Search Results

Search found 13534 results on 542 pages for 'python 2 1'.

Page 373/542 | < Previous Page | 369 370 371 372 373 374 375 376 377 378 379 380  | Next Page >

  • In SqlAlchemy, how to ignore m2m relationship attributes when merge?

    - by ablmf
    There is a m2m relation in my models, User and Role. I want to merge a role, but i DO NOT want this merge has any effect on user and role relation-ship. Unfortunately, for some complicate reason, role.users if not empty. I tried to set role.users = None, but SA complains None is not a list. At this moment, I use sqlalchemy.orm.attributes.del_attribute, but I don't know if it's provided for this purpose.

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • has any tools easy to download or uploaed data from gae ..

    - by zjm1126
    i find this: http://aralbalkan.com/1784 but it is : Gaebar is an easy-to-use, standalone Django application that you can plug in to your existing Google App Engine Django or app-engine-patch-based Django applications on Google App Engine to give them datastore backup and restore functionality. my app is not based on django,so did you know any tools esay to do this . thanks

    Read the article

  • How can I load a sql "dump" file into sql alchemy

    - by JudoWill
    I have a large sql dump file ... with multiple CREATE TABLE and INSERT INTO statements. Is there any way to load these all into a SQLAlchemy sqlite database at once. I plan to use the introspected ORM from sqlsoup after I've created the tables. However, when I use the engine.execute() method it complains: sqlite3.Warning: You can only execute one statement at a time. Is there a way to work around this issue. Perhaps splitting the file with a regexp or some kind of parser, but I don't know enough SQL to get all of the cases for the regexp. Any help would be greatly appreciated. Will EDIT: Since this seems important ... The dump file was created with a MySQL database and so it has quite a few commands/syntax that sqlite3 does not understand correctly.

    Read the article

  • Testing InlineFormset clean methods

    - by Rory
    I have a Django project, with 2 models, a Structure and Bracket, the Bracket has a ForeignKey to a Structure (i.e. one-to-many, one Structure has many Brackets). I created a TabularInline for the admin site, so that there would be a table of Brackets on the Structure. I added a custom formset with some a custom clean method to do some extra validation, you can't have a Bracket that conflicts with another Bracket on the same Structure etc. The admin looks like this: class BracketInline(admin.TabularInline): model = Bracket formset = BracketInlineFormset class StructureAdmin(admin.ModelAdmin): inlines = [ BracketInline ] admin.site.register(Structure, StructureAdmin) That all works, and the validation works. However now I want to write some unittest to test my complex formset validation logic. My first attempt to validate known-good values is: data = {'form-TOTAL_FORMS': '1', 'form-INITIAL_FORMS': '0', 'form-MAX_NUM_FORMS': '', 'form-0-field1':'good-value', … } formset = BracketInlineFormset(data) self.assertTrue(formset.is_valid()) However that doesn't work and raises the exception: ====================================================================== ERROR: testValid (appname.tests.StructureTestCase) ---------------------------------------------------------------------- Traceback (most recent call last): File "/paht/to/project/tests.py", line 494, in testValid formset = BracketInlineFormset(data) File "/path/to/django/forms/models.py", line 672, in __init__ self.instance = self.fk.rel.to() AttributeError: 'BracketInlineFormset' object has no attribute 'fk' ---------------------------------------------------------------------- The Django documentation (for formset validation) implies one can do this. How come this isn't working? How do I test the custom clean()/validation for my inline formset?

    Read the article

  • How to write data by dynamic parameter name

    - by Maxim Welikobratov
    I need to be able to write data to datastore of google-app-engine for some known entity. But I don't want write assignment code for each parameter of the entity. I meen, I don't want do like this val_1 = self.request.get('prop_1') val_2 = self.request.get('prop_2') ... val_N = self.request.get('prop_N') item.prop_1 = val_1 item.prop_2 = val_2 ... item.prop_N = val_N item.put() instead, I want to do something like this args = self.request.arguments() for prop_name in args: item.set(prop_name, self.request.get(prop_name)) item.put() dose anybody know how to do this trick?

    Read the article

  • Looping through a directory on the web and displaying its contents (files and other directories) via

    - by al jaffe
    In the same vein as http://stackoverflow.com/questions/2593399/process-a-set-of-files-from-a-source-directory-to-a-destination-directory-in-pyth I'm wondering if it is possible to create a function that when given a web directory it will list out the files in said directory. Something like... files[] for file in urllib.listdir(dir): if file.isdir: # handle this as directory else: # handle as file I assume I would need to use the urllib library, but there doesn't seem to be an easy way of doing this, that I've seen at least.

    Read the article

  • Getting unpredictable data into a tabular format

    - by Acorn
    The situation: Each page I scrape has <input> elements with a title= and a value= I don't know what is going to be on the page. I want to have all my collected data in a single table at the end, with a column for each title. So basically, I need each row of data to line up with all the others, and if a row doesn't have a certain element, then it should be blank (but there must be something there to keep the alignment). eg. First page has: {animal: cat, colour: blue, fruit: lemon, day: monday} Second page has: {animal: fish, colour: green, day: saturday} Third page has: {animal: dog, number: 10, colour: yellow, fruit: mango, day: tuesday} Then my resulting table should be: animal | number | colour | fruit | day cat | none | blue | lemon | monday fish | none | green | none | saturday dog | 10 | yellow | mango | tuesday Although it would be good to keep the order of the title value pairs, which I know dictionaries wont do. So basically, I need to generate columns from all the titles (kept in order but somehow merged together) What would be the best way of going about this without knowing all the possible titles and explicitly specifying an order for the values to be put in?

    Read the article

  • Rearranging a sequence

    - by sarah
    I'm have trouble rearranging sequences so the amount of letters in the given original sequence are the same in the random generated sequences. For example: If i have a string 'AAAC' I need that string rearranged randomly so the amount of A's and C's are the same.

    Read the article

  • Clean Method for a ModelForm in a ModelFormSet made by modelformset_factory

    - by Salyangoz
    I was wondering if my approach is right or not. Assuming the Restaurant model has only a name. forms.py class BaseRestaurantOpinionForm(forms.ModelForm): opinion = forms.ChoiceField(choices=(('yes', 'yes'), ('no', 'no'), ('meh', 'meh')), required=False, )) class Meta: model = Restaurant fields = ['opinion'] views.py class RestaurantVoteListView(ListView): queryset = Restaurant.objects.all() template_name = "restaurants/list.html" def dispatch(self, request, *args, **kwargs): if request.POST: queryset = self.request.POST.dict() #clean here return HttpResponse(json.dumps(queryset), content_type="application/json") def get_context_data(self, **kwargs): context = super(EligibleRestaurantsListView, self).get_context_data(**kwargs) RestaurantFormSet = modelformset_factory( Restaurant,form=BaseRestaurantOpinionForm ) extra_context = { 'eligible_restaurants' : self.get_eligible_restaurants(), 'forms' : RestaurantFormSet(), } context.update(extra_context) return context Basically I'll be getting 3 voting buttons for each restaurant and then I want to read the votes. I was wondering from where/which clean function do I need to call to get something like: { ('3' : 'yes'), ('2' : 'no') } #{ 'restaurant_id' : 'vote' } This is my second/third question so tell me if I'm being unclear. Thanks.

    Read the article

  • Iterate with binary structure over numpy array to get cell sums

    - by Curlew
    In the package scipy there is the function to define a binary structure (such as a taxicab (2,1) or a chessboard (2,2)). import numpy from scipy import ndimage a = numpy.zeros((6,6), dtype=numpy.int) a[1:5, 1:5] = 1;a[3,3] = 0 ; a[2,2] = 2 s = ndimage.generate_binary_structure(2,2) # Binary structure #.... Calculate Sum of result_array = numpy.zeros_like(a) What i want is to iterate over all cells of this array with the given structure s. Then i want to append a function to the current cell value indexed in a empty array (example function sum), which uses the values of all cells in the binary structure. For example: array([[0, 0, 0, 0, 0, 0], [0, 1, 1, 1, 1, 0], [0, 1, 2, 1, 1, 0], [0, 1, 1, 0, 1, 0], [0, 1, 1, 1, 1, 0], [0, 0, 0, 0, 0, 0]]) # The array a. The value in cell 1,2 is currently one. Given the structure s and an example function such as sum the value in the resulting array (result_array) becomes 7 (or 6 if the current cell value is excluded). Someone got an idea?

    Read the article

  • Right way to return proxy model instance from a base model instance in Django ?

    - by sotangochips
    Say I have models: class Animal(models.Model): type = models.CharField(max_length=255) class Dog(Animal): def make_sound(self): print "Woof!" class Meta: proxy = True class Cat(Animal): def make_sound(self): print "Meow!" class Meta: proxy = True Let's say I want to do: animals = Animal.objects.all() for animal in animals: animal.make_sound() I want to get back a series of Woofs and Meows. Clearly, I could just define a make_sound in the original model that forks based on animal_type, but then every time I add a new animal type (imagine they're in different apps), I'd have to go in and edit that make_sound function. I'd rather just define proxy models and have them define the behavior themselves. From what I can tell, there's no way of returning mixed Cat or Dog instances, but I figured maybe I could define a "get_proxy_model" method on the main class that returns a cat or a dog model. Surely you could do this, and pass something like the primary key and then just do Cat.objects.get(pk = passed_in_primary_key). But that'd mean doing an extra query for data you already have which seems redundant. Is there any way to turn an animal into a cat or a dog instance in an efficient way? What's the right way to do what I want to achieve?

    Read the article

  • Installing twisted.mail.smtp

    - by user3506985
    I am using Ubuntu 14.04 and trying to install twisted.mail.smtp using the following commnands -sudo add-apt-repository ppa:jesstess/twisted-12.1-testing -sudo apt-get update There are no errors in the installation,but when I specify the command that is from twisted.mail.smtp import ESMTPSenderFactory I am getting the following error Error: ImportError: No module named mail.smtp Please help me out

    Read the article

  • Setting up relations/mappings for a SQLAlchemy many-to-many database

    - by Brent Ramerth
    I'm new to SQLAlchemy and relational databases, and I'm trying to set up a model for an annotated lexicon. I want to support an arbitrary number of key-value annotations for the words which can be added or removed at runtime. Since there will be a lot of repetition in the names of the keys, I don't want to use this solution directly, although the code is similar. My design has word objects and property objects. The words and properties are stored in separate tables with a property_values table that links the two. Here's the code: from sqlalchemy import Column, Integer, String, Table, create_engine from sqlalchemy import MetaData, ForeignKey from sqlalchemy.orm import relation, mapper, sessionmaker from sqlalchemy.ext.declarative import declarative_base engine = create_engine('sqlite:///test.db', echo=True) meta = MetaData(bind=engine) property_values = Table('property_values', meta, Column('word_id', Integer, ForeignKey('words.id')), Column('property_id', Integer, ForeignKey('properties.id')), Column('value', String(20)) ) words = Table('words', meta, Column('id', Integer, primary_key=True), Column('name', String(20)), Column('freq', Integer) ) properties = Table('properties', meta, Column('id', Integer, primary_key=True), Column('name', String(20), nullable=False, unique=True) ) meta.create_all() class Word(object): def __init__(self, name, freq=1): self.name = name self.freq = freq class Property(object): def __init__(self, name): self.name = name mapper(Property, properties) Now I'd like to be able to do the following: Session = sessionmaker(bind=engine) s = Session() word = Word('foo', 42) word['bar'] = 'yes' # or word.bar = 'yes' ? s.add(word) s.commit() Ideally this should add 1|foo|42 to the words table, add 1|bar to the properties table, and add 1|1|yes to the property_values table. However, I don't have the right mappings and relations in place to make this happen. I get the sense from reading the documentation at http://www.sqlalchemy.org/docs/05/mappers.html#association-pattern that I want to use an association proxy or something of that sort here, but the syntax is unclear to me. I experimented with this: mapper(Word, words, properties={ 'properties': relation(Property, secondary=property_values) }) but this mapper only fills in the foreign key values, and I need to fill in the other value as well. Any assistance would be greatly appreciated.

    Read the article

  • sqlite3 'database is locked' won't go away with retries

    - by Azarias
    I have a sqlite3 database that is accessed by a few threads (3-4). I am aware of the general limitations of sqlite3 with regards to concurrency as stated http://www.sqlite.org/faq.html#q6 , but I am convinced that is not the problem. All of the threads both read and write from this database. Whenever I do a write, I have the following construct: try: Cursor.execute(q, params) Connection.commit() except sqlite3.IntegrityError: Notify except sqlite3.OperationalError: print sys.exc_info() print("DATABASE LOCKED; sleeping for 3 seconds and trying again") time.sleep(3) Retry On some runs, I won't even hit this block, but when I do, it never comes out of it (keeps retrying, but I keep getting the 'database is locked' error from exc_info. If I understand the reader/writer lock usage correctly, some amount of waiting should help with the contention. What this sounds like is deadlock, but I do not use any transactions in my code, and every SELECT or INSERT is simply a one off. Some threads, however, keep the same connection when they do their operation (which includes a mix of SELECTS and INSERTS and other modifiers). I would appericiate it if you could shade a light on this, and also ways around fixing it (besides using a different database engine.)

    Read the article

  • How to separate comma separeted data from csv file?

    - by Rahul
    I have opened a csv file and I want to sort each string which is comma separeted and are in same line: ex:: file : name,sal,dept tom,10000,it o/p :: each string in string variable I have a file which is already open, so I can not use "open" API, I have to use "csv.reader" which have to read one line at a time.

    Read the article

  • methods of metaclasses on class instances.

    - by Stefano Borini
    I was wondering what happens to methods declared on a metaclass. I expected that if you declare a method on a metaclass, it will end up being a classmethod, however, the behavior is different. Example >>> class A(object): ... @classmethod ... def foo(cls): ... print "foo" ... >>> a=A() >>> a.foo() foo >>> A.foo() foo However, if I try to define a metaclass and give it a method foo, it seems to work the same for the class, not for the instance. >>> class Meta(type): ... def foo(self): ... print "foo" ... >>> class A(object): ... __metaclass__=Meta ... def __init__(self): ... print "hello" ... >>> >>> a=A() hello >>> A.foo() foo >>> a.foo() Traceback (most recent call last): File "<stdin>", line 1, in <module> AttributeError: 'A' object has no attribute 'foo' What's going on here exactly ? edit: bumping the question

    Read the article

  • Efficiently generate a 16-character, alphanumeric string

    - by ensnare
    I'm looking for a very quick way to generate an alphanumeric unique id for a primary key in a table. Would something like this work? def genKey(): hash = hashlib.md5(RANDOM_NUMBER).digest().encode("base64") alnum_hash = re.sub(r'[^a-zA-Z0-9]', "", hash) return alnum_hash[:16] What would be a good way to generate random numbers? If I base it on microtime, I have to account for the possibility of several calls of genKey() at the same time from different instances. Or is there a better way to do all this? Thanks.

    Read the article

  • Making all variables accessible to namespace

    - by Gökhan Sever
    Hello, Say I have a simple function: def myfunc(): a = 4.2 b = 5.5 ... many similar variables ... I use this function one time only and I am wondering what is the easiest way to make all the variables inside the function accessible to my main name-space. Do I have to declare global for each item? or any other suggested methods? Thanks.

    Read the article

  • Creating a custom widget using django for use on external sites

    - by ajt
    I have a new site that I am putting together and part of it has statistics for the site's users. I would like to create a widget that others can use on another website by invoking javascript that reads data from my server and shows that statistics for a given user, but I am having a hard time finding specific tutorials that covers this in django. I have seen the link at Alex Maradon's site [0], but it looks to me like that is passing html back to the widget and I am having a hard time figuring out how to do this using something like xml. Are there any django apps for doing this or does anyone know of good how-tos? [0] http://alexmarandon.com/articles/web_widget_jquery/

    Read the article

< Previous Page | 369 370 371 372 373 374 375 376 377 378 379 380  | Next Page >