Search Results

Search found 13534 results on 542 pages for 'python 3 4'.

Page 373/542 | < Previous Page | 369 370 371 372 373 374 375 376 377 378 379 380  | Next Page >

  • In SqlAlchemy, how to ignore m2m relationship attributes when merge?

    - by ablmf
    There is a m2m relation in my models, User and Role. I want to merge a role, but i DO NOT want this merge has any effect on user and role relation-ship. Unfortunately, for some complicate reason, role.users if not empty. I tried to set role.users = None, but SA complains None is not a list. At this moment, I use sqlalchemy.orm.attributes.del_attribute, but I don't know if it's provided for this purpose.

    Read the article

  • Installing twisted.mail.smtp

    - by user3506985
    I am using Ubuntu 14.04 and trying to install twisted.mail.smtp using the following commnands -sudo add-apt-repository ppa:jesstess/twisted-12.1-testing -sudo apt-get update There are no errors in the installation,but when I specify the command that is from twisted.mail.smtp import ESMTPSenderFactory I am getting the following error Error: ImportError: No module named mail.smtp Please help me out

    Read the article

  • Encoding with url and api

    - by user2950824
    So I have this web app set up and running and it works fine for any username that you request, but when i try http://mrcastelo.pythonanywhere.com/lol/euw/Nazaré, it simply doesnt work - the error that I get on the server is the following: iddata= getJSON(urllolbase+region+urlid+username) #SummonerID UnicodeDecodeError: 'ascii' codec can't decode byte 0xc3 in position 5: ordinal not in range(128) It is annoying me greatly, I've tried some other threads but none of them came to a fix. The api that I am using (www.legendaryapi.com) does accept this because this works. Any idea on how to fix this?

    Read the article

  • Clean Method for a ModelForm in a ModelFormSet made by modelformset_factory

    - by Salyangoz
    I was wondering if my approach is right or not. Assuming the Restaurant model has only a name. forms.py class BaseRestaurantOpinionForm(forms.ModelForm): opinion = forms.ChoiceField(choices=(('yes', 'yes'), ('no', 'no'), ('meh', 'meh')), required=False, )) class Meta: model = Restaurant fields = ['opinion'] views.py class RestaurantVoteListView(ListView): queryset = Restaurant.objects.all() template_name = "restaurants/list.html" def dispatch(self, request, *args, **kwargs): if request.POST: queryset = self.request.POST.dict() #clean here return HttpResponse(json.dumps(queryset), content_type="application/json") def get_context_data(self, **kwargs): context = super(EligibleRestaurantsListView, self).get_context_data(**kwargs) RestaurantFormSet = modelformset_factory( Restaurant,form=BaseRestaurantOpinionForm ) extra_context = { 'eligible_restaurants' : self.get_eligible_restaurants(), 'forms' : RestaurantFormSet(), } context.update(extra_context) return context Basically I'll be getting 3 voting buttons for each restaurant and then I want to read the votes. I was wondering from where/which clean function do I need to call to get something like: { ('3' : 'yes'), ('2' : 'no') } #{ 'restaurant_id' : 'vote' } This is my second/third question so tell me if I'm being unclear. Thanks.

    Read the article

  • How can I load a sql "dump" file into sql alchemy

    - by JudoWill
    I have a large sql dump file ... with multiple CREATE TABLE and INSERT INTO statements. Is there any way to load these all into a SQLAlchemy sqlite database at once. I plan to use the introspected ORM from sqlsoup after I've created the tables. However, when I use the engine.execute() method it complains: sqlite3.Warning: You can only execute one statement at a time. Is there a way to work around this issue. Perhaps splitting the file with a regexp or some kind of parser, but I don't know enough SQL to get all of the cases for the regexp. Any help would be greatly appreciated. Will EDIT: Since this seems important ... The dump file was created with a MySQL database and so it has quite a few commands/syntax that sqlite3 does not understand correctly.

    Read the article

  • SQLAlchemy: who is in charge of the "session"? ( and how to unit-test with sessions )

    - by Nick Perkins
    I need some guidance on how to use session objects with SQLAlchemy, and how to organize Unit Tests of my mapped objects. What I would like to able to do is something like this: thing = BigThing() # mapped object child = thing.new_child() # create and return a related object thing.save() # will also save the child object In order to achieve this, I was thinking of having the BigThing actually add itself ( and it's children ) to the database -- but maybe this not a good idea? One reason to add objects as soon as possible is Automatic id values that are assigned by the database -- the sooner they are available, the fewer problems there are ( right? ) What is the best way to manage session objects? Who is in charge of the session? Should it be created only when required? or saved for a long time? What about Unit Tests for my mapped objects?...how should the session be handled? Is it ever OK to have mapped objects just automatically add themselves to a database? or is that going to lead to trouble?

    Read the article

  • how can i set the key 'blob-key' about BlobStore?

    - by pyleaf
    I use the jquery plugin "uploadify" to upload multiple files to My App(GAE), and then save them with blobstore, but it failed. I debug the code into get_uploads, it seems field.type_options is empty and of course has 'blob-key'. Q: where does the key 'blob-key' come from? thank you!

    Read the article

  • pyramid traversal resource url no attribute __name__

    - by Santana
    So I have: resources.py: def _add(obj, name, parent): obj.__name__ = name obj.__parent__ = parent return obj class Root(object): __parent__ = __name__ = None def __init__(self, request): super(Root, self).__init__() self.request = request self.collection = request.db.post def __getitem__(self, key): if u'profile' in key: return Profile(self.request) class Profile(dict): def __init__(self, request): super(Profile, self).__init__() self.__name__ = u'profile' self.__parent__ = Root self.collection = request.db.posts def __getitem__(self, name): post = Dummy(self.collection.find_one(dict(username=name))) return _add(post, name, self) and I'm using MongoDB and pyramid_mongodb views.py: @view_config(context = Profile, renderer = 'templates/mytemplate.pt') def test_view(request): return {} and in mytemplate.pt: <p tal:repeat='item request.context'> ${item} </p> I can echo what's in the database (I'm using mongodb), but when I provided a URL for each item using resource_url() <p tal:repeat='item request.context'> <a href='${request.resource_url(item)}'>${item}</a> </p> I got an error: 'dict' object has no attribute '__name__', can someone help me?

    Read the article

  • Looping through a directory on the web and displaying its contents (files and other directories) via

    - by al jaffe
    In the same vein as http://stackoverflow.com/questions/2593399/process-a-set-of-files-from-a-source-directory-to-a-destination-directory-in-pyth I'm wondering if it is possible to create a function that when given a web directory it will list out the files in said directory. Something like... files[] for file in urllib.listdir(dir): if file.isdir: # handle this as directory else: # handle as file I assume I would need to use the urllib library, but there doesn't seem to be an easy way of doing this, that I've seen at least.

    Read the article

  • Efficient way to store tuples in the datastore

    - by Drew Sears
    If I have a pair of floats, is it any more efficient (computationally or storage-wise) to store them as a GeoPtProperty than it would be pickle the tuple and store it as a BlobProperty? If GeoPt is doing something more clever to keep multiple values in a single property, can it be leveraged for arbitrary data? Can I store the tuple ("Johnny", 5) in a single entity property in a similarly efficient manner?

    Read the article

  • Union on ValuesQuerySet in django

    - by Wuxab
    I've been searching for a way to take the union of querysets in django. From what I read you can use query1 | query2 to take the union... This doesn't seem to work when using values() though. I'd skip using values until after taking the union but I need to use annotate to take the sum of a field and filter on it and since there's no way to do "group by" I have to use values(). The other suggestions I read were to use Q objects but I can't think of a way that would work. Do I pretty much need to just use straight SQL or is there a django way of doing this? What I want is: q1 = mymodel.objects.filter(date__lt = '2010-06-11').values('field1','field2').annotate(volsum=Sum('volume')).exclude(volsum=0) q2 = mymodel.objects.values('field1','field2').annotate(volsum=Sum('volume')).exclude(volsum=0) query = q1|q2 But this doesn't work and as far as I know I need the "values" part because there's no other way for Sum to know how to act since it's a 15 column table.

    Read the article

  • How to separate comma separeted data from csv file?

    - by Rahul
    I have opened a csv file and I want to sort each string which is comma separeted and are in same line: ex:: file : name,sal,dept tom,10000,it o/p :: each string in string variable I have a file which is already open, so I can not use "open" API, I have to use "csv.reader" which have to read one line at a time.

    Read the article

  • Iterate with binary structure over numpy array to get cell sums

    - by Curlew
    In the package scipy there is the function to define a binary structure (such as a taxicab (2,1) or a chessboard (2,2)). import numpy from scipy import ndimage a = numpy.zeros((6,6), dtype=numpy.int) a[1:5, 1:5] = 1;a[3,3] = 0 ; a[2,2] = 2 s = ndimage.generate_binary_structure(2,2) # Binary structure #.... Calculate Sum of result_array = numpy.zeros_like(a) What i want is to iterate over all cells of this array with the given structure s. Then i want to append a function to the current cell value indexed in a empty array (example function sum), which uses the values of all cells in the binary structure. For example: array([[0, 0, 0, 0, 0, 0], [0, 1, 1, 1, 1, 0], [0, 1, 2, 1, 1, 0], [0, 1, 1, 0, 1, 0], [0, 1, 1, 1, 1, 0], [0, 0, 0, 0, 0, 0]]) # The array a. The value in cell 1,2 is currently one. Given the structure s and an example function such as sum the value in the resulting array (result_array) becomes 7 (or 6 if the current cell value is excluded). Someone got an idea?

    Read the article

  • methods of metaclasses on class instances.

    - by Stefano Borini
    I was wondering what happens to methods declared on a metaclass. I expected that if you declare a method on a metaclass, it will end up being a classmethod, however, the behavior is different. Example >>> class A(object): ... @classmethod ... def foo(cls): ... print "foo" ... >>> a=A() >>> a.foo() foo >>> A.foo() foo However, if I try to define a metaclass and give it a method foo, it seems to work the same for the class, not for the instance. >>> class Meta(type): ... def foo(self): ... print "foo" ... >>> class A(object): ... __metaclass__=Meta ... def __init__(self): ... print "hello" ... >>> >>> a=A() hello >>> A.foo() foo >>> a.foo() Traceback (most recent call last): File "<stdin>", line 1, in <module> AttributeError: 'A' object has no attribute 'foo' What's going on here exactly ? edit: bumping the question

    Read the article

  • Validating key/certificate pairs with M2Crypto when a certificate chain is needed

    - by Charles Duffy
    M2Crypto.X509.X509 objects have a verify(pkey) method, which provide a means of testing that a given certificate does in fact sign a specified key. This is a good and useful thing -- except that sometimes the certificate I want to verify in this way is invalid without the use of an intermediate certificate, which this API does not appear to allow a way to specify. Is there an alternate means of validating a certificate / private key pair which will work even when the certificate is unable to stand alone?

    Read the article

  • Setting up relations/mappings for a SQLAlchemy many-to-many database

    - by Brent Ramerth
    I'm new to SQLAlchemy and relational databases, and I'm trying to set up a model for an annotated lexicon. I want to support an arbitrary number of key-value annotations for the words which can be added or removed at runtime. Since there will be a lot of repetition in the names of the keys, I don't want to use this solution directly, although the code is similar. My design has word objects and property objects. The words and properties are stored in separate tables with a property_values table that links the two. Here's the code: from sqlalchemy import Column, Integer, String, Table, create_engine from sqlalchemy import MetaData, ForeignKey from sqlalchemy.orm import relation, mapper, sessionmaker from sqlalchemy.ext.declarative import declarative_base engine = create_engine('sqlite:///test.db', echo=True) meta = MetaData(bind=engine) property_values = Table('property_values', meta, Column('word_id', Integer, ForeignKey('words.id')), Column('property_id', Integer, ForeignKey('properties.id')), Column('value', String(20)) ) words = Table('words', meta, Column('id', Integer, primary_key=True), Column('name', String(20)), Column('freq', Integer) ) properties = Table('properties', meta, Column('id', Integer, primary_key=True), Column('name', String(20), nullable=False, unique=True) ) meta.create_all() class Word(object): def __init__(self, name, freq=1): self.name = name self.freq = freq class Property(object): def __init__(self, name): self.name = name mapper(Property, properties) Now I'd like to be able to do the following: Session = sessionmaker(bind=engine) s = Session() word = Word('foo', 42) word['bar'] = 'yes' # or word.bar = 'yes' ? s.add(word) s.commit() Ideally this should add 1|foo|42 to the words table, add 1|bar to the properties table, and add 1|1|yes to the property_values table. However, I don't have the right mappings and relations in place to make this happen. I get the sense from reading the documentation at http://www.sqlalchemy.org/docs/05/mappers.html#association-pattern that I want to use an association proxy or something of that sort here, but the syntax is unclear to me. I experimented with this: mapper(Word, words, properties={ 'properties': relation(Property, secondary=property_values) }) but this mapper only fills in the foreign key values, and I need to fill in the other value as well. Any assistance would be greatly appreciated.

    Read the article

  • has any tools easy to download or uploaed data from gae ..

    - by zjm1126
    i find this: http://aralbalkan.com/1784 but it is : Gaebar is an easy-to-use, standalone Django application that you can plug in to your existing Google App Engine Django or app-engine-patch-based Django applications on Google App Engine to give them datastore backup and restore functionality. my app is not based on django,so did you know any tools esay to do this . thanks

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • beautifulsoup can't find exist href in file

    - by young001
    I have a html file like following: <form action="/2811457/follow?gsid=3_5bce9b871484d3af90c89f37" method="post"> <div> <a href="/2811457/follow?page=2&amp;gsid=3_5bce9b871484d3af90c89f37">next_page</a> &nbsp;<input name="mp" type="hidden" value="3" /> <input type="text" name="page" size="2" style='-wap-input-format: "*N"' /> <input type="submit" value="jump" />&nbsp;1/3 </div> </form> how to extract the "1/3" from the file? It is a part of html,I intend to make it clear. When I use beautifulsoup, I'm new to beautifulsoup,and I have look the document,but still confused. how to extract"1/3" from the html file? total_urls_num = soup.find(re.compile('.*/d\//d.*')) doesn't work As JBernardo said,\d should be a number,When I change to .*\d/\d.*,it doesn't work too. my code: from BeautifulSoup import BeautifulSoup import re with open("html.txt","r") as f: response = f.read() print response soup = BeautifulSoup(response) delete_urls = soup.findAll('a', href=re.compile('follow\?page')) #works print delete_urls #total_urls_num = soup.find(re.compile('.*\d/\d.*')) total_urls_num = soup.find('input',style='submit') #can't work print total_urls_num

    Read the article

  • Parsing html for domain links

    - by Hallik
    I have a script that parses an html page for all the links within it. I am getting all of them fine, but I have a list of domains I want to compare it against. So a sample list contains list=['www.domain.com', 'sub.domain.com'] But I may have a list of links that look like http://domain.com http://sub.domain.com/some/other/page I can strip off the http:// just fine, but in the two example links I just posted, they both should match. The first I would like to match against the www.domain.com, and the second, I would like to match against the subdomain in the list. Right now I am using url2lib for parsing the html. What are my options in completely this task?

    Read the article

  • Creating a custom widget using django for use on external sites

    - by ajt
    I have a new site that I am putting together and part of it has statistics for the site's users. I would like to create a widget that others can use on another website by invoking javascript that reads data from my server and shows that statistics for a given user, but I am having a hard time finding specific tutorials that covers this in django. I have seen the link at Alex Maradon's site [0], but it looks to me like that is passing html back to the widget and I am having a hard time figuring out how to do this using something like xml. Are there any django apps for doing this or does anyone know of good how-tos? [0] http://alexmarandon.com/articles/web_widget_jquery/

    Read the article

  • Rearranging a sequence

    - by sarah
    I'm have trouble rearranging sequences so the amount of letters in the given original sequence are the same in the random generated sequences. For example: If i have a string 'AAAC' I need that string rearranged randomly so the amount of A's and C's are the same.

    Read the article

  • Estimating the boundary of arbitrarily distributed data

    - by Dave
    I have two dimensional discrete spatial data. I would like to make an approximation of the spatial boundaries of this data so that I can produce a plot with another dataset on top of it. Ideally, this would be an ordered set of (x,y) points that matplotlib can plot with the plt.Polygon() patch. My initial attempt is very inelegant: I place a fine grid over the data, and where data is found in a cell, a square matplotlib patch is created of that cell. The resolution of the boundary thus depends on the sampling frequency of the grid. Here is an example, where the grey region are the cells containing data, black where no data exists. OK, problem solved - why am I still here? Well.... I'd like a more "elegant" solution, or at least one that is faster (ie. I don't want to get on with "real" work, I'd like to have some fun with this!). The best way I can think of is a ray-tracing approach - eg: from xmin to xmax, at y=ymin, check if data boundary crossed in intervals dx y=ymin+dy, do 1 do 1-2, but now sample in y An alternative is defining a centre, and sampling in r-theta space - ie radial spokes in dtheta increments. Both would produce a set of (x,y) points, but then how do I order/link neighbouring points them to create the boundary? A nearest neighbour approach is not appropriate as, for example (to borrow from Geography), an isthmus (think of Panama connecting N&S America) could then close off and isolate regions. This also might not deal very well with the holes seen in the data, which I would like to represent as a different plt.Polygon. The solution perhaps comes from solving an area maximisation problem. For a set of points defining the data limits, what is the maximum contiguous area contained within those points To form the enclosed area, what are the neighbouring points for the nth point? How will the holes be treated in this scheme - is this erring into topology now? Apologies, much of this is me thinking out loud. I'd be grateful for some hints, suggestions or solutions. I suspect this is an oft-studied problem with many solution techniques, but I'm looking for something simple to code and quick to run... I guess everyone is, really! Cheers, David

    Read the article

< Previous Page | 369 370 371 372 373 374 375 376 377 378 379 380  | Next Page >