Search Results

Search found 10838 results on 434 pages for 'adf task flow'.

Page 381/434 | < Previous Page | 377 378 379 380 381 382 383 384 385 386 387 388  | Next Page >

  • Get active window title in X

    - by dutt
    I'm trying to get the title of the active window. The application is a background task so if the user has Eclipse open the function returns "Eclipse - blabla", so it's not getting the window title of my own window. I'm developing this in Python 2.6 using PyQt4. My current solution, borrowed and slightly modified from an old answer here at SO, looks like this: def get_active_window_title(): title = '' root_check = '' root = Popen(['xprop', '-root'], stdout=PIPE) if root.stdout != root_check: root_check = root.stdout for i in root.stdout: if '_NET_ACTIVE_WINDOW(WINDOW):' in i: id_ = i.split()[4] id_w = Popen(['xprop', '-id', id_], stdout=PIPE) for j in id_w.stdout: if 'WM_ICON_NAME(STRING)' in j: if title != j.split()[2]: return j.split("= ")[1].strip(' \n\"') It works for most windows, but not all. For example it can't find my kopete chat windows, or the name of the application i'm currently developing. My next try looks like this: def get_active_window_title(self): screen = wnck.screen_get_default() if screen == None: return "Could not get screen" window = screen.get_active_window() if window == None: return "Could not get window" title = window.get_name() return title; But for some reason window is always None. Does somebody have a better way of getting the current window title, or how to modify one of my ways, that works for all windows? Edit: In case anybody is wondering this is the way I found that seems to work for all windows. def get_active_window_title(self): root_check = '' root = Popen(['xprop', '-root'], stdout=PIPE) if root.stdout != root_check: root_check = root.stdout for i in root.stdout: if '_NET_ACTIVE_WINDOW(WINDOW):' in i: id_ = i.split()[4] id_w = Popen(['xprop', '-id', id_], stdout=PIPE) id_w.wait() buff = [] for j in id_w.stdout: buff.append(j) for line in buff: match = re.match("WM_NAME\((?P<type>.+)\) = (?P<name>.+)", line) if match != None: type = match.group("type") if type == "STRING" or type == "COMPOUND_TEXT": return match.group("name") return "Active window not found"

    Read the article

  • Controller actions appear to be synchronous though on different requests?

    - by Oded
    I am under the impression that the below code should work asynchronously. However, when I am looking at firebug, I see the requests fired asynchronously, but the results coming back synchronously: Controller: [HandleError] public class HomeController : Controller { public ActionResult Status() { return Content(Session["status"].ToString()); } public ActionResult CreateSite() { Session["status"] += "Starting new site creation"; Thread.Sleep(20000); // Simulate long running task Session["status"] += "<br />New site creation complete"; return Content(string.Empty); } } Javascript/jQuery: $(document).ready(function () { $.ajax({ url: '/home/CreateSite', async: true, success: function () { mynamespace.done = true; } }); setTimeout(mynamespace.getStatus, 2000); }); var mynamespace = { counter: 0, done: false, getStatus: function () { $('#console').append('.'); if (mynamespace.counter == 4) { mynamespace.counter = 0; $.ajax({ url: '/home/Status', success: function (data) { $('#console').html(data); } }); } if (!mynamespace.done) { mynamespace.counter++; setTimeout(mynamespace.getStatus, 500); } } } Addtional information: IIS 7.0 Windows 2008 R2 Server Running in a VMWare virutual machine Can anyone explain this? Shouldn't the Status action be returning practically immediately instead of waiting for CreateSite to finish? Edit: How can I get the long running process to kick off and still get status updates?

    Read the article

  • Slow query. Wrong database structure?

    - by Tin
    I have a database with table that contains tasks. Tasks have a lifecycle. The status of the task's lifecycle can change. These state transitions are stored in a separate table tasktransitions. Now I wrote a query to find all open/reopened tasks and recently changed tasks but I already see with a rather small number of tasks (<1000) that execution time has becoming very long (0.5s). Tasks +-------------+---------+------+-----+---------+----------------+ | Field | Type | Null | Key | Default | Extra | +-------------+---------+------+-----+---------+----------------+ | taskid | int(11) | NO | PRI | NULL | auto_increment | | description | text | NO | | NULL | | +-------------+---------+------+-----+---------+----------------+ Tasktransitions +------------------+-----------+------+-----+-------------------+----------------+ | Field | Type | Null | Key | Default | Extra | +------------------+-----------+------+-----+-------------------+----------------+ | tasktransitionid | int(11) | NO | PRI | NULL | auto_increment | | taskid | int(11) | NO | MUL | NULL | | | status | int(11) | NO | MUL | NULL | | | description | text | NO | | NULL | | | userid | int(11) | NO | | NULL | | | transitiondate | timestamp | NO | | CURRENT_TIMESTAMP | | +------------------+-----------+------+-----+-------------------+----------------+ Query SELECT tasks.taskid,tasks.description,tasklaststatus.status FROM tasks LEFT OUTER JOIN ( SELECT tasktransitions.taskid,tasktransitions.transitiondate,tasktransitions.status FROM tasktransitions INNER JOIN ( SELECT taskid,MAX(transitiondate) AS lasttransitiondate FROM tasktransitions GROUP BY taskid ) AS tasklasttransition ON tasklasttransition.lasttransitiondate=tasktransitions.transitiondate AND tasklasttransition.taskid=tasktransitions.taskid ) AS tasklaststatus ON tasklaststatus.taskid=tasks.taskid WHERE tasklaststatus.status IS NULL OR tasklaststatus.status=0 or tasklaststatus.transitiondate>'2013-09-01'; I'm wondering if the database structure is best choice performance wise. Could adding indexes help? I already tried to add some but I don't see great improvements. +-----------------+------------+----------------+--------------+------------------+-----------+-------------+----------+--------+------+------------+---------+---------------+ | Table | Non_unique | Key_name | Seq_in_index | Column_name | Collation | Cardinality | Sub_part | Packed | Null | Index_type | Comment | Index_comment | +-----------------+------------+----------------+--------------+------------------+-----------+-------------+----------+--------+------+------------+---------+---------------+ | tasktransitions | 0 | PRIMARY | 1 | tasktransitionid | A | 896 | NULL | NULL | | BTREE | | | | tasktransitions | 1 | taskid_date_ix | 1 | taskid | A | 896 | NULL | NULL | | BTREE | | | | tasktransitions | 1 | taskid_date_ix | 2 | transitiondate | A | 896 | NULL | NULL | | BTREE | | | | tasktransitions | 1 | status_ix | 1 | status | A | 3 | NULL | NULL | | BTREE | | | +-----------------+------------+----------------+--------------+------------------+-----------+-------------+----------+--------+------+------------+---------+---------------+ Any other suggestions?

    Read the article

  • What is the best way to find a processed memory allocations in terms of C# objects

    - by Shantaram
    I have written various C# console based applications, some of them long running some not, which can over time have a large memory foot print. When looking at the windows perofrmance monitor via the task manager, the same question keeps cropping up in my mind; how do I get a break down of the number objects by type that are contributing to this footprint; and which of those are f-reachable and those which aren't and hence can be collected. On numerous occasions I've performed a code inspection to ensure that I am not unnecessarily holding on objects longer than required and disposing of objects with the using construct. I have also recently looked at employing the CG.Collect method when I have released a large number of objects (for example held in a collection which has just been cleared). However, I am not so sure that this made that much difference, so I threw that code away. I am guessing that there are tools in sysinternals suite than can help to resolve these memory type quiestions but I am not sure which and how to use them. The alternative would be to pay for a third party profiling tool such as JetBrains dotTrace; but I need to make sure that I've explored the free options first before going cap in hand to my manager.

    Read the article

  • How do you clear your mind after 8-10 hours per day of coding?

    - by Bryan
    Related Question- Ways to prepare your mind before coding?. I'm having a hard time taking my mind off of work projects in my personal time. It's not that I have a stressful job or tight deadlines; I love my job. I find that after spending the whole day writing code & trying to solve problems, I have an extremely hard time getting it out of my mind. I'm constantly thinking about the current project/problem/task all the time. It's keeping me from relaxing, and in the long run it just builds stress. Personal projects help to some extent, but mostly just to distract me. I still have source code bouncing around my head 16 hours a day. I'm still relatively new to the workforce. Have you struggled with this, perhaps as a young developer? How did you overcome it? Can anyone offer general advice on winding down after a long programming session?

    Read the article

  • Dynamic table memory usage

    - by Dan
    I use a dynamic table: <html> <body> <button id="button">Build table</button> <div id="container"> <script type="text/javascript"> window.onload=function(){ var table = null; var row = "<tr><td>111111111111111111111111111111111111111111111111111111</td>" + "<td>222222222222222222222222222222222222222222222222222222</td>" + "<td>333333333333333333333333333333333333333333333333333333</td></tr>"; var data = null; for (var i = 0; i < 2000; i++){ data += row; } var obj = document.getElementById("button"); obj.onclick=function buildTable(){ document.getElementById("container").innerHTML = "<div><table><tbody>" + data + "</tbody></table></div>"; }; }; </script> </body> </html> Using chromes task manager, each time new data is loaded the memory usage increases considerably and doesn't go down, so after some time the app consumes a lot of memory and requires the browser to be closed. Is there any change in the code I can use to solve this or is it a browser side problem?

    Read the article

  • How to handle Win+Shift+LEft/Right on Win7 with custom WM_GETMINMAXINFO logic?

    - by Steven Robbins
    I have a custom windows implementation in a WPF app that hooks WM_GETMINMAXINFO as follows: private void MaximiseWithTaskbar(System.IntPtr hwnd, System.IntPtr lParam) { MINMAXINFO mmi = (MINMAXINFO)Marshal.PtrToStructure(lParam, typeof(MINMAXINFO)); System.IntPtr monitor = MonitorFromWindow(hwnd, MONITOR_DEFAULTTONEAREST); if (monitor != System.IntPtr.Zero) { MONITORINFO monitorInfo = new MONITORINFO(); GetMonitorInfo(monitor, monitorInfo); RECT rcWorkArea = monitorInfo.rcWork; RECT rcMonitorArea = monitorInfo.rcMonitor; mmi.ptMaxPosition.x = Math.Abs(rcWorkArea.left - rcMonitorArea.left); mmi.ptMaxPosition.y = Math.Abs(rcWorkArea.top - rcMonitorArea.top); mmi.ptMaxSize.x = Math.Abs(rcWorkArea.right - rcWorkArea.left); mmi.ptMaxSize.y = Math.Abs(rcWorkArea.bottom - rcWorkArea.top); mmi.ptMinTrackSize.x = Convert.ToInt16(this.MinWidth * (desktopDpiX / 96)); mmi.ptMinTrackSize.y = Convert.ToInt16(this.MinHeight * (desktopDpiY / 96)); } Marshal.StructureToPtr(mmi, lParam, true); } It all works a treat and it allows me to have a borderless window maximized without having it sit on to of the task bar, which is great, but it really doesn't like being moved between monitors with the new Win7 keyboard shortcuts. Whenever the app is moved with Win+Shift+Left/Right the WM_GETMINMAXINFO message is received, as I'd expect, but MonitorFromWindow(hwnd, MONITOR_DEFAULTTONEAREST) returns the monitor the application has just been moved FROM, rather than the monitor it is moving TO, so if the monitors are of differing resolutions the window end up the wrong size. I'm not sure if there's something else I can call, other then MonitorFromWindow, or whether there's a "moving monitors" message I can hook prior to WM_GETMINMAXINFO. I'm assuming there is a way to do it because "normal" windows work just fine.

    Read the article

  • Can one connection get details of another? Or, how can I get the most detailed pending transaction

    - by bob-the-destroyer
    Is there a Mysql statement which provides full details of any other open connection or user? For this particular case, on myisam tables specifically. Looking at Mysql's SHOW TABLE STATUS documentation, it's missing some very important information for my purpose. For example: remote odbc connection one is inserting several thousand records, which due to a slow connection speed can take up to an hour. Tcp connection two, using PHP on the server's localhost, is running select queries with aggregate functions on that data. Before allowing connection two to run those queries, I'd like connection two to first check to make sure there's no pending inserts on any other connection on those specific tables so it can instead wait until all data is available. If the table is currently being written to, I'd like to spit back to the user of connection two an approximation of how much longer to wait based on the number of pending inserts. Ideally by table, I'd like to get back using a query the timestamp when connection one began the write, total inserts left to be done, and total inserts already completed. Instead of insert counts, even knowing number of bytes written and left to write would work just fine here. Obviously since connection two is a tcp connection via a PHP script, all I can really use in that script is some sort of query. I suppose if I have to, since it is on localhost, I can exec() it if the only way is by a mysql command line option that outputs this info, but I'd rather not. I suppose I could simply update a custom-made transaction log before and after this massive insert task which the PHP script can check, but hopefully there's already a built-in Mysql feature I can take advantage of.

    Read the article

  • Database choices

    - by flobadob
    I have a prickly design issue regarding the choice of database technologies to use for a group of new applications. The final suite of applications would have the following database requirements... Central databases (more than one database) using mysql (myst be mysql due to justhost.com). An application to be written which accesses the multiple mysql databases on the web host. This application will also write to local serverless database (sqlite/firebird/vistadb/whatever). Different flavors of this application will be created for windows (.NET), windows mobile, android if possible, iphone if possible. So, the design task is to minimise the quantity of code to achieve this. This is going to be tricky since the languages used are already c# / java (android) and objc (iphone). Not too worried about that, but can the work required to implement the various database access layers be minimised? The serverless database will hold similar data to the mysql server, so some kind of inheritance in the DAL would be useful. Looking at hibernate/nhibernate and there is linq to whatever. So many choices!

    Read the article

  • Is there a recommended way to communicate scientific/engineering programming to C developers?

    - by ggkmath
    Hi, I have a lot of MATLAB code that needs to get ported to C (execution speed is critical for this work) as part of a back-end process for a web application. When I attempt to outsource this code to a C developer, I assume (correct me if I'm wrong) few C developers also understand MATLAB code (things like indexing and memory management are different, etc.). I wonder if there are any C developers out there that can recommend a procedure for me to follow to best communicate what the code does? For example, should I provide the MATLAB code and explain what it's doing line by line? Or, should I just provide the math/algorithm, explain it in plain English, and let the C developer implement it with this understanding in his/her own way (e.g. can I assume the developer understands how to work with complex math (i.e. imaginary numbers), how to generate histograms, perform an FFT, etc.)? Or, is there a better method? I expect I'm not the first to need to do this, so I wonder if any C developers out there ran into this situation and can share any conventional wisdom how they'd like this task to be transferred? Thanks in advance for any comments.

    Read the article

  • What about parallelism across network using multiple PCs?

    - by MainMa
    Parallel computing is used more and more, and new framework features and shortcuts make it easier to use (for example Parallel extensions which are directly available in .NET 4). Now what about the parallelism across network? I mean, an abstraction of everything related to communications, creation of processes on remote machines, etc. Something like, in C#: NetworkParallel.ForEach(myEnumerable, () => { // Computing and/or access to web ressource or local network database here }); I understand that it is very different from the multi-core parallelism. The two most obvious differences would probably be: The fact that such parallel task will be limited to computing, without being able for example to use files stored locally (but why not a database?), or even to use local variables, because it would be rather two distinct applications than two threads of the same application, The very specific implementation, requiring not just a separate thread (which is quite easy), but spanning a process on different machines, then communicating with them over local network. Despite those differences, such parallelism is quite possible, even without speaking about distributed architecture. Do you think it will be implemented in a few years? Do you agree that it enables developers to easily develop extremely powerfull stuff with much less pain? Example: Think about a business application which extracts data from the database, transforms it, and displays statistics. Let's say this application takes ten seconds to load data, twenty seconds to transform data and ten seconds to build charts on a single machine in a company, using all the CPU, whereas ten other machines are used at 5% of CPU most of the time. In a such case, every action may be done in parallel, resulting in probably six to ten seconds for overall process instead of forty.

    Read the article

  • Hundreds of custom UserControls create thousands of USER Objects

    - by Andy Blackman
    I'm creating a dashboard application that shows hundreds of "items" on a FlowLayoutPanel. Each "item" is a UserControl that is made up of 12 or labels. My app queries a database and then creates an "item" instance for each record, populating ethe labels and textboxes with data before adding it to the FlowLayoutPanel. After adding about 560 items to the panel, I noticed that the USER Objects count in my Task Manager had gone up to about 7300, which was much much larger than any other app on my machine. I did a quick spot of mental arithmetic (OK, I might have used calc.exe) and figured that 560 * 13 (12 labels plus the UserControl itself) is 7280. So that suddenly gave away where all the objects were coming from... Knowing that there is a 10,000 USER object limit before windows throws in the towel, I'm trying to figure better ways of drawing these items onto the FlowLayoutPanel. My ideas so far are as follows: 1) User-draw the "item", using graphics.DrawText and DrawImage in place of many of the labels. I'm hoping that this will mean 1 item = 1 USER Object, not 13. 2) Have 1 instance of the "item", then for each record, populate the instance and use the Control.DrawToBitmap() method to grab an image and then use that in the FlowLayoutPanel (or similar) So... Does anyone have any other suggestions ??? P.S. It's a zoomable interface, so I have already ruled out "Paging" as there is a requirement to see all items at once :( Thanks everyone.

    Read the article

  • Oracle 10.1 and 11.2 produce different XML using the same statement

    - by MindFyer
    I am migrating a database from Oracle 10.1 to 11.2 and I have the following problem. The statement SELECT '<?xml version="1.0" encoding="utf-8" ?>' || (Xml).getClobVal() AS XmlClob FROM ( SELECT XmlElement( "Element1", ( SELECT XmlAgg(tpx.Xml) FROM ( SELECT XmlElement("Element3",XmlForest('content' as Element4)) AS Xml FROM dual ) tpx ) AS "Element2" ) AS Xml FROM dual ) On the original 10.1 database produces XML like this... <?xml version="1.0" encoding="utf-8"?> <Element1> <Element2> <Element3> <ELEMENT4>content</ELEMENT4> </Element3> </Element2> </Element1> On the new 11.2 system it looks like this... <?xml version="1.0" encoding="utf-8"?> <Element1> <Element3> <ELEMENT4>content</ELEMENT4> </Element3> </Element1> Is there some environmental variable I am missing that tells Oracle how to format its XML. There are hundreds of thousands of lines of PL/SQL in the database; it would be a mammoth task to rewrite if it turned out they had changed they way Oracle formats XML between versions. Hopefully someone has come accross this before. Thanks

    Read the article

  • Compromising design & code quality to integrate with existing modules

    - by filip-fku
    Greetings! I inherited a C#.NET application I have been extending and improving for a while now. Overall it was obviously a rush-job (or whoever wrote it was seemingly less competent than myself). The app pulls some data from an embedded device & displays and manipulates it. At the core is a communications thread in the main application form which executes a 600+ lines of code method which calls functions all over the place, implementing a state machine - lots of if-state-then-do type code. Interaction with the device is done by setting the state/mode globally and letting the thread do it's thing. (This is just one example of the badness of the code - overall it is not very OO-like, it reminds of the style of embedded C code the device firmware is written in). My problem is that this piece of code is central to the application. The software, communications protocol or device firmware are not documented at all. Obviously to carry on with my work I have to interact with this code. What I would like some guidance on, is whether it is worth scrapping this code & trying to piece together something more reasonable from the information I can reverse engineer? I can't decide! The reason I don't want to refactor is because the code already works, and changing it will surely be a long, laborious and unpleasant task. On the flip side, not refactoring means I have to sometimes compromise the design of other modules so that I may call my code from this state machine! I've heard of "If it ain't broke don't fix it!", so I am wondering if it should apply when "it" is influencing the design of future code! Any advice would be appreciated! Thanks!

    Read the article

  • MACRO compilation PROBLEM

    - by wildfly
    i was given a primitive task to find out (and to put in cl) how many nums in an array are bigger than the following ones, (meaning if (arr[i] arr[i+1]) count++;) but i've problems as it has to be a macro. i am getting errors from TASM. can someone give me a pointer? SortA macro a, l LOCAL noes irp reg, <si,di,bx> push reg endm xor bx,bx xor si,si rept l-1 ;;also tried rept 3 : wont' compile mov bl,a[si] inc si cmp bl,arr[si] jb noes inc di noes: add di,0 endm mov cx,di irp reg2, <bx,di,si> pop reg2 endm endm dseg segment arr db 10,9,8,7 len = 4 dseg ends sseg segment stack dw 100 dup (?) sseg ends cseg segment assume ds:dseg, ss:sseg, cs:cseg start: mov ax, dseg mov ds,ax sortA arr,len cseg ends end start errors: Assembling file: sorta.asm **Error** sorta.asm(51) REPT(4) Expecting pointer type **Error** sorta.asm(51) REPT(6) Symbol already different kind: NOES **Error** sorta.asm(51) REPT(10) Expecting pointer type **Error** sorta.asm(51) REPT(12) Symbol already different kind: NOES **Error** sorta.asm(51) REPT(16) Expecting pointer type **Error** sorta.asm(51) REPT(18) Symbol already different kind: NOES Error messages: 6

    Read the article

  • How to exclude tags folder from triggering build in Teamcity?

    - by Jaya mareedu
    Hello, I recently installed Teamcity 5.0.3. I am trying to setup automated build for a .NET 2.0 VS2005 project. I use NAnt and MSBuild task to perform the build. The project structure is a typical SVN structure svn://localhost/ITools is my repository and the project structure is VisualTrack trunk branches tags I created a new project in Teamcity and then created a build configuration for that project. I asked it to kick off a build everytime there is a change detected in SVN VisualTrack VCS. I also configured it to create a label in VisualTrack/tags for every successful build. The problem I am running into is that the build is getting trigerred everytime teamcity is creating a new label under tags. I only want the build to be triggered if some developer commits his or her changes into trunk. Next step I took was to create a build trigger rule to exclude the tags path by specifying a trigger pattern as -:VisualTrack/tags/**, but looks like its not working. I believe the pattern I specified is not correct. Can someone please help me resolve this issue? Thanks, Jaya.

    Read the article

  • Vim: change formatting of variables in a script

    - by sixtyfootersdude
    I am using vim to edit a shell script (did not use the right coding standard). I need to change all of my variables from camel-hum-notation startTime to caps-and-underscore-notation START_TIME. I do not want to change the way method names are represented. I was thinking one way to do this would be to write a function and map it to a key. The function could do something like generating this on the command line: s/<word under cursor>/<leave cursor here to type what to replace with> I think that this function could be applyable to other situations which would be handy. Two questions: Question 1: How would I go about creating that function. I have created functions in vim before the biggest thing I am clueless about is how to capture movement. Ie if you press dw in vim it will delete the rest of a word. How do you capture that? Also can you leave an uncompleted command on the vim command line? Question 2: Got a better solution for me? How would you approach this task?

    Read the article

  • What Test Environment Setup do Top Project Committers Use in the Ruby Community?

    - by viatropos
    Today I am going to get as far as I can setting up my testing environment and workflow. I'm looking for practical advice on how to setup the test environment from you guys who are very passionate and versed in Ruby Testing. By the end of the day (6am PST?) I would like to be able to: Type one 1-command to run test suites for ANY project I find on Github. Run autotest for ANY Github project so I can fork and make TESTABLE contributions. Build gems from the ground up with Autotest and Shoulda. For one reason or another, I hardly ever run tests for projects I clone from Github. The major reason is because unless they're using RSpec and have a Rake task to run the tests, I don't see the common pattern behind it all. I have built 3 or 4 gems writing tests with RSpec, and while I find the DSL fun, it's less than ideal because it just adds another layer/language of methods I have to learn and remember. So I'm going with Shoulda. But this isn't a question about which testing framework to choose. So the questions are: What is your, the SO reader and Github project committer, test environment setup using autotest so that whenever you git clone a gem, you can run the tests and autotest-develop them if desired? What are the guys who are writing the Paperclip Tests and Authlogic Tests doing? What is their setup? Thanks for the insight. Looking for answers that will make me a more effective tester.

    Read the article

  • is it possible to write a program which prints its own source code utilizing a "sequence-generating-

    - by guest
    is it possible to write a program which prints its own source code utilizing a "sequence-generating-function"? what i call a sequence-generating-function is simply a function which returns a value out of a specific interval (i.e. printable ascii-charecters (32-126)). the point now is, that this generated sequence should be the programs own source-code. as you see, implementing a function which returns an arbitrary sequence is really trivial, but since the returned sequence must contain the implementation of the function itself it is a highly non-trivial task. this is how such a program (and its corresponding output) could look like #include <stdio.h> int fun(int x) { ins1; ins2; ins3; . . . return y; } int main(void) { int i; for ( i=0; i<size of the program; i++ ) { printf("%c", fun(i)); } return 0; } i personally think it is not possible, but since i don't know very much about the underlying matter i posted my thoughts here. i'm really looking forward to hear some opinions!

    Read the article

  • How to detect a Socket disconnection?

    - by AngryHacker
    I've implemented a task using the async Sockets pattern in Silverlight 3. I started with Michael Schwarz's implementation and built on top of that. So basically, my Silverlight app establishes a persistent socket connection to a device and then data flows both ways as necessary between the device and the Silverlight app. One thing I am struggling with is how to detect disconnection. I could think of 2 approaches: Keep-Alive. I know this can be done at the Sockets level, but I am not sure how to do this in an async model. How would the Socket class let me know there has been a disconnection. Manual keep alive. Basically, I am having the Silverlight app send a dummy packet every 20 seconds or so. If it fails, I'd assume disconnection. However, incredibly, SocketAsyncEventArgs.SocketError always reports success, even if I simply unplug the device that the Silverlight app is connected to. I am not sure whether this is a bug or what or perhaps I need to upgrade to SL4. Any ideas, direction or implementation would be appreciated.

    Read the article

  • lapply slower than for-loop when used for a BiomaRt query. Is that expected?

    - by ptocquin
    I would like to query a database using BiomaRt package. I have loci and want to retrieve some related information, let say description. I first try to use lapply but was surprise by the time needed for the task to be performed. I thus tried a more basic for-loop and get a faster result. Is that expected or is something wrong with my code or with my understanding of apply ? I read other posts dealing with *apply vs for-loop performance (Here, for example) and I was aware that improved performance should not be expected but I don't understand why performance here is actually lower. Here is a reproducible example. 1) Loading the library and selecting the database : library("biomaRt") athaliana <- useMart("plants_mart_14") athaliana <- useDataset("athaliana_eg_gene",mart=athaliana) 2) Querying the database : loci <- c("at1g01300", "at1g01800", "at1g01900", "at1g02335", "at1g02790", "at1g03220", "at1g03230", "at1g04040", "at1g04110", "at1g05240" ) I create a function for the use in lapply : foo <- function(loci) { getBM("description","tair_locus",loci,athaliana) } When I use this function on the first element : > system.time(foo(cwp_loci[1])) utilisateur système écoulé 0.020 0.004 1.599 When I use lapply to retrieve the data for all values : > system.time(lapply(loci, foo)) utilisateur système écoulé 0.220 0.000 16.376 I then created a new function, adding a for-loop : foo2 <- function(loci) { for (i in loci) { getBM("description","tair_locus",loci[i],athaliana) } } Here is the result : > system.time(foo2(loci)) utilisateur système écoulé 0.204 0.004 10.919 Of course, this will be applied to a big list of loci, so the best performing option is needed. I thank you for assistance. EDIT Following recommendation of @MartinMorgan Simply passing the vector loci to getBM greatly improves the query efficiency. Simpler is better. > system.time(lapply(loci, foo)) utilisateur système écoulé 0.236 0.024 110.512 > system.time(foo2(loci)) utilisateur système écoulé 0.208 0.040 116.099 > system.time(foo(loci)) utilisateur système écoulé 0.028 0.000 6.193

    Read the article

  • do the Python libraries have a natural dependence on the global namespace?

    - by msw
    I first ran into this when trying to determine the relative performance of two generators: t = timeit.repeat('g.get()', setup='g = my_generator()') So I dug into the timeit module and found that the setup and statement are evaluated with their own private, initially empty namespaces so naturally the binding of g never becomes accessible to the g.get() statement. The obvious solution is to wrap them into a class, thus adding to the global namespace. I bumped into this again when attempting, in another project, to use the multiprocessing module to divide a task among workers. I even bundled everything nicely into a class but unfortunately the call pool.apply_async(runmc, arg) fails with a PicklingError because buried inside the work object that runmc instantiates is (effectively) an assignment: self.predicate = lambda x, y: x > y so the whole object can't be (understandably) pickled and whereas: def foo(x, y): return x > y pickle.dumps(foo) is fine, the sequence bar = lambda x, y: x > y yields True from callable(bar) and from type(bar), but it Can't pickle <function <lambda> at 0xb759b764>: it's not found as __main__.<lambda>. I've given only code fragments because I can easily fix these cases by merely pulling them out into module or object level defs. The bug here appears to be in my understanding of the semantics of namespace use in general. If the nature of the language requires that I create more def statements I'll happily do so; I fear that I'm missing an essential concept though. Why is there such a strong reliance on the global namespace? Or, what am I failing to understand? Namespaces are one honking great idea -- let's do more of those!

    Read the article

  • How to test a Grails Service that utilizes a criteria query (with spock)?

    - by user569825
    I am trying to test a simple service method. That method mainly just returns the results of a criteria query for which I want to test if it returns the one result or not (depending on what is queried for). The problem is, that I am unaware of how to right the corresponding test correctly. I am trying to accomplish it via spock, but doing the same with any other way of testing also fails. Can one tell me how to amend the test in order to make it work for the task at hand? (BTW I'd like to keep it a unit test, if possible.) The EventService Method public HashSet<Event> listEventsForDate(Date date, int offset, int max) { date.clearTime() def c = Event.createCriteria() def results = c { and { le("startDate", date+1) // starts tonight at midnight or prior? ge("endDate", date) // ends today or later? } maxResults(max) order("startDate", "desc") } return results } The Spock Specification package myapp import grails.plugin.spock.* import spock.lang.* class EventServiceSpec extends Specification { def event def eventService = new EventService() def setup() { event = new Event() event.publisher = Mock(User) event.title = 'et' event.urlTitle = 'ut' event.details = 'details' event.location = 'location' event.startDate = new Date(2010,11,20, 9, 0) event.endDate = new Date(2011, 3, 7,18, 0) } def "list the Events of a specific date"() { given: "An event ranging over multiple days" when: "I look up a date for its respective events" def results = eventService.listEventsForDate(searchDate, 0, 100) then: "The event is found or not - depending on the requested date" numberOfResults == results.size() where: searchDate | numberOfResults new Date(2010,10,19) | 0 // one day before startDate new Date(2010,10,20) | 1 // at startDate new Date(2010,10,21) | 1 // one day after startDate new Date(2011, 1, 1) | 1 // someday during the event range new Date(2011, 3, 6) | 1 // one day before endDate new Date(2011, 3, 7) | 1 // at endDate new Date(2011, 3, 8) | 0 // one day after endDate } } The Error groovy.lang.MissingMethodException: No signature of method: static myapp.Event.createCriteria() is applicable for argument types: () values: [] at myapp.EventService.listEventsForDate(EventService.groovy:47) at myapp.EventServiceSpec.list the Events of a specific date(EventServiceSpec.groovy:29)

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • PendingIntent in Widget + TaskKiller

    - by YaW
    Hi, I've developed an Application (called Instant Buttons) and the app has a widget feature. This widget uses PendingIntent for the onClick of the widget. My PendingIntent code is something like this: Intent active = new Intent(context, InstantWidget.class); active.setAction(String.valueOf(appWidgetId)); active.putExtra("blabla", blabla); //Some data PendingIntent actionPendingIntent = PendingIntent.getBroadcast(context, 0, active, 0); actionPendingIntent.cancel(); actionPendingIntent = PendingIntent.getBroadcast(context, 0, active, 0); remoteViews.setOnClickPendingIntent(R.id.button, actionPendingIntent); The onReceive gets the intent and do some stuff with the MediaPlayer class to reproduce a sound. I have reports from some users that the widgets stop working after a while and with some research i've discovered is because the Task Killers. It seems that when you kill the app in the TaskKiller, the PendingIntent is erased from memory, so when you click the widget, it doesn't know what to do. Is there any solution for this? Is my code wrong or something or it's the default behavior of the PendingIntent? Is there something I can use to avoid the TaskKiller to stop my widgets from working?? Greetings.

    Read the article

< Previous Page | 377 378 379 380 381 382 383 384 385 386 387 388  | Next Page >