. Here’s the code: public static class DictionaryExtensions { /// <summary> /// Removes all the elements where the key match the conditions defined by the specified predicate. /// </summary> /// <typeparam name="TKey"> /// The type of the dictionary key. /// </typeparam> /// <typeparam name="TValue"> /// The type of the dictionary value. /// </typeparam> /// <param name="dictionary"> /// A dictionary from which to remove the matched keys. /// </param> /// <param name="match"> /// The <see cref="Predicate{T}"/> delegate that defines the conditions of the keys to remove. /// </param> /// <exception cref="ArgumentNullException"> /// dictionary is null /// <br />-or-<br /> /// match is null. /// </exception> /// <returns> /// The number of elements removed from the <see cref="IDictionary{TKey, TValue}"/>. /// </returns> public static int RemoveAll<TKey, TValue>( this IDictionary<TKey, TValue> dictionary, Predicate<TKey> match) { if (dictionary == null) throw new ArgumentNullException("dictionary"); if (match == null) throw new ArgumentNullException("match"); var keysToRemove = dictionary.Keys.Where(k => match(k)).ToList(); if (keysToRemove.Count == 0) return 0; foreach (var key in keysToRemove) { dictionary.Remove(key); } return keysToRemove.Count; } }

    Read the article

  • Why the system information message when accessing an Ubuntu server doesn't match free -m?

    - by Andres
    Each time I SSH into my AWS Ubuntu servers I see a system information message, showing load, memory usage and packages available to install, like this: Welcome to Ubuntu 12.04.3 LTS (GNU/Linux 3.2.0-51-virtual x86_64) * Documentation: https://help.ubuntu.com/ System information as of Sun Nov 10 18:06:43 EST 2013 System load: 0.08 Processes: 127 Usage of /: 4.9% of 98.43GB Users logged in: 1 Memory usage: 69% IP address for eth0: 10.236.136.233 Swap usage: 100% Graph this data and manage this system at https://landscape.canonical.com/ 13 packages can be updated. 0 updates are security updates. Get cloud support with Ubuntu Advantage Cloud Guest http://www.ubuntu.com/business/services/cloud Use Juju to deploy your cloud instances and workloads. https://juju.ubuntu.com/#cloud-precise *** /dev/xvda1 will be checked for errors at next reboot *** *** System restart required *** My question is about the memory percentage shown. In this case, it's showing a 69% of memory usage, but since the swap usage was 100% I checked it by myself. So when I run free -m I get this: total used free shared buffers cached Mem: 1652 1635 17 0 4 29 -/+ buffers/cache: 1601 51 Swap: 895 895 0 And that's of course closer to 100% than to 69%

    Read the article

  • Can I change the user id of a user on one Linux server to match another server in /etc/passwd?

    - by user76177
    I have a Rails application that is on a virtual machine (RHEL 6) and it's database is on dedicated hardware (also RHEL 6). The app server has an NFS directory from the db server mounted and accessible. It needs to write images to that server that are uploaded via the app. Background processes on the db server need to read and write to the same directory, as they perform resizing operations on the uploaded files. Right now none of this is working, because the user ids are different between the two systems. I only need this to work for this one application, so it is way too much overhead to put an LDAP system in place. Can I simply change the user id of this one user in one of the systems, or will that cause mass chaos? UPDATE: The fix worked, at least on local devices. Unfortunately the device I have mounted to the main db server still thinks my user id is 502 instead of 506. Do I need to remount that device, or is there an NFS daemon I can stop and restart to refresh it?

    Read the article

  • how do I match movement of an object from 2d video into a 3d package ?

    - by George Profenza
    I'm trying to add objects in a 3d package(Blender) using recorded footage. I've played with Icarus and it's great to capture the camera movement. Also the Blender 2.41 importer script works in Blender 2.49 as well. The problem is I can't seem to get 3d coordinates for objects. I have tried Autodesk(RealVIZ) MatchMover 2011 and gone through the tutorials. Tutorial 3 shows how to link a vertex from a 3d mesh to a 2d trackpoint, but the setup is for camera movement. Tutorial 4 goes into Motion capture, but it uses 2 videos of the same motion taken with 2 cameras from different viewpoints. I've tried to bypass that using the same footage twice, but that failed, as the 3d coordinate system ends up messed up. What software do you recommend for this (mapping 3d coordinates to 2d tracked points and importing them into a 3d package) ? What is the recommended technique ? Any good examples out there ? Thanks, George

    Read the article

  • How do I get grep color in the file names before each match?

    - by chimerical
    If I run grep -ir "somethingtomatch" . from the current directory, I typically get results like this: ./some/path/file1.html: filecontent filecontent keyword filecontent ./some/path/file2.html: filecontent filecontent filecontent keyword ./some/path/file3.html: filecontent keyword filecontent filecontent ./some/path/file4.html: keyword filecontent filecontent filecontent I used grep --color=auto -ir 'somethingtomatch" . but it only highlights the keywords in white on a red highlight. I'm trying to get file names on the left color-coded too. How do I do that? I'm using Terminal.app in OS X with bash and xterm (and I tried xterm-color too).

    Read the article

  • How to match a string in URI with regular expression?

    - by forestclown
    In my Apache config httpd.conf, I wish to setup a rule like below SetEnvIfNoCase %{QUERY_STRING} ^.*(getBook+)$ no-gzip dont-vary I am hoping to do no-gzip when my URL looks like http://myurl.fake.com/book/getBook3?id=234 http://myurl.fake.com/book/getBook1?id=xxx I am not sure if I can do that by setting up something like the above in httpd.conf.. The reason I do query string is because the url myurl.fake.com/book/getBook3 was mod_rewrite from myurl.fake.com/index.php?controller=book&action=getBook3 Thanks!

    Read the article

  • How can I compare two columns in Excel to highlight words that don't match?

    - by Jez Vander Brown
    (I'm using Microsoft excel 2010) OK, lets say I have a list of phrases in both column A and column B (see screen shot below) What I would like to happen whether it be with a macro, VBA or formula is: If there is a word in any cell in column A that isn't any of the words in any cell in column B to highlight that word in red. For example: in cell A9 the word "buy" is there, but the word buy isn't mentioned anywhere in column B so i would like the word buy to highlight in red. How can I accomplish this? (I think a macro/vba would be the best option but I have no idea how to create it, or even if its possible.)

    Read the article

  • How match 'other' applications to a tag in awesome-wm?

    - by Mnementh
    I use version 3.3.4 of awesome and it is fine. But I miss one thing I could do with an older version of awesome (without configuration via Lua): I could add a matcher with the regexp .* to add all windows without another tag to a specific tag: rule { name = ".*" tags = "9" } With that all applications I didn't made another rule for were added to tag 9. How can I do something similar with configuration in rc.lua?

    Read the article

  • Apache mod_proxy_html Substitute: how to re-use part of regex match? (regex variables?)

    - by goober
    Hi all, Have a unique URL-rewriting situation in Apache. I need to be able to take a URL that starts with "\u002f[X]" or '\u002f[X]" Where X is the rest of some URL, and substitute the text "\u002fmeis2\u002f[X] I'm not sure how the Regex works in Apache -- I think it's the same as Perl 5? -- but even then I'm a little unsure how this would be done. My hunch is that it has to do with Regex grouping and then using $1 to pull the variable out, but I'm entirely unfamiliar with this process in Apache. Hoping someone can help -- thanks!

    Read the article

  • Using sed, how to print all lines that match a certain date?

    - by Steve
    Using sed, how to print all lines where the birthdays are in November or December? Assuming input file name "datebook" as follows: Steve Blenheim:238-923-7366:95 Latham Lane, Easton, PA 83755:11/12/56:20300 Betty Boop:245-836-8357:635 Cutesy Lane, Hollywood, CA 91464:6/23/23:14500 Igor Chevsky:385-375-8395:3567 Populus Place, Caldwell, NJ 23875:6/18/68:23400 Karen Evich:284-758-2857:23 Edgecliff Place, Lincoln, NB 92743:7/25/53:85100 Fred Fardbarkle:674-843-1385:20 Parak Lane, Duluth, MN 23850:4/12/23:780900 Lori Gortz:327-832-5728:3465 Mirlo Street, Peabody, MA 34756:10/2/65:35200 Paco Gutierrez:835-365-1284:454 Easy Street, Decatur, IL 75732:2/28/53:123500 Ephram Hardy:293-259-5395:235 CarltonLane, Joliet, IL 73858:8/12/20:56700 ABE LINCOLN:813-555-0123:1549 Cabin Drive, Springfield, IL 61801:2/12/09:79000 James Ikeda:834-938-8376:23445 Aster Ave., Allentown, NJ 83745:12/1/38:45000

    Read the article

  • EXCEL 2010 Check if sub string value in cell match with other string from range of cells

    - by gotqn
    I am stuck with this one from hours. I have range with cells with string values: A1 text1 A2 text2 An text3 And other column with other string values like: B1 text1sampletext B2 text2sampletext B3 text3sampletext B4 text1sampletext B5 text1sampletext I have to check if text in column A is sub string of text in column B. If it is, to set in column C the text from column A. Like this: B1 text1sampletext - C1 text1 B2 text2sampletext - C1 text2 B3 text3sampletext - C1 text3 B4 text1sampletext - C1 text1 B5 text1sampletext - C1 text1

    Read the article

  • Windows XP: Make Google Chrome's minimize, restore and close buttons match other programs?

    - by TRiG
    I like the way Google Chrome puts the tabs above the address bar, but I don't like the way the minimize, restore, close buttons are a different shape to every other program's. It means that if I sit the mouse in the top corner and minimize everything, I find that I've restored Chrome, not minimized it. Is there any way to get these buttons to a normal shape and size? That's Firefox in front, looking normal, like every other program, and Chrome above and behind, with the buttons at an off-standard position and size.

    Read the article

  • How do I get ftype & assoc to match Windows Explorer?

    - by Gauthier
    I changed the association to use upon launching a .py file, via Windows Explorer: Tools - Folders - File types. Then browse to .py. Change the association to Wordpad. Now when I type the name of a py file in the command line, Wordpad opens it. But assoc and ftype in the command line still return the following: C:\> assoc .py .py = Python.File C:\> ftype Python.File Python.File = "C:\Program\Python27\python.exe" "%1" %* How come the association is working, but assoc and ftype are not aware of it? I did restart the prompt. More info from my registry: HKEY_CLASSES_ROOT\.py = Python.File HKEY_CURRENT_USER\Software\Microsoft\Windows\CurrentVersion\Explorer\FileExts\.py\Application = wordpad.exe HKEY_CURRENT_USER\Software\Microsoft\Windows\CurrentVersion\Explorer\FileExts\.py\OpenWithProgids\Python.File = HKEY_LOCAL_MACHINE\SOFTWARE\Classes\.py\(Standard) = Python.File More registry: HKEY_CLASSES_ROOT\Applications\python.exe\shell\open\command\(Standard) = "C:\Program\Python27\python.exe" "%1" %*` I suppose this is what is showing up in ftype Python.File. But it does not seem to get used. (I am doing this for testing, so I can eventually choose my default version of Python easily).

    Read the article

  • Windows XP: Make Google Chrome's minimize, restore and close buttons match other programs?

    - by TRiG
    I like the way Google Chrome puts the tabs above the address bar, but I don't like the way the minimize, restore, close buttons are a different shape to every other program's. It means that if I sit the mouse in the top corner and minimize everything, I find that I've restored Chrome, not minimized it. Is there any way to get these buttons to a normal shape and size? That's Firefox in front, looking normal, like every other program, and Chrome above and behind, with the buttons at an off-standard position and size.

    Read the article

< Previous Page | 33 34 35 36 37 38 39 40 41 42 43 44  | Next Page >