Search Results

Search found 13815 results on 553 pages for 'gae python'.

Page 383/553 | < Previous Page | 379 380 381 382 383 384 385 386 387 388 389 390  | Next Page >

  • django join-like expansion of queryset

    - by jimbob
    I have a list of Persons each which have multiple fields that I usually filter what's upon, using the object_list generic view. Each person can have multiple Comments attached to them, each with a datetime and a text string. What I ultimately want to do is have the option to filter comments based on dates. class Person(models.Model): name = models.CharField("Name", max_length=30) ## has ~30 other fields, usually filtered on as well class Comment(models.Model): date = models.DateTimeField() person = models.ForeignKey(Person) comment = models.TextField("Comment Text", max_length=1023) What I want to do is get a queryset like Person.objects.filter(comment__date__gt=date(2011,1,1)).order_by('comment__date') send that queryset to object_list and be able to only see the comments ordered by date with only so many objects on a page. E.g., if "Person A" has comments 12/3/11, 1/2/11, 1/5/11, "Person B" has no comments, and person C has a comment on 1/3, I would see: "Person A", 1/2 - comment "Person C", 1/3 - comment "Person A", 1/5 - comment I would strongly prefer not to have to switch to filtering based on Comments.objects.filter(), as that would make me have to largely repeat large sections of code in the both the view and template. Right now if I tried executing the following command, I will get a queryset returning (PersonA, PersonC, PersonA), but if I try rendering that in a template each persons comment_set will contain all their comments even if they aren't in the date range. Ideally they're would be some sort of functionality where I could expand out a Person queryset's comment_set into a larger queryset that can be sorted and ordered based on the comment and put into a object_list generic view. This normally is fairly simple to do in SQL with a JOIN, but I don't want to abandon the ORM, which I use everywhere else.

    Read the article

  • Why is django.test.client.Client not keeping me logged in.

    - by Mystic
    I'm using django.test.client.Client to test whether some text shows up when a user is logged in. However, I the Client object doesn't seem to be keeping me logged in. This test passes if done manually with Firefox but not when done with the Client object. class Test(TestCase): def test_view(self): user.set_password(password) user.save() client = self.client # I thought a more manual way would work, but no luck # client.post('/login', {'username':user.username, 'password':password}) login_successful = client.login(username=user.username, password=password) # this assert passes self.assertTrue(login_successful) response = client.get("/path", follow=True) #whether follow=True or not doesn't seem to work self.assertContains(response, "needle" ) When I print response it returns the login form that is hidden by: {% if not request.user.is_authenticated %} ... form ... {% endif %} This is confirmed when I run ipython manage.py shell. The problem seems to be that the Client object is not keeping the session authenticated.

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Get wrong PATH_INFO after rewriting in lighttpd

    - by Satoru.Logic
    In my lighttpd config file, I have a rewrite rule like this: $HTTP["host"] == "sub.example.com" { url.rewrite = ( "^/(.*)" => "/sub/$1" ) } So when a user visits http://sub.example.com, she's actually visiting http://example.com/sub. The problem is that the PATH_INFO seems wrong, URL: http://sub.example.com/extra PATH_INFO: expected: /extra what I get: /sub/extra Now whenever I call request.get_path(), it returns something like http://sub.example.com/sub/extra, which is not what I want. Of course, I can just override the get_path method of the request class, but I wonder if there is a simpler way like changing the lighttpd config?

    Read the article

  • Return 0 where django quersyet is none

    - by gramware
    I have a django queryset in my views whose values I pack before passing to my template. There is a problem when the queryset returns none since associated values are not unpacked. the quersyet is called comments. Here is my views.py def forums(request ): post_list = list(forum.objects.filter(child='0')&forum.objects.filter(deleted='0').order_by('postDate')) user = UserProfile.objects.get(pk=request.session['_auth_user_id']) newpostform = PostForm(request.POST) deletepostform = PostDeleteForm(request.POST) DelPostFormSet = modelformset_factory(forum, exclude=('child','postSubject','postBody','postPoster','postDate','childParentId')) readform = ReadForumForm(request.POST) comments =list( forum.objects.filter(deleted='0').filter(child='1').order_by('childParentId').values('childParentId').annotate(y=Count('childParentId'))) if request.user.is_staff== True : staff = 1 else: staff = 0 staffis = 1 if newpostform.is_valid(): topic = request.POST['postSubject'] poster = request.POST['postPoster'] newpostform.save() return HttpResponseRedirect('/forums') else: newpostform = PostForm(initial = {'postPoster':user.id}) if request.GET: form = SearchForm(request.GET) if form.is_valid(): query = form.cleaned_data['query'] post_list = list((forum.objects.filter(child='0')&forum.objects.filter(deleted='0')&forum.objects.filter(Q(postSubject__icontains=query)|Q(postBody__icontains=query)|Q(postDate__icontains=query)))or(forum.objects.filter(deleted='0')&forum.objects.filter(Q(postSubject__icontains=query)|Q(postBody__icontains=query)|Q(postDate__icontains=query)).values('childParentId'))) if request.method == 'POST': delpostformset = DelPostFormSet(request.POST) if delpostformset.is_valid(): delpostformset.save() return HttpResponseRedirect('/forums') else: delpostformset = DelPostFormSet(queryset=forum.objects.filter(child='0', deleted='0')) """if readform.is_valid(): user=get_object_or_404(UserProfile.objects.all()) readform.save() else: readform = ReadForumForm()""" post= zip( post_list,comments, delpostformset.forms) paginator = Paginator(post, 10) # Show 10 contacts per page # Make sure page request is an int. If not, deliver first page. try: page = int(request.GET.get('page', '1')) except ValueError: page = 1 # If page request (9999) is out of range, deliver last page of results. try: post = paginator.page(page) except (EmptyPage, InvalidPage): post = paginator.page(paginator.num_pages) return render_to_response('forum.html', {'post':post, 'newpostform': newpostform,'delpost':delpostformset, 'username':user.username, 'comments':comments, 'user':user, },context_instance = RequestContext( request ))

    Read the article

  • what would be a frozen dict ?

    - by dugres
    A frozen set is a frozenset. A frozen list could be a tuple. What would be a frozen dict ? An immutable, hashable dict. I guess it could be something like collections.namedtuple, but namedtuple is more like a frozenkeys dict (an half-frozen dict). No ?

    Read the article

  • What's the straightforward way to implement one to many editing in list_editable in django admin?

    - by Nate Pinchot
    Given the following models: class Store(models.Model): name = models.CharField(max_length=150) class ItemGroup(models.Model): group = models.CharField(max_length=100) code = models.CharField(max_length=20) class ItemType(models.Model): store = models.ForeignKey(Store, on_delete=models.CASCADE, related_name="item_types") item_group = models.ForeignKey(ItemGroup) type = models.CharField(max_length=100) Inline's handle adding multiple item_types to a Store nicely when viewing a single Store. The content admin team would like to be able to edit stores and their types in bulk. Is there a simple way to implement Store.item_types in list_editable which also allows adding new records, similar to horizontal_filter? If not, is there a straightforward guide that shows how to implement a custom list_editable template? I've been Googling but haven't been able to come up with anything. Also, if there is a simpler or better way to set up these models that would make this easier to implement, feel free to comment.

    Read the article

  • Does urllib2.urlopen() actually fetch the page?

    - by beagleguy
    hi all, I was condering when I use urllib2.urlopen() does it just to header reads or does it actually bring back the entire webpage? IE does the HTML page actually get fetch on the urlopen call or the read() call? handle = urllib2.urlopen(url) html = handle.read() The reason I ask is for this workflow... I have a list of urls (some of them with short url services) I only want to read the webpage if I haven't seen that url before I need to call urlopen() and use geturl() to get the final page that link goes to (after the 302 redirects) so I know if I've crawled it yet or not. I don't want to incur the overhead of having to grab the html if I've already parsed that page. thanks!

    Read the article

  • How can I merge two lists and sort them working in 'linear' time?

    - by Sergio Tapia
    I have this, and it works: # E. Given two lists sorted in increasing order, create and return a merged # list of all the elements in sorted order. You may modify the passed in lists. # Ideally, the solution should work in "linear" time, making a single # pass of both lists. def linear_merge(list1, list2): finalList = [] for item in list1: finalList.append(item) for item in list2: finalList.append(item) finalList.sort() return finalList # +++your code here+++ return But, I'd really like to learn this stuff well. :) What does 'linear' time mean?

    Read the article

  • MUD (game) design concept question about timed events.

    - by mudder
    I'm trying my hand at building a MUD (multiplayer interactive-fiction game) I'm in the design/conceptualizing phase and I've run into a problem that I can't come up with a solution for. I'm hoping some more experienced programmers will have some advice. Here's the problem as best I can explain it. When the player decides to perform an action he sends a command to the server. the server then processes the command, determines whether or not the action can be performed, and either does it or responds with a reason as to why it could not be done. One reason that an action might fail is that the player is busy doing something else. For instance, if a player is mid-fight and has just swung a massive broadsword, it might take 3 seconds before he can repeat this action. If the player attempts to swing again to soon, the game will respond indicating that he must wait x seconds before doing that. Now, this I can probably design without much trouble. The problem I'm having is how I can replicate this behavior from AI creatures. All of the events that are being performed by the server ON ITS OWN, aka not as an immediate reaction to something a player has done, will have to be time sensitive. Some evil monster has cast a spell on you but must wait 30 seconds before doing it again... I think I'll probably be adding all these events to some kind of event queue, but how can I make that event queue time sensitive?

    Read the article

  • Installing twisted.mail.smtp

    - by user3506985
    I am using Ubuntu 14.04 and trying to install twisted.mail.smtp using the following commnands -sudo add-apt-repository ppa:jesstess/twisted-12.1-testing -sudo apt-get update There are no errors in the installation,but when I specify the command that is from twisted.mail.smtp import ESMTPSenderFactory I am getting the following error Error: ImportError: No module named mail.smtp Please help me out

    Read the article

  • Creating a new plugin for mpld3

    - by sjp14051
    Toward learning how to create a new mpld3 plugin, I took an existing example, LinkedDataPlugin (http://mpld3.github.io/examples/heart_path.html), and modified it slightly by deleting references to lines object. That is, I created the following: class DragPlugin(plugins.PluginBase): JAVASCRIPT = r""" mpld3.register_plugin("drag", DragPlugin); DragPlugin.prototype = Object.create(mpld3.Plugin.prototype); DragPlugin.prototype.constructor = DragPlugin; DragPlugin.prototype.requiredProps = ["idpts", "idpatch"]; DragPlugin.prototype.defaultProps = {} function DragPlugin(fig, props){ mpld3.Plugin.call(this, fig, props); }; DragPlugin.prototype.draw = function(){ var patchobj = mpld3.get_element(this.props.idpatch, this.fig); var ptsobj = mpld3.get_element(this.props.idpts, this.fig); var drag = d3.behavior.drag() .origin(function(d) { return {x:ptsobj.ax.x(d[0]), y:ptsobj.ax.y(d[1])}; }) .on("dragstart", dragstarted) .on("drag", dragged) .on("dragend", dragended); patchobj.path.attr("d", patchobj.datafunc(ptsobj.offsets, patchobj.pathcodes)); patchobj.data = ptsobj.offsets; ptsobj.elements() .data(ptsobj.offsets) .style("cursor", "default") .call(drag); function dragstarted(d) { d3.event.sourceEvent.stopPropagation(); d3.select(this).classed("dragging", true); } function dragged(d, i) { d[0] = ptsobj.ax.x.invert(d3.event.x); d[1] = ptsobj.ax.y.invert(d3.event.y); d3.select(this) .attr("transform", "translate(" + [d3.event.x,d3.event.y] + ")"); patchobj.path.attr("d", patchobj.datafunc(ptsobj.offsets, patchobj.pathcodes)); } function dragended(d, i) { d3.select(this).classed("dragging", false); } } mpld3.register_plugin("drag", DragPlugin); """ def __init__(self, points, patch): print "Points ID : ", utils.get_id(points) self.dict_ = {"type": "drag", "idpts": utils.get_id(points), "idpatch": utils.get_id(patch)} However, when I try to link the plugin to a figure, as in plugins.connect(fig, DragPlugin(points[0], patch)) I get an error, 'module' is not callable, pointing to this line. What does this mean and why doesn't it work? Thanks. I'm adding additional code to show that linking more than one Plugin might be problematic. But this may be entirely due to some silly mistake on my part, or there is a way around it. The following code based on LinkedViewPlugin generates three panels, in which the top and the bottom panel are supposed to be identical. Mouseover in the middle panel was expected to control the display in the top and bottom panels, but updates occur in the bottom panel only. It would be nice to be able to figure out how to reflect the changes in multiple panels. Thanks. import matplotlib import matplotlib.pyplot as plt import numpy as np import mpld3 from mpld3 import plugins, utils class LinkedView(plugins.PluginBase): """A simple plugin showing how multiple axes can be linked""" JAVASCRIPT = """ mpld3.register_plugin("linkedview", LinkedViewPlugin); LinkedViewPlugin.prototype = Object.create(mpld3.Plugin.prototype); LinkedViewPlugin.prototype.constructor = LinkedViewPlugin; LinkedViewPlugin.prototype.requiredProps = ["idpts", "idline", "data"]; LinkedViewPlugin.prototype.defaultProps = {} function LinkedViewPlugin(fig, props){ mpld3.Plugin.call(this, fig, props); }; LinkedViewPlugin.prototype.draw = function(){ var pts = mpld3.get_element(this.props.idpts); var line = mpld3.get_element(this.props.idline); var data = this.props.data; function mouseover(d, i){ line.data = data[i]; line.elements().transition() .attr("d", line.datafunc(line.data)) .style("stroke", this.style.fill); } pts.elements().on("mouseover", mouseover); }; """ def __init__(self, points, line, linedata): if isinstance(points, matplotlib.lines.Line2D): suffix = "pts" else: suffix = None self.dict_ = {"type": "linkedview", "idpts": utils.get_id(points, suffix), "idline": utils.get_id(line), "data": linedata} class LinkedView2(plugins.PluginBase): """A simple plugin showing how multiple axes can be linked""" JAVASCRIPT = """ mpld3.register_plugin("linkedview", LinkedViewPlugin2); LinkedViewPlugin2.prototype = Object.create(mpld3.Plugin.prototype); LinkedViewPlugin2.prototype.constructor = LinkedViewPlugin2; LinkedViewPlugin2.prototype.requiredProps = ["idpts", "idline", "data"]; LinkedViewPlugin2.prototype.defaultProps = {} function LinkedViewPlugin2(fig, props){ mpld3.Plugin.call(this, fig, props); }; LinkedViewPlugin2.prototype.draw = function(){ var pts = mpld3.get_element(this.props.idpts); var line = mpld3.get_element(this.props.idline); var data = this.props.data; function mouseover(d, i){ line.data = data[i]; line.elements().transition() .attr("d", line.datafunc(line.data)) .style("stroke", this.style.fill); } pts.elements().on("mouseover", mouseover); }; """ def __init__(self, points, line, linedata): if isinstance(points, matplotlib.lines.Line2D): suffix = "pts" else: suffix = None self.dict_ = {"type": "linkedview", "idpts": utils.get_id(points, suffix), "idline": utils.get_id(line), "data": linedata} fig, ax = plt.subplots(3) # scatter periods and amplitudes np.random.seed(0) P = 0.2 + np.random.random(size=20) A = np.random.random(size=20) x = np.linspace(0, 10, 100) data = np.array([[x, Ai * np.sin(x / Pi)] for (Ai, Pi) in zip(A, P)]) points = ax[1].scatter(P, A, c=P + A, s=200, alpha=0.5) ax[1].set_xlabel('Period') ax[1].set_ylabel('Amplitude') # create the line object lines = ax[0].plot(x, 0 * x, '-w', lw=3, alpha=0.5) ax[0].set_ylim(-1, 1) ax[0].set_title("Hover over points to see lines") linedata = data.transpose(0, 2, 1).tolist() plugins.connect(fig, LinkedView(points, lines[0], linedata)) # second set of lines exactly the same but in a different panel lines2 = ax[2].plot(x, 0 * x, '-w', lw=3, alpha=0.5) ax[2].set_ylim(-1, 1) ax[2].set_title("Hover over points to see lines #2") plugins.connect(fig, LinkedView2(points, lines2[0], linedata)) mpld3.show()

    Read the article

  • Django save method

    - by Marijus
    So I have a model with a FileField for excel spreadsheet. What I need to do this add another column in this spreadsheet, in each row let user pick from a drop-down list then save it and display it in html. All the picking and uploading will happen through the admin interface. So I have figured out way how to display a spreadsheet in html, however I have no idea how to write this save method. I could really use some hints and tips..

    Read the article

  • Increasing figure size in Matplotlib

    - by Anirudh
    I am trying to plot a graph from a distance matrix. The code words fine and gives me a image in 800 * 600 pixels. The image being too small, All the nodes are packed together. I want increase the size of the image. so I added the following line to my code - figure(num=None, figsize=(10, 10), dpi=80, facecolor='w', edgecolor='k') After this all I get is a blank 1000 * 1000 image file. My overall code - import networkx as nx import pickle import matplotlib.pyplot as plt print "Reading from pickle." p_file = open('pickles/names') Names = pickle.load(p_file) p_file.close() p_file = open('pickles/distance') Dist = pickle.load(p_file) p_file.close() G = nx.Graph() print "Inserting Nodes." for n in Names: G.add_node(n) print "Inserting Edges." for i in range(601): for j in range(601): G.add_edge(Names[i],Names[j],weight=Dist[i][j]) print "Drawing Graph." nx.draw(G) print "Saving Figure." #plt.figure(num=None, figsize=(10, 10)) plt.savefig('new.png') print "Success!"

    Read the article

  • ahow can I resolve Django Error: str' object has no attribute 'autoescape'?

    - by Angelbit
    Hi have tried to create a inclusion tag on Django but don't work and return str' object has no attribute 'autoescape' this is the code of custom tag: from django import template from quotes.models import Quotes register = template.Library() def show_quote(): quote = Quotes.objects.values('quote', 'author').get(id=0) return {'quote': quote['quote']} register.inclusion_tag('quotes.html')(show_quote) EDIT: Quote class from django.db import models class Quotes(models.Model): quote = models.CharField(max_length=255) author = models.CharField(max_length=100) class Meta: db_table = 'quotes' quotes.html <blockquote id="quotes">{{ quote }}</blockquote>

    Read the article

  • Good looking programs that use wxPython for their UI

    - by ChrisC
    I need inspiration and motivation so I'm trying to find examples of different programs that have interesting and attractive UI's created free using wxPython. My searches have been slow to find results. I'm hoping you guys know of some of the best ones out there. btw, I've seen these: http://www.wxpython.org/screenshots.php and the list under "Applications Developed with wxPython" on the wxPython Wikipedia page. Update: only need Windows examples

    Read the article

  • Inlines in Django Admin

    - by Oli
    I have two models, Order and UserProfile. Each Order has a ForeignKey to UserProfile, to associate it with that user. On the django admin page for each Order, I'd like to display the UserProfile associated with it, for easy processing of information. I have tried inlines: class UserInline(admin.TabularInline): model = UserProfile class ValuationRequestAdmin(admin.ModelAdmin): list_display = ('address1', 'address2', 'town', 'date_added') list_filter = ('town', 'date_added') ordering = ('-date_updated',) inlines = [ UserInline, ] But it complains that UserProfile "has no ForeignKey to" Order - which it doesn't, it's the other way around. Is there a way to do what I want?

    Read the article

  • Looping through a directory on the web and displaying its contents (files and other directories) via

    - by al jaffe
    In the same vein as http://stackoverflow.com/questions/2593399/process-a-set-of-files-from-a-source-directory-to-a-destination-directory-in-pyth I'm wondering if it is possible to create a function that when given a web directory it will list out the files in said directory. Something like... files[] for file in urllib.listdir(dir): if file.isdir: # handle this as directory else: # handle as file I assume I would need to use the urllib library, but there doesn't seem to be an easy way of doing this, that I've seen at least.

    Read the article

  • django link format words joined with hypens

    - by soField
    href="http://www.torontolife.com/daily/daily-dish/restauranto/2010/03/10/best-new-restaurants-2010-james-chatto-names-five-honourable-mentions/"Best new restaurants 2010: honourable mentions is django has built in mechanism to format links above i mean words joined with hypens how can achieve this ?

    Read the article

  • Distance between numpy arrays, columnwise

    - by Jaapsneep
    I have 2 arrays in 2D, where the column vectors are feature vectors. One array is of size F x A, the other of F x B, where A << B. As an example, for A = 2 and F = 3 (B can be anything): arr1 = np.array( [[1, 4], [2, 5], [3, 6]] ) arr2 = np.array( [[1, 4, 7, 10, ..], [2, 5, 8, 11, ..], [3, 6, 9, 12, ..]] ) I want to calculate the distance between arr1 and a fragment of arr2 that is of equal size (in this case, 3x2), for each possible fragment of arr2. The column vectors are independent of each other, so I believe I should calculate the distance between each column vector in arr1 and a collection of column vectors ranging from i to i + A from arr2 and take the sum of these distances (not sure though). Does numpy offer an efficient way of doing this, or will I have to take slices from the second array and, using another loop, calculate the distance between each column vector in arr1 and the corresponding column vector in the slice?

    Read the article

  • Sending message from one server to another in Twisted

    - by Casey Patton
    I've implemented my servers in the following way: def makeServer(application, port): factory = protocol.ServerFactory() factory.protocol = MyChat factory.clients = [] internet.TCPServer(port, factory).setServiceParent(application) application = service.Application("chatserver") server1 = makeServer(application, port=1025) server2 = makeServer(application, port=1026) server3 = makeServer(application, port=1027) Note that MyChat is an event handling class that has a "receiveMessage" action: def lineReceived(self, line): print "received", repr(line) for c in self.factory.clients: c.transport.write(message + '\n') I want server1 to be able to pass messages to server2. Rather, I want server1 to be treated as a client of server2. If server1 receives the message "hi" then I want it to send that same exact message to server2. How can I accomplish this?

    Read the article

  • Pass errors in Django using HttpResponseRedirect

    - by JPC
    I know that HttpResponseRedirect only takes one parameter, a URL. But there are cases when I want to redirect with an error message to display. I was reading this post: How to pass information using an http redirect (in Django) and there were a lot of good suggestions. I don't really want to use a library that I don't know how works. I don't want to rely on messages which, according to the Django docs, is going to be removed. I thought about using sessions. I also like the idea of passing it in a URL, something like: return HttpResponseRedirect('/someurl/?error=1') and then having some map from error code to message. Is it good practice to have a global map-like structure which hard codes in these error messages or is there a better way? Or should I just use a session EDIT: I got it working using a session. Is that a good practice to put things like this in the session?

    Read the article

< Previous Page | 379 380 381 382 383 384 385 386 387 388 389 390  | Next Page >