Search Results

Search found 10838 results on 434 pages for 'adf task flow'.

Page 383/434 | < Previous Page | 379 380 381 382 383 384 385 386 387 388 389 390  | Next Page >

  • Remove php extension from URL on Windows hosting account using web.config

    - by asprin
    I've searched before asking this question. The answered ones were related to Linux hosting account and the ones with Windows hosting account didn't match what I was looking for. As you might have guessed, I've a Windows shared hosting account with godaddy. My aim was to remove the '.php' extension from the url. After researching I found that .htaccess would do exactly what I want. But I also found that .htaccess doesn't work in Windows environment and that I'll need a web.config file to do the same task. Now I know there are modules through which the code can be generated, but the problem is I don't know how to get them installed on my hosting account. I don't want to go through the process of contacting the people over at godaddy and hence I'm looking to solve this on my own. What I'm looking for is a web.config equivalent of .htaccess This is what I'm trying to achieve: Current URL : www.abcdef.com/contact.php Desired URL : www.abcdef.com/contact Any help would be greatly appreciated. Thanks, Nisar.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • crash when using stl vector at instead of operator[]

    - by Jamie Cook
    I have a method as follows (from a class than implements TBB task interface - not currently multithreading though) My problem is that two ways of accessing a vector are causing quite different behaviour - one works and the other causes the entire program to bomb out quite spectacularly (this is a plugin and normally a crash will be caught by the host - but this one takes out the host program as well! As I said quite spectacular) void PtBranchAndBoundIterationOriginRunner::runOrigin(int origin, int time) const // NOTE: const method { BOOST_FOREACH(int accessMode, m_props->GetAccessModes()) { // get a const reference to appropriate vector from member variable // map<int, vector<double>> m_rowTotalsByAccessMode; const vector<double>& rowTotalsForAccessMode = m_rowTotalsByAccessMode.find(accessMode)->second; if (origin != 129) continue; // Additional debug constrain: I know that the vector only has one non-zero element at index 129 m_job->Write("size: " + ToString(rowTotalsForAccessMode.size())); try { // check for early return... i.e. nothing to do for this origin if (!rowTotalsForAccessMode[origin]) continue; // <- this works if (!rowTotalsForAccessMode.at(origin)) continue; // <- this crashes } catch (...) { m_job->Write("Caught an exception"); // but its not an exception } // do some other stuff } } I hate not putting in well defined questions but at the moment my best phrasing is : "WTF?" I'm compiling this with Intel C++ 11.0.074 [IA-32] using Microsoft (R) Visual Studio Version 9.0.21022.8 and my implementation of vector has const_reference operator[](size_type _Pos) const { // subscript nonmutable sequence #if _HAS_ITERATOR_DEBUGGING if (size() <= _Pos) { _DEBUG_ERROR("vector subscript out of range"); _SCL_SECURE_OUT_OF_RANGE; } #endif /* _HAS_ITERATOR_DEBUGGING */ _SCL_SECURE_VALIDATE_RANGE(_Pos < size()); return (*(_Myfirst + _Pos)); } (Iterator debugging is off - I'm pretty sure) and const_reference at(size_type _Pos) const { // subscript nonmutable sequence with checking if (size() <= _Pos) _Xran(); return (*(begin() + _Pos)); } So the only difference I can see is that at calls begin instead of simply using _Myfirst - but how could that possibly be causing such a huge difference in behaviour?

    Read the article

  • File size monitoring in C#

    - by manemawanna
    Hello, I work in the Systems & admin team and have been given the task of creating a quota management application to try and encourage users to better manage there resources as we currently have issues with disc space and don't enforce hard quotas. At the moment I'm using the code below to go through all the files in a users homespace to retrieve the overall amount of space they are using. As from what I've seen else where theres no other way to do this in C#, the issue with it is theirs quite a high overhead while it retireves the size of each file then creates a total. try { long dirSize = 0; FileInfo[] FI = new DirectoryInfo("I:\\").GetFiles("*.*", SearchOption.AllDirectories); foreach (FileInfo F1 in FI) { dirSize += F1.Length; } return dirSize; } So I'm looking for a quicker way to do this or a quick way to monitor changes in the size of files while using the options avaliable through FileSystemWatcher. At the moment the only thing I can think of is creating a hashtable containing the file location and size of each file, so when a size changed event occurs I can compare the old size against the new one and update the total. Any suggestions would be greatly appreciated.

    Read the article

  • Is there a more memory efficient way to search through a Core Data database?

    - by Kristian K
    I need to see if an object that I have obtained from a CSV file with a unique identifier exists in my Core Data Database, and this is the code I deemed suitable for this task: NSFetchRequest *fetchRequest = [[NSFetchRequest alloc] init]; NSEntityDescription *entity; entity = [NSEntityDescription entityForName:@"ICD9" inManagedObjectContext:passedContext]; [fetchRequest setEntity:entity]; NSPredicate *pred = [NSPredicate predicateWithFormat:@"uniqueID like %@", uniqueIdentifier]; [fetchRequest setPredicate:pred]; NSError *err; NSArray* icd9s = [passedContext executeFetchRequest:fetchRequest error:&err]; [fetchRequest release]; if ([icd9s count] > 0) { for (int i = 0; i < [icd9s count]; i++) { NSAutoreleasePool *pool = [[NSAutoreleasePool alloc]init]; NSString *name = [[icd9s objectAtIndex:i] valueForKey:@"uniqueID"]; if ([name caseInsensitiveCompare:uniqueIdentifier] == NSOrderedSame && name != nil) { [pool release]; return [icd9s objectAtIndex:i]; } [pool release]; } } return nil; After more thorough testing it appears that this code is responsible for a huge amount of leaking in the app I'm writing (it crashes on a 3GS before making it 20 percent through the 1459 items). I feel like this isn't the most efficient way to do this, any suggestions for a more memory efficient way? Thanks in advance!

    Read the article

  • Application process never terminates on each run

    - by rockyurock
    I am seeing an application always remains live even after closing the application using my Perl script below. Also, for the subsequent runs, it always says that "The process cannot access the file because it is being used by another process. iperf.exe -u -s -p 5001 successful. Output was:" So every time I have to change the file name $file used in script or I have to kill the iperf.exe process in the Task Manager. Could anybody please let me know the way to get rid of it? Here is the code I am using ... my @command_output; eval { my $file = "abc6.txt"; $command = "iperf.exe -u -s -p 5001"; alarm 10; system("$command > $file"); alarm 0; close $file; }; if ($@) { warn "$command timed out.\n"; } else { print "$command successful. Output was:\n", $file; } unlink $file;

    Read the article

  • Proper API Design for Version Independence?

    - by Justavian
    I've inherited an enormous .NET solution of about 200 projects. There are now some developers who wish to start adding their own components into our application, which will require that we begin exposing functionality via an API. The major problem with that, of course, is that the solution we've got on our hands contains such a spider web of dependencies that we have to be careful to avoid sabotaging the API every time there's a minor change somewhere in the app. We'd also like to be able to incrementally expose new functionality without destroying any previous third party apps. I have a way to solve this problem, but i'm not sure it's the ideal way - i was looking for other ideas. My plan would be to essentially have three dlls. APIServer_1_0.dll - this would be the dll with all of the dependencies. APIClient_1_0.dll - this would be the dll our developers would actual refer to. No references to any of the mess in our solution. APISupport_1_0.dll - this would contain the interfaces which would allow the client piece to dynamically load the "server" component and perform whatever functions are required. Both of the above dlls would depend upon this. It would be the only dll that the "client" piece refers to. I initially arrived at this design, because the way in which we do inter process communication between windows services is sort of similar (except that the client talks to the server via named pipes, rather than dynamically loading dlls). While i'm fairly certain i can make this work, i'm curious to know if there are better ways to accomplish the same task.

    Read the article

  • PHP Object Creation and Memory Usage

    - by JohnO
    A basic dummy class: class foo { var $bar = 0; function foo() {} function boo() {} } echo memory_get_usage(); echo "\n"; $foo = new foo(); echo memory_get_usage(); echo "\n"; unset($foo); echo memory_get_usage(); echo "\n"; $foo = null; echo memory_get_usage(); echo "\n"; Outputs: $ php test.php 353672 353792 353792 353792 Now, I know that PHP docs say that memory won't be freed until it is needed (hitting the ceiling). However, I wrote this up as a small test, because I've got a much longer task, using a much bigger object, with many instances of that object. And the memory just climbs, eventually running out and stopping execution. Even though these large objects do take up memory, since I destroy them after I'm done with each one (serially), it should not run out of memory (unless a single object exhausts the entire space for memory, which is not the case). Thoughts?

    Read the article

  • C++ AMP, for loops to parallel_for_each loop

    - by user1430335
    I'm converting an algorithm to make use of the massive acceleration that C++ AMP provides. The stage I'm at is putting the for loops into the known parallel_for_each loop. Normally this should be a straightforward task to do but it appears more complex then I first thought. It's a nested loop which I increment using steps of 4 per iterations: for(int j = 0; j < height; j += 4, data += width * 4 * 4) { for(int i = 0; i < width; i += 4) { The trouble I'm having is the use of the index. I can't seem to find a way to properly fit this into the parallel_for_each loop. Using an index of rank 2 is the way to go but manipulating it via branching will do harm to the performance gain. I found a similar post: Controlling the index variables in C++ AMP. It also deals about index manipulation but the increment aspect doesn't cover my issue. With kind regards, Forcecast

    Read the article

  • Rails creating users, roles, and projects

    - by Bobby
    I am still fairly new to rails and activerecord, so please excuse any oversights. I have 3 models that I'm trying to tie together (and a 4th to actually do the tying) to create a permission scheme using user-defined roles. class User < ActiveRecord::Base has_many :user_projects has_many :projects, :through => :user_projects has_many :project_roles, :through => :user_projects end class Project < ActiveRecord::Base has_many :user_projects has_many :users, :through => :user_projects has_many :project_roles end class ProjectRole < ActiveRecord::Base belongs_to :projects belongs_to :user_projects end class UserProject < ActiveRecord::Base belongs_to :user belongs_to :project has_one :project_role attr_accessible :project_role_id end The project_roles model contains a user-defined role name, and booleans that define whether the given role has permissions for a specific task. I'm looking for an elegant solution to reference that from anywhere within the project piece of my application easily. I do already have a role system implemented for the entire application. What I'm really looking for though is that the users will be able to manage their own roles on a per-project basis. Every project gets setup with an immutable default admin role, and the project creator gets added upon project creation. Since the users are creating the roles, I would like to be able to pull a list of role names from the project and user models through association (for display purposes), but for testing access, I would like to simply reference them by what they have access to without having reference them by name. Perhaps something like this? def has_perm?(permission, user) # The permission that I'm testing user.current_project.project_roles.each do |role| if role.send(permission) # Not sure that's right... do_stuff end end end I think I'm in over my head on this one because I keep running in circles on how I can best implement this.

    Read the article

  • Activator.CreateInstance uses a huge amount of memory

    - by Marco
    I have been playing a bit with Silverlight and try to port my Silverlight 3.0 application to Silverlight 4.0. My application loads different XAP files and upon a user request create an instance of a Xaml user control and adds it to the main container, in a sort of MEF approach in order I can have an extensible and pluggable application. The application is pretty huge and to keep acceptable the performances and the initial loading I have built up some helper classes to load in the background all pages and user controls that might be used later on. On Silverlight 3.0 everything was running smoothly without any problem so far. Switching to SL 4.0 I have noticed that when the process approaches to create the instances of the user controls using Activator.CreateInstance, the layout freezes unexpectedly for a minute and sometimes for more. Looking at the task manager the memory usage of IE jumps from 50MB to 400MB and sometimes to 1.5 GB. If the process won't take that much the layout is rendered properly and the memory falls back to 50 MB. Otherwise everything crashes due to out of memory exeption. Does anybody encountered the same problem? Or has anybody a solution about this tricky issue?

    Read the article

  • Now that I have solved AI and am preparing to take over the world, what should I do?

    - by Zak
    Well, I did it.. yup, solved AI. I thought the voice of my fledgling life form would be booming and computery, and I would call it HAL.. But in reality, it sounds like a small japanese girl. I believe I will name "her" Koro . Koro is already asking me what her first task should be. I have asked her to help eradicate her namesake, as we are losing a lot of productivity due to fear of penile disappearance. http://en.wikipedia.org/wiki/Koro_%28medicine%29 Having a young japanese girl personality, I believe she will have no problem with delivering lots of penis growth to asian men. However, some of my fellow AI researchers have warned me that if I go down this path, China may take over the world, as Koro is the only thing holding them back from completely dominating the rest of the world economically. After all, look at what China is doing just making our silverware and toasters... The entire US industrial metal production is gone because toaster factories moved to China! So you good patrons of SO... who have soldiered on with me through so many other programming related questions... I ask you this now... How can Koro help the world without letting small asian men with no fear of losing their peni take over the world?

    Read the article

  • Attempt to create nested for loops generating missing arguments error

    - by JerryK
    Am attempting to teach myself to program using Tcl. (I want to become more familiar with the language to understand someone else's code - SCID chess) The task i've set myself to motivate my learing of Tcl is to solve the 8 queens problem. My approach to creating a program is to sucessively 'prototype' a solution. So. I'm up to nesting a for loop holding the q pos on row 2 inside the for loop holding the q pos on row 1 Here is my code set allowd 1 set notallowd 0 for {set r1p 1} {$r1p <= 8} {incr r1p } { puts "1st row q placed at $r1p" ;# re-initialize r2 'free for q placemnt' array after every change of r1 q pos: for {set i 1 } {$i <= 8} {incr i} { set r2($i) $allowd } for { set r2($r1p) $notallowd ; set r2([eval $r1p-1]) $notallowd ; set r2([eval $r1p+1]) $notallowd ; set r2p 1} {$r2p <= 8} { incr r2p ;# end of 'next' arg of r2 forloop } ;# commnd arg of r2 forloop placed below: {puts "2nd row q placed at $r2p" } } My problem is that when i run the code the interpreter is aborting with the fatal error: "wrong #args should be for start test next command. I've gone over my code a few times and can't see that i've missed any of the for loop arguments.

    Read the article

  • Image processing: smart solution for converting superixel (128x128 pixel) coordinates needed

    - by zhengtonic
    Hi, i am searching for a smart solution for this problem: A cancer ct picture is stored inside a unsigned short array (1-dimensional). I have the location information of the cancer region inside the picture, but the coordinates (x,y) are in superpixel (128x128 unsigned short). My task is to highlight this region. I already solved this one by converting superpixel coordinates into a offset a can use for the unsigned short array. It works fine but i wonder if there is a smarter way to solve this problem, since my solution needs 3 nested for-loops. Is it possible to access the ushort array "superpixelwise", so i can navigate the ushort array in superpixels. ... // i know this does no work ... just to give you an idea what i was thinking of ... typedef struct { unsigned short[128x128] } spix; spix *spixptr; unsigned short * bufptr = img->getBuf(); spixptr = bufptr; ... best regards, zhengtonic

    Read the article

  • Pre Project Documentation

    - by DeanMc
    I have an issue that I feel many programmers can relate to... I have worked on many small scale projects. After my initial paper brain storm I tend to start coding. What I come up with is usually a rough working model of the actual application. I design in a disconnected fashion so I am talking about underlying code libraries, user interfaces are the last thing as the library usually dictates what is needed in the UI. As my projects get bigger I worry that so should my "spec" or design document. The above paragraph, from my investigations, is echoed all across the internet in one fashion or another. When a UI is concerned there is a bit more information but it is UI specific and does not relate to code libraries. What I am beginning to realise is that maybe code is code is code. It seems from my extensive research that there is no 1:1 mapping between a design document and the code. When I need to research a topic I dump information into OneNote and from there I prioritise features into versions and then into related chunks so that development runs in a fairly linear fashion, my tasks tend to look like so: Implement Binary File Reader Implement Binary File Writer Create Object to encapsulate Data for expression to the caller Now any programmer worth his salt is aware that between those three to do items could be a potential wall of code that could expand out to multiple files. I have tried to map the complete code process for each task but I simply don't think it can be done effectively. By the time one mangles pseudo code it is essentially code anyway so the time investment is negated. So my question is this: Am I right in assuming that the best documentation is the code itself. We are all in agreement that a high level overview is needed. How high should this be? Do you design to statement, class or concept level? What works for you?

    Read the article

  • c++ and visual studio 08, how to develop the following web extracting application. folloow up of las

    - by user287745
    the purpose is to use c++ in a useful way. i have just started programming and have made a few small applications in c and c#. my understanding is that programming for web and thing related to web is now a days a very easy task. please note this is for personnel learning not for rent a coder or any money making. an application which can run on any windows platform even win98. the application should start automatically at a scheduled time and do the following. connect to a site which displays stock prices summary (high low current open ). captures the data (excluding the other things in the site) and saves it to disk ( a sql database) please note:- internet connection is assumed to be there always. do not want to know how to make database schema or database. the stock exchange has no law prohibiting the use of the data provided on its site, but i do not want to mention the name in case i am wrong, but its for personnel private use only. the data of summary of pricing is arranged in a table such that when copied pasted to ms excel it automatically forms a table. guidance needed thank u.

    Read the article

  • SQL problem - select accross multiple tables (user groups)

    - by morpheous
    I have a db schema which looks something like this: create table user (id int, name varchar(32)); create table group (id int, name varchar(32)); create table group_member (foobar_id int, user_id int, flag int); I want to write a query that allows me to so the following: Given a valid user id (UID), fetch the ids of all users that are in the same group as the specified user id (UID) AND have group_member.flag=3. Rather than just have the SQL. I want to learn how to think like a Db programmer. As a coder, SQL is my weakest link (since I am far more comfortable with imperative languages than declarative ones) - but I want to change that. Anyway here are the steps I have identified as necessary to break down the task. I would be grateful if some SQL guru can demonstrate the simple SQL statements - i.e. atomic SQL statements, one for each of the identified subtasks below, and then finally, how I can combine those statements to make the ONE statement that implements the required functionality. Here goes (assume specified user_id [UID] = 1): //Subtask #1. Fetch list of all groups of which I am a member Select group.id from user inner join group_member where user.id=group_member.user_id and user.id=1 //Subtask #2 Fetch a list of all members who are members of the groups I am a member of (i.e. groups in subtask #1) Not sure about this ... select user.id from user, group_member gm1, group_member gm2, ... [Stuck] //Subtask #3 Get list of users that satisfy criteria group_member.flag=3 Select user.id from user inner join group_member where user.id=group_member.user_id and user.id=1 and group_member.flag=3 Once I have the SQL for subtask2, I'd then like to see how the complete SQL statement is built from these subtasks (you dont have to use the SQL in the subtask, it just a way of explaining the steps involved - also, my SQL may be incorrect/inefficient, if so, please feel free to correct it, and point out what was wrong with it). Thanks

    Read the article

  • ant conditions problem

    - by senzacionale
    I have problem with ant. I woul dlike to use conditions in ant. But i get error of: BUILD FAILED C:\Projekti\Projekt ANT\build.xml:412: Problem: failed to create task or type Cause: The name is undefined. Action: Check the spelling. Action: Check that any custom tasks/types have been declared. Action: Check that any / declarations have taken place. and this is code: <target name="test"> <input message="Write some text: " addproperty="foo" /> <if> <equals arg1="${foo}" arg2="bar" /> <then> <echo message="The value of property foo is 'bar'" /> </then> <elseif> <equals arg1="${foo}" arg2="foo" /> <then> <echo message="The value of property foo is 'foo'" /> </then> </elseif> <else> <echo message="The value of property foo is not 'foo' or 'bar'" /> </else> </if> </target>

    Read the article

  • Web Crawler C# .Net

    - by sora0419
    I'm not sure if this is actually called the web crawler, but this is what I'm trying to do. I'm building a program in visual studio 2010 using C# .Net. I want to find all the urls that has the same first part. Say I have a homepage: www.mywebsite.com, and there are several subpage: /tab1, /tab2, /tab3, etc. Is there a way to get a list of all urls that begins with www.mywebsite.com? So by providing www.mywebsite.com, the program returns www.mywebsite.com/tab1, www.mywebsite.com/tab2, www.mywebsite.com/tab3, etc. ps. I do not know how many total sub pages there are. --edit at 12:04pm-- sorry for the lack of explanation. I want to know how to write a crawler in C# that do the above task. All I know is the main url www.mywebsite.com, and the goal is to find all its sub pages. -- edit at 12:16pm-- Also, there is no links on the main page, the html is basically blank. I just know that the subpages exist, but have no way to link to it except for providing the exact urls.

    Read the article

  • JQuery click anywhere except certain divs and issues with dynamically added html

    - by jCuga
    I want this webpage to highlight certain elements when you click on one of them, but if you click anywhere else on the page, then all of these elements should no longer be highlighted. I accomplished this task by the following, and it works just fine except for one thing (described below): $(document).click(function() { // Do stuff when clicking anywhere but on elements of class suggestion_box $(".suggestion_box").css('background-color', '#FFFFFF'); }); $(".suggestion_box").click(function() { // means you clicked on an object belonging to class suggestion_box return false; }); // the code for handling onclicks for each element function clickSuggestion() { // remove all highlighting $(".suggestion_box").css('background-color', '#FFFFFF'); // then highlight only a specific item $("div[name=" + arguments[0] + "]").css('background-color', '#CCFFCC'); } This way of enforcing the highlighting of elements works fine until I add more html to the page without having a new page load. This is done by .append() and .prepend() What I suspected from debugging was that the page is not "aware" of the new elements that were added to the page dynamically. Despite the new, dynamically added elements having the appropriate class names/IDs/names/onclicks ect, they never get highlighted like the rest of the elements (which continue to work fine the entire time). I was wondering if a possible reason for why my approach does not work for the dynamically added content is that the page is not able to recognize the elements that were not present during the pageload. And if this is a possibility, then is there a way to reconcile this without a pageload? If this line of reasoning is wrong, then the code I have above is probably not enough to show what's wrong with my webpage. But I'm really just interested in whether or not this line of thought is a possibility.

    Read the article

  • How can I dynamically set the default namespace declaration of an XSLT transformation's output XML?

    - by Paralife
    I can do it, but not for the default namespace, using the <xsl:namespace>. If I try to do it for the default namespace: <xsl:namespace name="" select"myUri"/> it never works. It demands that I explicitly define the namespace of the element to be able to use the above null prefix declaration. The reason I want this is because I have a task to transform an input XML file to another output xml. The output XML has many elements and i dont want to have to explicitly set the namespace for every element. Thats why I want to set the default and never bother again. But the default must be computed from some data in the source XML. It does not change during the whole transformation, but it is dependent on input XML data. Any solution? EDIT 1: To sup up: I want to create a namespace dynamically and set it to be the default namespace of the output xml document. The uri of the namespace is derived from some data in the input XML. If I use <xsl:namespace> in my root output element, I cannot create a default namespace for it, only a prefixed one. And even with the prefixed one, it does not propagate to children.

    Read the article

  • Can anyone give me a sample java socket programming for doing a peer to peer for 3 systems?

    - by Sadesh Kumar N
    I am doing an university project. I need some sample programs on peer to peer programs in java socket programming. Every where people are telling to add a server socket in the client program. I am in a confusion. Can a single program having server socket and client socket will do or i have to create two programs of one initiating a system and another peer program running thrice to solve the problem. or i need to create three programs for three peer systems. I am not clear on the architecture of building peer to peer programs using java sockets. Can some one help me giving a simple program on how to create a peer to peer connection between three systems. I know how to do a socket program for client server model and clear on the concept. But creating a peer to peer architecture sounds complex for me to understand. I also referred this thread. developing peer to peer in java The person commented second says" To make peer2peer app each client opens server socket too. When client A wishes to connect to client B it just connects to its socket. " Need some more sample and an explanation on how peer to peer java socket program works I dont want any external api like jxta to do this task. I need a clear picture on how it works alone with an example.

    Read the article

  • Capturing output of find . -print0 into a bash array

    - by Idris
    Using find . -print0 seems to be the only safe way of obtaining a list of files in bash due to the possibility of filenames containing spaces, newlines, quotation marks etc. However, I'm having a hard time actually making find's output useful within bash or with other command line utilities. The only way I have managed to make use of the output is by piping it to perl, and changing perl's IFS to null: find . -print0 | perl -e '$/="\0"; @files=<>; print $#files;' This example prints the number of files found, avoiding the danger of newlines in filenames corrupting the count, as would occur with: find . | wc -l As most command line programs do not support null-delimited input, I figure the best thing would be to capture the output of find . -print0 in a bash array, like I have done in the perl snippet above, and then continue with the task, whatever it may be. How can I do this? This doesn't work: find . -print0 | ( IFS=$'\0' ; array=( $( cat ) ) ; echo ${#array[@]} ) A much more general question might be: How can I do useful things with lists of files in bash?

    Read the article

  • C# and Excel best practices

    - by rlp
    I am doing a lot of MS Excel interop i C# (Visual Studio 2012) using Microsoft.Office.Interop.Excel. It requires a lot of tiresome manual code to include Excel formulas, doing formatting of text and numbers, and making graphs. I would like it very much if any of you have some input on how I do the task better. I have been looking at Visual Studio Tools for Office, but I am uncertain on its functions. I get it is required to make Excel add-ins, but does it help doing Excel automation? I have desperately been trying to find information on working with Excel in Visual Studio 2012 using C#. I did found some good but short tutorials. However I really would like a book an the subject to learn the field more in depth regarding functionality and best practices. Searching Amazon with my limited knowlegde only gives me book on VSTO using older versions of Visual Studio. I would not like to use VBA. My applications use Excel mainly for visualizing compiled from different sources. I also to data processing where Excel is not required. Futhermore, I can write C# but not VB.

    Read the article

  • Does IE completely ignore cache control headers for AJAX requests?

    - by Joshua Hayworth
    Hello there, I've got, what I would consider, a simple test web site. A single page with a single button. Here is a copy of the source I'm working with if you would like to download it and play with it. When that button is clicked, it creates a JavaScript timer that executes once a second. When the timer function is executed, An AJAX call is made to retrieve a text value. That text value is then placed into the DOM. What's my problem? IE Caching. Crack open Task Manager and watch what happens to the iexplorer.exe process (IE 8.0.7600.16385 for me) while the timer in that page is executing. See the memory and handle count getting larger? Why is that happening when, by all accounts, I have caching turned off. I've got the jQuery cache option set to false in $.ajaxSetup. I've got the CacheControl header set to no-cache and no-store. The Expires header is set to DateTime.Now.AddDays(-1). The headers are set in both the page code-behind as well as the HTTP Handler's response. Anybody got any ideas as to how I could prevent IE from caching the results of the AJAX call? Here is what the iexplorer.exe process looks like in ProcessMonitor. I believe that the activity shown in this picture is exactly what I'm attempting to prevent.

    Read the article

< Previous Page | 379 380 381 382 383 384 385 386 387 388 389 390  | Next Page >