Search Results

Search found 13534 results on 542 pages for 'python 2 1'.

Page 375/542 | < Previous Page | 371 372 373 374 375 376 377 378 379 380 381 382  | Next Page >

  • need help in site classification

    - by goh
    hi guys, I have to crawl the contents of several blogs. The problem is that I need to classify whether the blogs the authors are from a specific school and is talking about the school's stuff. May i know what's the best approach in doing the crawling or how should i go about the classification?

    Read the article

  • some register.inclusion_tag error in my code using django

    - by zjm1126
    my helloworld_tags: from django import template register = template.Library() def show_profile(): return {"eee": '333'} register.inclusion_tag("b.html")(show_profile) my view: def b(request): return render_to_response('b.html') my html: {% load helloworld_tags%} dsad {{ eee }} but only show 'dsad' ,not show 'dsad333' why?? thanks

    Read the article

  • Does urllib2.urlopen() actually fetch the page?

    - by beagleguy
    hi all, I was condering when I use urllib2.urlopen() does it just to header reads or does it actually bring back the entire webpage? IE does the HTML page actually get fetch on the urlopen call or the read() call? handle = urllib2.urlopen(url) html = handle.read() The reason I ask is for this workflow... I have a list of urls (some of them with short url services) I only want to read the webpage if I haven't seen that url before I need to call urlopen() and use geturl() to get the final page that link goes to (after the 302 redirects) so I know if I've crawled it yet or not. I don't want to incur the overhead of having to grab the html if I've already parsed that page. thanks!

    Read the article

  • Distance between numpy arrays, columnwise

    - by Jaapsneep
    I have 2 arrays in 2D, where the column vectors are feature vectors. One array is of size F x A, the other of F x B, where A << B. As an example, for A = 2 and F = 3 (B can be anything): arr1 = np.array( [[1, 4], [2, 5], [3, 6]] ) arr2 = np.array( [[1, 4, 7, 10, ..], [2, 5, 8, 11, ..], [3, 6, 9, 12, ..]] ) I want to calculate the distance between arr1 and a fragment of arr2 that is of equal size (in this case, 3x2), for each possible fragment of arr2. The column vectors are independent of each other, so I believe I should calculate the distance between each column vector in arr1 and a collection of column vectors ranging from i to i + A from arr2 and take the sum of these distances (not sure though). Does numpy offer an efficient way of doing this, or will I have to take slices from the second array and, using another loop, calculate the distance between each column vector in arr1 and the corresponding column vector in the slice?

    Read the article

  • Application closes on Nokia E71 when using urllib.urlopen

    - by sammr
    Hello, Im running the following code on my Nokia E71. But after the text input, the program closes abruptly. I have a GPRS connection on my phone,but i still seem to be having some problem with urllib.urlopen The code is as follows : import appuifw,urllib amountInDollars = appuifw.query(u"Enter amount in Dollars","text") data=urllib.urlopen("http://www.google.com").read() appuifw.note(u"Hey","info") Any way to fix this problem ? Thank You

    Read the article

  • Moving a turtle to the center of a circle.

    - by Maggie
    I've just started using the turtle graphics program, but I can't figure out how to move the turtle automatically to the center of a circle (no matter where the circle is located) without it drawing any lines. I thought I could use the goto.() function but it's too specific and I need something general.

    Read the article

  • SQLAlchemy introspection of ORM classes/objects

    - by Adam Batkin
    I am looking for a way to introspect SQLAlchemy ORM classes/entities to determine the types and other constraints (like maximum lengths) of an entity's properties. For example, if I have a declarative class: class User(Base): __tablename__ = "USER_TABLE" id = sa.Column(sa.types.Integer, primary_key=True) fullname = sa.Column(sa.types.String(100)) username = sa.Column(sa.types.String(20), nullable=False) password = sa.Column(sa.types.String(20), nullable=False) created_timestamp = sa.Column(sa.types.DateTime, nullable=False) I would want to be able to find out that the 'fullname' field should be a String with a maximum length of 100, and is nullable. And the 'created_timestamp' field is a DateTime and is not nullable.

    Read the article

  • any faster alternative??

    - by kaushik
    cost=0 for i in range(12): cost=cost+math.pow(float(float(q[i])-float(w[i])),2) cost=(math.sqrt(cost)) Any faster alternative to this? i am need to improve my entire code so trying to improve each statements performance. thanking u

    Read the article

  • any faster alternative??

    - by kaushik
    I have to read a file from a particular line number and i know the line number say "n": i have been thinking of two choice: 1)for i in range(n) fname.readline() k=readline() print k 2)i=0 for line in fname: dictionary[i]=line i=i+1 but i want to know faster alternative as i might have to perform this on different files 20000 times. is there is any other better alternatives?? thanking u

    Read the article

  • Do Django Models inherit managers? (Mine seem not to)

    - by Zach
    I have 2 models: class A(Model): #Some Fields objects = ClassAManager() class B(A): #Some B-specific fields I would expect B.objects to give me access to an instance of ClassAManager, but this is not the case.... >>> A.objects <app.managers.ClassAManager object at 0x103f8f290> >>> B.objects <django.db.models.manager.Manager object at 0x103f94790> Why doesn't B inherit the objects attribute from A?

    Read the article

  • Is there a functional way to do this?

    - by Ishpeck
    def flattenList(toFlatten): final=[] for el in toFlatten: if isinstance(el, list): final.extend(flattenList(el)) else: final.append(el) return final When I don't know how deeply the lists will nest, this is the only way I can think to do this. 2

    Read the article

  • How to give points for each indices of list

    - by Eric Jung
    def voting_borda(rank_ballots): '''(list of list of str) -> tuple of (str, list of int) The parameter is a list of 4-element lists that represent rank ballots for a single riding. The Borda Count is determined by assigning points according to ranking. A party gets 3 points for each first-choice ranking, 2 points for each second-choice ranking and 1 point for each third-choice ranking. (No points are awarded for being ranked fourth.) For example, the rank ballot shown above would contribute 3 points to the Liberal count, 2 points to the Green count and 1 point to the CPC count. The party that receives the most points wins the seat. Return a tuple where the first element is the name of the winning party according to Borda Count and the second element is a four-element list that contains the total number of points for each party. The order of the list elements corresponds to the order of the parties in PARTY_INDICES.''' #>>> voting_borda([['GREEN','NDP', 'LIBERAL', 'CPC'], ['GREEN','CPC','LIBERAL','NDP'], ['LIBERAL','NDP', 'CPC', 'GREEN']]) #('GREEN',[4, 6, 5, 3]) list_of_party_order = [] for sublist in rank_ballots: for party in sublist[0]: if party == 'GREEN': GREEN_COUNT += 3 elif party == 'NDP': NDP_COUNT += 3 elif party == 'LIBERAL': LIBERAL_COUNT += 3 elif party == 'CPC': CPC_COUNT += 3 for party in sublist[1]: if party == 'GREEN': GREEN_COUNT += 2 elif party == 'NDP': NDP_COUNT += 2 elif party == 'LIBERAL': LIBERAL_COUNT += 2 elif party == 'CPC': CPC_COUNT += 2 for party in sublist[2]: if party == 'GREEN': GREEN_COUNT += 1 elif party == 'NDP': NDP_COUNT += 1 elif party == 'LIBERAL': LIBERAL_COUNT += 1 elif party == 'CPC': CPC_COUNT += 1 I don't know how I would give points for each indices of the list MORE SIMPLY. Can someone please help me? Without being too complicated. Thank you!

    Read the article

  • remove border of a gtk.button

    - by spanctus
    Hi, I want to remove the border of the gtk.button, but i Don't know how to do it. I tried with : button = gtk.Button() button.set_style("inner-border",0) but i have an error : the property doesn't exist. I tried too to create a new gtk.Style and use it for the button, but same error. Anyone has an idea ? Thanks

    Read the article

  • google contacts api service account oauth2.0 sub user

    - by user3709507
    I am trying to use the Google Contacts API to connect to a user's contact information, on my Google apps domain. Generating an access_token using the gdata api's ContactsService clientlogin function while using the API key for my project works fine, but I would prefer to not store the user's credentials, and from the information I have found that method uses OAuth1.0 So, to use OAuth2.0 I have: Generated a Service Account in the developer's console for my project Granted access to the service account for the scope of https://www.google.com/m8/feeds/ in the Google apps domain admin panel Attempted to generate credentials using SignedJwtAssertionCredentials: credentials = SignedJwtAssertionCredentials( service_account_name=service_account_email, private_key=key_from_p12_file, scope='https://www.google.com/m8/feeds/', sub=user_email') The problem I am running into is that attempting to generate an access token using this method fails. It succeeds in generating the token when I remove the sub parameter, but then that token fails when I try to fetch the user's contacts. Does anyone know why this might be happening?

    Read the article

  • Using sqlalchemy to query using multiple column where in clause

    - by crunkchitis
    I'm looking to execute this query using sqlalchemy. SELECT name, age, favorite_color, favorite_food FROM kindergarten_classroom WHERE (favorite_color, favorite_food) IN (('lavender','lentil soup'),('black','carrot juice')); I only want kids that like (lavender AND lentil soup) OR (black and carrot juice). This is similar, but doesn't get me all of the way there: Sqlalchemy in clause

    Read the article

  • Use Regular expression with fileinput

    - by chrissygormley
    Hello, I am trying to replace a variable stored in another file using regular expression. The code I have tried is: r = re.compile(r"self\.uid\s*=\s*('\w{12})'") for line in fileinput.input(['file.py'], inplace=True): print line.replace(r.match(line), sys.argv[1]), The format of the variable in the file is: self.uid = '027FC8EBC2D1' I am trying to pass in a parameter in this format and use regular expression to verify that the sys.argv[1] is correct format and to find the variable stored in this file and replace it with the new variable. Can anyone help. Thanks for the help.

    Read the article

  • Can you change/redirect a django form's function by passing in your own function?

    - by Derek
    I'm dealing with django-paypal and want to change the button src images. So I went the the conf.py file in the source and edited the src destination. However, I really want to leave the source alone, and I noticed that the class PayPalPaymentsForm(forms.Form): has def get_image(self): return { (True, self.SUBSCRIBE): SUBSCRIPTION_SANDBOX_IMAGE, (True, self.BUY): SANDBOX_IMAGE, (True, self.DONATE): DONATION_SANDBOX_IMAGE, (False, self.SUBSCRIBE): SUBSCRIPTION_IMAGE, (False, self.BUY): IMAGE, (False, self.DONATE): DONATION_IMAGE, }[TEST, self.button_type] which handles all the image src destinations. Since changing this def in the source is worse than changing conf, I was wondering if there was a way to pass in customized defs you make like passing in initial arguments in forms? This way no source code is changed, and I can customize the get_image def as much as I need. passing in def something like this? def get_image(self): .... .... paypal = { 'amount': 10, 'item_name': 'test1', 'item_number': 'test1_slug', # PayPal wants a unique invoice ID 'invoice': str(uuid.uuid4()), } form = PayPalPaymentsForm(initial=paypal, get_image) Thanks!

    Read the article

  • SQLAlchemy Expression Language problem

    - by Torkel
    I'm trying to convert this to something sqlalchemy expression language compatible, I don't know if it's possible out of box and are hoping someone more experienced can help me along. The backend is PostgreSQL and if I can't make it as an expression I'll create a string instead. SELECT DISTINCT date_trunc('month', x.x) as date, COALESCE(b.res1, 0) AS res1, COALESCE(b.res2, 0) AS res2 FROM generate_series( date_trunc('year', now() - interval '1 years'), date_trunc('year', now() + interval '1 years'), interval '1 months' ) AS x LEFT OUTER JOIN( SELECT date_trunc('month', access_datetime) AS when, count(NULLIF(resource_id != 1, TRUE)) AS res1, count(NULLIF(resource_id != 2, TRUE)) AS res2 FROM tracking_entries GROUP BY date_trunc('month', access_datetime) ) AS b ON (date_trunc('month', x.x) = b.when) First of all I got a class TrackingEntry mapped to tracking_entries, the select statement within the outer joined can be converted to something like (pseudocode):: from sqlalchemy.sql import func, select from datetime import datetime, timedelta stmt = select([ func.date_trunc('month', TrackingEntry.resource_id).label('when'), func.count(func.nullif(TrackingEntry.resource_id != 1, True)).label('res1'), func.count(func.nullif(TrackingEntry.resource_id != 2, True)).label('res2') ], group_by=[func.date_trunc('month', TrackingEntry.access_datetime), ]) Considering the outer select statement I have no idea how to build it, my guess is something like: outer = select([ func.distinct(func.date_trunc('month', ?)).label('date'), func.coalesce(?.res1, 0).label('res1'), func.coalesce(?.res2, 0).label('res2') ], from_obj=[ func.generate_series( datetime.now(), datetime.now() + timedelta(days=365), timedelta(days=1) ).label(x) ]) Then I suppose I have to link those statements together without using foreign keys: outer.outerjoin(stmt???).??(func.date_trunc('month', ?.?), ?.when) Anyone got any suggestions or even better a solution?

    Read the article

  • class inheretence of a attribute which is itself a class

    - by alex
    i have a class which inherets a attribute from a super-class. this attribute is a class itself. class classA(superClass): def func(self,x): if self.attributeB is None: do somthing and in the other class i have class superClass: self.attributB = classB() i get the error AttributeError: class classA has no attribute 'attributeB' when i access the attribute like i showed but if on command line i can see it works, x = classA() x.attributeB is None True so the test works. whats going on in the above code?

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • How would make this run with an if statement and one for loop?

    - by Nick Jacobs
    I'm trying to get this to run by using an if statment, a for loop, and a list. The list is part of the parameters. I am not sure how to write the if statement and have the program loop through all of the different words and set everything how it is supposed to be. newSndIdx=0; for i in range (8700, 12600+1): sampleValue=getSampleValueAt(sound, i) setSampleValueAt(newSnd, newSndIdx, sampleValue) newSndIdx +=1 newSndIdx=newSndIdx+500 for i in range (15700, 17600+1): sampleValue=getSampleValueAt(sound, i) setSampleValueAt(newSnd, newSndIdx, sampleValue) newSndIdx +=1 newSndIdx=newSndIdx+500 for i in range (18750, 22350+1): sampleValue=getSampleValueAt(sound, i) setSampleValueAt(newSnd, newSndIdx, sampleValue) newSndIdx +=1 newSndIdx=newSndIdx+500 for i in range (23700, 27250+1): sampleValue=getSampleValueAt(sound, i) setSampleValueAt(newSnd, newSndIdx, sampleValue) newSndIdx +=1 newSndIdx=newSndIdx+500 for i in range (106950, 115300+1): sampleValue=getSampleValueAt(sound, i) setSampleValueAt(newSnd, newSndIdx, sampleValue) newSndIdx+=1

    Read the article

< Previous Page | 371 372 373 374 375 376 377 378 379 380 381 382  | Next Page >