Search Results

Search found 56144 results on 2246 pages for 'web search'.

Page 370/2246 | < Previous Page | 366 367 368 369 370 371 372 373 374 375 376 377  | Next Page >

  • How do I do an exact whois search?

    - by brianegge
    When I execute the following whois command on my Ubuntu server, I get all sorts of other domains which contain google.com in the name, but clearly aren't owned by google. As this appears to be some sort of spam, I won't paste the output here. I'd like to check for exactly the name I typed in. I thought the following would work, but it doesn't. What is the proper way to do an exact match? whois -Hx google.com

    Read the article

  • WSS Web application and IIS Website differences

    - by chaitanya
    Can somebody explain briefly the differences between a "WSS Web Application" and a normal "IIS Website"? I have read that a WSS web application is a "special" IIS Website with WSS featured. I also know that the content of a web application is stored in an SQL Server Website(called the content database) whereas an IIS Website stores it on a hard disk on the server. A point-by-point difference would be appreciated.

    Read the article

  • search data from FileReader in Java

    - by maya
    hi I'm new in java how to read and search data from file (txt) and then display the data in TextArea or Jtable. for example I have file txt contains data and I need to display this data in textarea after I clicked a button, I have used FileReader , and t1 t2 tp are attributes in the file import java.io.FileReader; import java.io.IOException; String t1,t2,tp; Ffile f1= new Ffile(); FileReader fin = new FileReader("test2.txt"); Scanner src = new Scanner(fin); while (src.hasNext()) { t1 = src.next(); textarea.setText(t1); t2 = src.next(); textarea.setText(t2); tp = src.next(); textarea.setText(tp); f1.insert(t1,t2,tp); } fin.close(); also I have used the inputstream DataInputStream dis = null; String dbRecord = null; try { File f = new File("text2.text"); FileInputStream fis = new FileInputStream(f); BufferedInputStream bis = new BufferedInputStream(fis); dis = new DataInputStream while ( (dbRecord = dis.readLine()) != null) { StringTokenizer st = new StringTokenizer(dbRecord, ":"); String t1 = st.nextToken(); String t2 = st.nextToken(); String tp = st.nextToken(); textarea.setText(textarea.getText()+t1); textarea.setText(textarea.getText()+t2); textarea.setText(textarea.getText()+tp); } } catch (IOException e) { // catch io errors from FileInputStream or readLine() System.out.println("Uh oh, got an IOException error: " + e.getMessage()); } finally { } but both of them don't work ,so please any one help me I want to know how to read data and also search it from file and i need to display the data in textarea . thanks in advance

    Read the article

  • How can I get Opera speed-dial and password management features in other browsers?

    - by Howard Guo
    I heavily rely on Opera's speed dial and password management features. Lack of these two features is really stopping me from switching to another web browser such as Chrome or Firefox. Opera's password management has two unique characteristics which I rely on heavily: It saves passwords on all pages, (apparently) despite the page's meta data asking not to save passwords. It offers keyboard shortcut and button to automatically fill in username/passwords and all other fields in a login form, then automatically submit the form. (So I'm only one key/click away from logging into a website) How can I get those functions in other browsers? Thank you! Edit: Reason being that I use other web browsers at work and I wish they could have those functions.

    Read the article

  • Photo/Video gallery for Ubuntu web server

    - by Andrew
    I'm trying to have a gallery that can display images as well as videos for visitors to my web server. I'm running Ubuntu 12.10, and have Apache installed. All my images and videos are in /var/www/media. I've taken a look at bbgallery, which is simple enough for me, but I don't think it supports video. I've also looked at Single File PHP Gallery, but it doesn't support video. Does anyone know of a gallery that supports video as well, which I can use for my web server? EDIT: I do not have a database.

    Read the article

  • How to ignore query parameters in web cache?

    - by eduardocereto
    Google Analytics use some query parameters to identify campaigns and to do cookie control. This is all handled by javascript code. Take a look at the following example: http://www.example.com/?utm_source=newsletter&utm_medium=email&utm_ter m=October%2B2008&utm_campaign=promotion This will set cookies via JavaScript with the right campaign origin. This query parameters can have multiple and sometimes random values. Since they are used as cache hash keys the cache performance is heavily degraded in some scenarios. I suppose there's a not so hard configuration on cache servers to just ignore all query parameters or specific query parameters. Am I right? Does anyone know how hard is it in popular web cache solutions, to create ? I'm not interested in a specific web cache solution. It would be great to hear about the one you use.

    Read the article

  • Virtual server hardware to simulate 3-4 node web farm

    - by frankadelic
    I would like to get a dedicated server to run VMWare, VirtualBox, or similar. On this box, I would like to host 3-4 virtual instances of Linux, to act as nodes in a web farm. Performance is not that important, this would only be for testing and experimenting. I need something sub $1000 (including tax/shipping). Can someone recommend a pre-built server that would do the trick? I am pretty ignorant of hardware so building one is not going to work for me. Also, would I need multiple network cards to simulate a web farm or can the virtualization software handle that for me. Thanks

    Read the article

  • Search XDocument with LINQ with out knowing the Namespace

    - by BarDev
    Is there a way to search a XDocument without knowing the Namespace. I have a process that logs all soap requests and encrypts the sensitive data. I want to find any elements based on name. Something like, give me all elements where the name is CreditCard. I don't care what the namespace is. My problem seems to be with LINQ and requiring a xml namespace. I have other processes that retrieve values from XML, but I know the namespace for these other process. XDocument xDocument = XDocument.Load(@"C:\temp\Packet.xml"); XNamespace xNamespace = "http://CompanyName.AppName.Service.Contracts"; var elements = xDocument.Root.DescendantsAndSelf().Elements().Where(d = d.Name == xNamespace + "CreditCardNumber"); But what I really want, is to have the ability to search xml without knowing about namespaces, something like this: XDocument xDocument = XDocument.Load(@"C:\temp\Packet.xml"); var elements = xDocument.Root.DescendantsAndSelf().Elements().Where(d = d.Name == "CreditCardNumber") But of course this will not work be cause I do no have a namespace. BarDev

    Read the article

  • Using awstats with a round-robin DNS configuration

    - by Shaun
    I have a website with multiple web servers whose access is controlled via a round-robin DNS. We currently use Google Analytics for site traffic monitoring but were looking to move to awstats due to concerns of inaccuracy with Google Analytics and using third-party trackers in general. I have a little experience with awstats and I know it gets its information from parsing server logs. How would this work when you have multiple web servers logging independently to separate locations? Is this supported with awstats? Is there an alternative I could use to track traffic activity directly on my servers?

    Read the article

  • Using ASP.NET Automatically login to an external website and redirect

    - by DoodleWalker
    Hello, We have a series of products with built in web servers each of which has a login page, a customer wants to create a web portal in which they log into once, from there they can simply click on any of the devices (external websites) and it will automatically login to that site and redirect them to the page after the login screen. The portal is using ASP.NET MVC, the external devices are Windows CE based units running embedded web servers. Can find a lot on scraping, but not much on redirection after the event. Many Thanks Andy

    Read the article

  • Get the file path of current application's config file

    - by dummy
    The reason I asked this question is that I wanted to create a helper class for Remoting instantiation, and wanted to pass the appropriate app.exe.config (or web.config) file path to the RemotingConfiguration.Configure method, depending on the caller. Is there a way I could get the name of the config file for both Win and Web apps without checking if the application is Web or WinForms?

    Read the article

  • How can you open windows program by pressing a button on web page

    - by Dani AM
    How can you open windows program by pressing a button on web page I develop web app in asp.net, and I want to do some action in windows when press button on the web page, For example: when you press Messenger button in http://www.msn.com/?ocid=hmlogout windows live messenger will open in your computer, Is there a certain technique to do that ? thanks for any suggestion. Dani.

    Read the article

  • ASP.NET mvc on mono 2.2

    - by Markus
    Hi, I am having a trouble. I am trying to run asp.net mvc 1.0 on mono 2.2.I have copied the system.web.mvc.dll to bin directory. I have done HttpContext.Current.RewritePath("/Home/Index");. Still I am having te error: Server Error in '/' Application The incoming request does not match any route Description: HTTP 500. Error processing request. Stack Trace: System.Web.HttpException: The incoming request does not match any route at System.Web.Routing.UrlRoutingHandler.ProcessRequest (System.Web.HttpContextBase httpContext) [0x00000] at System.Web.Routing.UrlRoutingHandler.ProcessRequest (System.Web.HttpContext httpContext) [0x00000] at System.Web.Routing.UrlRoutingHandler.System.Web.IHttpHandler.ProcessRequest (System.Web.HttpContext context) [0x00000] at MvcApplication4._Default.Page_Load (System.Object sender, System.EventArgs e) [0x00000] at System.Web.UI.Control.OnLoad (System.EventArgs e) [0x00000] at System.Web.UI.Control.LoadRecursive () [0x00000] at System.Web.UI.Page.ProcessLoad () [0x00000] at System.Web.UI.Page.ProcessPostData () [0x00000] at System.Web.UI.Page.InternalProcessRequest () [0x00000] at System.Web.UI.Page.ProcessRequest (System.Web.HttpContext context) [0x00000] Version information: Mono Version: 2.0.50727.1433; ASP.NET Version: 2.0.50727.1433

    Read the article

  • Using web view behind a proxy (cocoa)

    - by Cal S
    Hi, I'm creating a web-browser type app (using a web view object) that needs to be able to connect to the internet via a proxy. Server, port, username and password can all be hardcoded into the app but unfortunately I have no idea how to customise the proxy settings of a web view without changing the system wide proxy settings. If you know how to do this please provide some example code, thanks a lot! (Also, if it changes anything - I'm developing for mac, not iPhone)

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Silverlight 4 web cam permission on load of User Control

    - by Mike
    I am using Silverlight 4 to access the web cam. Everything works ok when I start the web cam on a button click event, I get the prompt for permission. I would like the web cam to start when User Control loads, but for some reason when I run the same code on the Loaded event, I don't get a prompt when executing the following code:' CaptureDeviceConfiguration.RequestDeviceAccess() Does anyone have a work around for this?

    Read the article

  • SSL certificate for ISAPI redirected Web Site

    - by Daniel
    I have a Win 2003 server and I'm using Ionics Isapi Rewrite Filter to redirect requests made to a Web Site configured in IIS to another Apache2 Server in a server not exposed to the Internet. The Web Site has its host headers configured to catch requests for the specific site, and the redirection is being done with the ProxyPass directive. This is working OK. So far the scenario, my question is: I'd like to add a server certificate to the Apache server, but I don´t know if I need to add the certificate to both Apache and IIS sites. I think I still don´t get the theory behind this and would like to know from someone with expertise in the field the right way to implement this. Thank you in advance.

    Read the article

  • Convert video format to Flash Video automatically

    - by Jessica Boxer
    I need to allow web site users to upload videos to my web site in various common formats. From these I need to convert them to Flash video, and also limit their lengths and size. I need to do this automatically as part of the web site processing. Is there some simple tool that will allow me to do this? If not, can you point me in a direction that might help me out. Thanks.

    Read the article

  • Get the file path of the current app

    - by dummy
    The reason I asked this question is that I wanted to create a helper class for Remoting instantiation, and wanted to pass the appropriate app.exe.config (or web.config) file path to the RemotingConfiguration.Configure method, depending on the caller. Is there a way I could get the name of the config file for both Win and Web apps without checking if the application is Web or WinForms?

    Read the article

  • How does MTOM work + sample code

    - by zengr
    I am trying to make a very simple web-service which does the following: The client hits the web service requesting a file. The web service's service class queries a hashtable which has the key (search query) and the value as the base64encoded value of a file (say a pdf) Now,I need to use MTOM to return the base64encoded value stored in the hashtable to the client. It's upto the client to decode it and convert it to pdf. So, here are my questions: I understand we encode files to base64 for transmission via web service, but where and how does MTOM come into the picture there? Can some one provide me a simple method which uses MTOM and sends the data back. Do we need to specify something in the WSDL too? or a simple String return type would suffice? Why/Why not? Thanks I have seen this code. It uses a lot of annotations, I just need a simple java code using MTOM. New to J2EE HERE :)

    Read the article

  • Security question pertaining web application deployment

    - by orokusaki
    I am about to deploy a web application (in a couple months) with the following set-up (perhaps anyways): Ubuntu Lucid Lynx with: IP Tables firewall (white-list style with only 3 ports open) Custom SSH port (like 31847 or something) No "root" SSH access Long, random username (not just "admin" or something) with a long password (65 chars) PostgreSQL which only listens to localhost 256 bit SSL Cert Reverse proxy from NGINX to my application server (UWSGI) Assume that my colo is secure (Physical access isn't my concern for the time being) Application-level security (SQL injection, XSS, Directory Traversal, CSRF, etc) Perhaps IP masquerading (but I don't really understand this yet) Does this sound like a secure setup? I hear about people's web apps getting hacked all the time, and part of me thinks, "maybe they're just neglecting something", but the other part of me thinks, "maybe there's nothing you can do to protect your server, and those things are just measures to make it a little harder for script kiddies to get in". If I told you all of this, gave you my IP address, and told you what ports were available, would it be possible for you to get in (assuming you have a penetration testing tool), or is this really protected well.

    Read the article

< Previous Page | 366 367 368 369 370 371 372 373 374 375 376 377  | Next Page >