Search Results

Search found 13683 results on 548 pages for 'python sphinx'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 370/548 | < Previous Page | 366 367 368 369 370 371 372 373 374 375 376 377  | Next Page >

  • split twice in the same expression?

    - by UcanDoIt
    Imagine I have the following: inFile = "/adda/adas/sdas/hello.txt" # that instruction give me hello.txt Name = inFile.name.split("/") [-1] # that one give me the name I want - just hello Name1 = Name.split(".") [0] Is there any chance to simplify that doing the same job in just one expression?

    Read the article

  • Simple pygtk and threads example please.

    - by wtzolt
    Hello, Can someone give me a simple example involving threads in this manner, please. Problem with my code is that when I click button One, GUI freezes until its finished. I want buttons to stay responsive when def is being executed. How can i fix that? class fun: wTree = None def __init__( self ): self.wTree = gtk.glade.XML( "ui.glade" ) dic = { "on_buttonOne" : self.one, "on_buttonTwo" : self.two, } self.wTree.signal_autoconnect( dic ) gtk.main() def sone(self, widget): time.sleep(1) print "1" time.sleep(1) print "2" time.sleep(1) print "3" def stwo(self, widget): time.sleep(1) print "4" time.sleep(1) print "5" time.sleep(1) print "6" do=fun() Pretty please, help me.

    Read the article

  • How to replace empty string with zero in comma-separated string?

    - by dsaccount1
    "8,5,,1,4,7,,,,7,,1,9,3,6,,,8,6,3,9,,2,5,4,,,,,3,2,,,7,4,1,1,,4,,6,9,,5,,,,5,,,1,,6,3,,,6,5,,,,7,4,,1,7,6,,,,8,,5,,,7,1,,3,9," I'm doing a programming challenge where i need to parse this sequence into my sudoku script. Need to get the above sequence into 8,5,0,1,4,7,0,0,0,7,0,1,9,3,6,0,0,8......... I tried re but without success, help is appreciated, thanks.

    Read the article

  • CherryPy and RESTful web api

    - by hyperboreean
    What's the best approach of creating a RESTful web api in CherryPy? I've been looking around for a few days now and nothing seems great. For Django it seems that are lots of tools to do this, but not for CherryPy or I am not aware of them

    Read the article

  • How to make scipy.interpolate give a an extrapolated result beyond the input range?

    - by Salim Fadhley
    I'm trying to port a program which uses a hand-rolled interpolator (developed by a mathematitian colleage) over to use the interpolators provided by scipy. I'd like to use or wrap the scipy interpolator so that it has as close as possible behavior to the old interpolator. A key difference between the two functions is that in our original interpolator - if the input value is above or below the input range, our original interpolator will extrapolate the result. If you try this with the scipy interpolator it raises a ValueError. Consider this program as an example: import numpy as np from scipy import interpolate x = np.arange(0,10) y = np.exp(-x/3.0) f = interpolate.interp1d(x, y) print f(9) print f(11) # Causes ValueError, because it's greater than max(x) Is there a sensible way to make it so that instead of crashing, the final line will simply do a linear extrapolate, continuing the gradients defined by the first and last two pouints to infinity. Note, that in the real software I'm not actually using the exp function - that's here for illustration only!

    Read the article

  • How to set the size of a wx.aui.AuiManager Pane that is centered?

    - by aF
    Hello, I have three panes with the InfoPane center option. I want to know how to set their size. Using this code: import wx import wx.aui class MyFrame(wx.Frame): def __init__(self, parent, id=-1, title='wx.aui Test', pos=wx.DefaultPosition, size=(800, 600), style=wx.DEFAULT_FRAME_STYLE): wx.Frame.__init__(self, parent, id, title, pos, size, style) self._mgr = wx.aui.AuiManager(self) # create several text controls text1 = wx.TextCtrl(self, -1, 'Pane 1 - sample text', wx.DefaultPosition, wx.Size(200,150), wx.NO_BORDER | wx.TE_MULTILINE) text2 = wx.TextCtrl(self, -1, 'Pane 2 - sample text', wx.DefaultPosition, wx.Size(200,150), wx.NO_BORDER | wx.TE_MULTILINE) text3 = wx.TextCtrl(self, -1, 'Main content window', wx.DefaultPosition, wx.Size(200,150), wx.NO_BORDER | wx.TE_MULTILINE) # add the panes to the manager self._mgr.AddPane(text1, wx.CENTER) self._mgr.AddPane(text2, wx.CENTER) self._mgr.AddPane(text3, wx.CENTER) # tell the manager to 'commit' all the changes just made self._mgr.Update() self.Bind(wx.EVT_CLOSE, self.OnClose) def OnClose(self, event): # deinitialize the frame manager self._mgr.UnInit() # delete the frame self.Destroy() app = wx.App() frame = MyFrame(None) frame.Show() app.MainLoop() I want to know what is called when we change the size of the panes. If you tell me that, I can do the rest by myself :)

    Read the article

  • Obtaining references to function objects on the execution stack from the frame object?

    - by Marcin
    Given the output of inspect.stack(), is it possible to get the function objects from anywhere from the stack frame and call these? If so, how? (I already know how to get the names of the functions.) Here is what I'm getting at: Let's say I'm a function and I'm trying to determine if my caller is a generator or a regular function? I need to call inspect.isgeneratorfunction() on the function object. And how do you figure out who called you? inspect.stack(), right? So if I can somehow put those together, I'll have the answer to my question. Perhaps there is an easier way to do this?

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • unit test for proxy checking

    - by zubin71
    Proxy configuration of a machine can be easily fetched using def check_proxy(): import urllib2 http_proxy = urllib2.getproxies().get('http') I need to write a test for the above written function. In order to do that I need to:- Set the system-wide proxy to an invalid URL during the test(sounds like a bad idea). Supply an invalid URL to http_proxy. How can I achieve either of the above?

    Read the article

  • Returning Database Blobs in TurboGears 2.x / FCGI / Lighttpd extremely slow

    - by Tom
    Hey everyone, I am running a TG2 App on lighttpd via flup/fastcgi. We are reading images (~30kb each) from BlobFields in a MySQL database and return those images with a custom mime type via a controller method. Caching these images on the hard disk makes no sense because they change with every request, the only reason we cache these in the DB is that creating these images is quite expensive and the data used to create the images is also present in plain text on the website. Now to the problem itself: When returning such an image, things get extremely slow. The code runs totally fine on paster itself with no visible delay, but as soon as its running via fcgi/lighttpd the described phenomenon happens. I profiled the method of my controller that returns my blob, and the entire method runs in a few miliseconds, but when "return" executes, the entire app hangs for roughly 10 seconds. We could not reproduce the same error with PHP on FCGI. This only seems to happen with Turbogears or Pylons. Here for your consideration the concerned piece of source code: @expose(content_type=CUSTOM_CONTENT_TYPE) def return_img(self, img_id): """ Return a DB persisted image when requested """ img = model.Images.by_id(img_id) #get image from DB response.headers['content-type'] = 'image/png' return img.data # this causes the app to hang for 10 seconds

    Read the article

  • redefine __and__ operator

    - by wiso
    Why I can't redefine the __and__ operator? class Cut(object): def __init__(self, cut): self.cut = cut def __and__(self, other): return Cut("(" + self.cut + ") && (" + other.cut + ")") a = Cut("a>0") b = cut("b>0") c = a and b print c.cut() I want (a>0) && (b>0), but I got b, that the usual behaviour of and

    Read the article

  • twisted reactor stops too early

    - by pygabriel
    I'm doing a batch script to connect to a tcp server and then exiting. My problem is that I can't stop the reactor, for example: cmd = raw_input("Command: ") # custom factory, the protocol just send a line reactor.connectTCP(HOST,PORT, CommandClientFactory(cmd) d = defer.Deferred() d.addCallback(lambda x: reactor.stop()) reactor.callWhenRunning(d.callback,None) reactor.run() In this code the reactor stops before that the tcp connection is done and the cmd is passed. How can I stop the reactor after that all the operation are finished?

    Read the article

  • I get a 400 Bad Request error while using django-piston

    - by Cheezo
    Hello, I am trying to use Piston to provide REST support to Django. I have implemented my handlers as per the documentation provided . The problem is that i can "read" and "delete" my resource but i cannot "create" or "update". Each time i hit the relevant api i get a 400 Bad request Error. I have extended the Resource class for csrf by using this commonly available code snippet: class CsrfExemptResource(Resource): """A Custom Resource that is csrf exempt""" def init(self, handler, authentication=None): super(CsrfExemptResource, self).init(handler, authentication) self.csrf_exempt = getattr(self.handler, 'csrf_exempt', True) My class (code snippet) looks like this: user_resource = CsrfExemptResource(User) class User(BaseHandler): allowed_methods = ('GET', 'POST', 'PUT', 'DELETE') @require_extended def create(self, request): email = request.GET['email'] password = request.GET['password'] phoneNumber = request.GET['phoneNumber'] firstName = request.GET['firstName'] lastName = request.GET['lastName'] self.createNewUser(self, email,password,phoneNumber,firstName,lastName) return rc.CREATED Please let me know how can i get the create method to work using the POST operation?

    Read the article

  • List Directories and get the name of the Directory

    - by chrissygormley
    Hello, I am trying to get the code to list all the directories in a folder, change directory into that folder and get the name of the current folder. The code I have so far is below and isn't working at the minute. I seem to be getting the parent folder name. import os for directories in os.listdir(os.getcwd()): dir = os.path.join('/home/user/workspace', directories) os.chdir(dir) current = os.path.dirname(dir) new = str(current).split("-")[0] print new I also have other files in the folder but I do not want to list them. I have tried the below code but I haven't got it working yet either. for directories in os.path.isdir(os.listdir(os.getcwd())): Can anyone see where I am going wrong? Thanks

    Read the article

  • In Django, why is user.is_authenticated a method and not a member variable like is_staff

    - by luc
    Hello all, I've lost some time with a bug in my app due to user authentication. I think that it's a bit confusing but maybe someone can explain the reason and it will appear to me very logical. The user.is_staff is a member variable while user.is_authenticated is a method. However is_authenticated only returns True or False depending if the class is User or AnonymousUser (see http://docs.djangoproject.com/en/dev/topics/auth/) Is there a reason for that? Why user.is_authenticated is a method? Thanks in advance

    Read the article

  • Most efficient way to update attribute of one instance

    - by Begbie00
    Hi all - I'm creating an arbitrary number of instances (using for loops and ranges). At some event in the future, I need to change an attribute for only one of the instances. What's the best way to do this? Right now, I'm doing the following: 1) Manage the instances in a list. 2) Iterate through the list to find a key value. 3) Once I find the right object within the list (i.e. key value = value I'm looking for), change whatever attribute I need to change. for Instance within ListofInstances: if Instance.KeyValue == SearchValue: Instance.AttributeToChange = 10 This feels really inefficient: I'm basically iterating over the entire list of instances, even through I only need to change an attribute in one of them. Should I be storing the Instance references in a structure more suitable for random access (e.g. dictionary with KeyValue as the dictionary key?) Is a dictionary any more efficient in this case? Should I be using something else? Thanks, Mike

    Read the article

  • etree.findall: 'OR'-lookup?

    - by piquadrat
    I want to find all stylesheet definitions in a XHTML file with lxml.etree.findall. This could be as simple as elems = tree.findall('link[@rel="stylesheet"]') + tree.findall('style') But the problem with CSS style definitions is that the order matters, e.g. <link rel="stylesheet" type="text/css" href="/media/css/first.css" /> <style>body:{font-size: 10px;}</style> <link rel="stylesheet" type="text/css" href="/media/css/second.css" /> if the contents of the style tag is applied after the rules in the two link tags, the result may be completely different from the one where the rules are applied in order of definition. So, how would I do a lookup that inlcudes both link[@rel="stylesheet"] and style?

    Read the article

  • Filter zipcodes by proximity in Django with the Spherical Law of Cosines

    - by spiffytech
    I'm trying to handle proximity search for a basic store locater in Django. Rather than haul PostGIS around with my app just so I can use GeoDjango's distance filter, I'd like to use the Spherical Law of Cosines distance formula in a model query. I'd like all of the calculations to be done in the database in one query, for efficiency. An example MySQL query from The Internet implementing the Spherical Law of Cosines like this: SELECT id, ( 3959 * acos( cos( radians(37) ) * cos( radians( lat ) ) * cos( radians( lng ) - radians(-122) ) + sin( radians(37) ) * sin( radians( lat ) ) ) ) AS distance FROM stores HAVING distance < 25 ORDER BY distance LIMIT 0 , 20; The query needs to reference the Zipcode ForeignKey for each store's lat/lng values. How can I make all of this work in a Django model query?

    Read the article

  • Qt/PyQt dialog with toggable fullscreen mode - problem on Windows

    - by Guard
    I have a dialog created in PyQt. It's purpose and functionality don't matter. The init is: class MyDialog(QWidget, ui_module.Ui_Dialog): def __init__(self, parent=None): super(MyDialog, self).__init__(parent) self.setupUi(self) self.installEventFilter(self) self.setWindowFlags(Qt.Dialog | Qt.WindowTitleHint) self.showMaximized() Then I have event filtering method: def eventFilter(self, obj, event): if event.type() == QEvent.KeyPress: key = event.key() if key == Qt.Key_F11: if self.isFullScreen(): self.setWindowFlags(self._flags) if self._state == 'm': self.showMaximized() else: self.showNormal() self.setGeometry(self._geometry) else: self._state = 'm' if self.isMaximized() else 'n' self._flags = self.windowFlags() self._geometry = self.geometry() self.setWindowFlags(Qt.Tool | Qt.FramelessWindowHint) self.showFullScreen() return True elif key == Qt.Key_Escape: self.close() return QWidget.eventFilter(self, obj, event) As can be seen, Esc is used for dialog hiding, and F11 is used for toggling full-screen. In addition, if the user changed the dialog mode from the initial maximized to normal and possibly moved the dialog, it's state and position are restored after exiting the full-screen. Finally, the dialog is created on the MainWindow action triggered: d = MyDialog(self) d.show() It works fine on Linux (Ubuntu Lucid), but quite strange on Windows 7: if I go to the full-screen from the maximized mode, I can't exit full-screen (on F11 dialog disappears and appears in full-screen mode again. If I change the dialog's mode to Normal (by double-clicking its title), then go to full-screen and then return back, the dialog is shown in the normal mode, in the correct position, but without the title line. Most probably the reason for both cases is the same - the setWindowFlags doesn't work. But why? Is it also possible that it is the bug in the recent PyQt version? On Ubuntu I have 4.6.x from apt, and on Windows - the latest installer from the riverbank site.

    Read the article

  • I am currently serving my static files in Django. How do I use Apache2 to do this?

    - by alex
    (r'^media/(?P<path>.*)$', 'django.views.static.serve',{'document_root': settings.MEDIA_ROOT}), As you can see, I have a directory called "media" under my Django project. I would like to delete this line in my urls.py and instead us Apache to serve my static files. What do I do to my Apache configs (which files do I change) in order to do this? By the way, I installed Apache2 like normal: sudo aptitude install apache2

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 366 367 368 369 370 371 372 373 374 375 376 377  | Next Page >