Search Results

Search found 39440 results on 1578 pages for 'possible homework'.

Page 39/1578 | < Previous Page | 35 36 37 38 39 40 41 42 43 44 45 46  | Next Page >

  • Recursive Enumeration in Java

    - by Harm De Weirdt
    Hello everyone. I still have a question about Enumerations. Here's a quick sketch of the situation. I have a class Backpack that has a Hashmap content with as keys a variable of type long, and as value an ArrayList with Items. I have to write an Enumeration that iterates over the content of a Backpack. But here's the catch: in a Backpack, there can also be another Backpack. And the Enumeration should also be able to iterate over the content of a backpack that is in the backpack. (I hope you can follow, I'm not really good at explaining..) Here is the code I have: public Enumeration<Object> getEnumeration() { return new Enumeration<Object>() { private int itemsDone = 0; //I make a new array with all the values of the HashMap, so I can use //them in nextElement() Collection<Long> keysCollection = getContent().keySet(); Long [] keys = keysCollection.toArray(new Long[keysCollection.size()]); public boolean hasMoreElements() { if(itemsDone < getContent().size()) { return true; }else { return false; } } public Object nextElement() { ArrayList<Item> temporaryList= getContent().get(keys[itemsDone]); for(int i = 0; i < temporaryList.size(); i++) { if(temporaryList.get(i) instanceof Backpack) { return temporaryList.get(i).getEnumeration(); }else { return getContent().get(keys[itemsDone++]); } } } }; Will this code work decently? It's just the "return temporaryList.get(i).getEnumeration();" I'm worried about. Will the users still be able to use just the hasMoreElemens() and nextElement() like he would normally do? Any help is appreciated, Harm De Weirdt

    Read the article

  • Read from file in eclipse

    - by Buzkie
    I'm trying to read from a text file to input data to my java program. However, eclipse continuosly gives me a Source not found error no matter where I put the file. I've made an additional sources folder in the project directory, the file in question is in both it and the bin file for the project and it still can't find it. I even put a copy of it on my desktop and tried pointing eclipse there when it asked me to browse for the source lookup path. No matter what I do it can't find the file. here's my code in case it's pertinent: System.out.println(System.getProperty("user.dir")); File file = new File("file.txt"); Scanner scanner = new Scanner(file); in addition, it says the user directory is the project directory and there is a copy there too. I have no clue what to do. Thanks, Alex after attempting the suggestion below and refreshing again, I was greeted by a host of errors. FileNotFoundException(Throwable).<init>(String) line: 195 FileNotFoundException(Exception).<init>(String) line: not available FileNotFoundException(IOException).<init>(String) line: not available FileNotFoundException.<init>(String) line: not available URLClassPath$JarLoader.getJarFile(URL) line: not available URLClassPath$JarLoader.access$600(URLClassPath$JarLoader, URL) line: not available URLClassPath$JarLoader$1.run() line: not available AccessController.doPrivileged(PrivilegedExceptionAction<T>) line: not available [native method] URLClassPath$JarLoader.ensureOpen() line: not available URLClassPath$JarLoader.<init>(URL, URLStreamHandler, HashMap) line: not available URLClassPath$3.run() line: not available AccessController.doPrivileged(PrivilegedExceptionAction<T>) line: not available [native method] URLClassPath.getLoader(URL) line: not available URLClassPath.getLoader(int) line: not available URLClassPath.access$000(URLClassPath, int) line: not available URLClassPath$2.next() line: not available URLClassPath$2.hasMoreElements() line: not available ClassLoader$2.hasMoreElements() line: not available CompoundEnumeration<E>.next() line: not available CompoundEnumeration<E>.hasMoreElements() line: not available ServiceLoader$LazyIterator.hasNext() line: not available ServiceLoader$1.hasNext() line: not available LocaleServiceProviderPool$1.run() line: not available AccessController.doPrivileged(PrivilegedExceptionAction<T>) line: not available [native method] LocaleServiceProviderPool.<init>(Class<LocaleServiceProvider>) line: not available LocaleServiceProviderPool.getPool(Class<LocaleServiceProvider>) line: not available NumberFormat.getInstance(Locale, int) line: not available NumberFormat.getNumberInstance(Locale) line: not available Scanner.useLocale(Locale) line: not available Scanner.<init>(Readable, Pattern) line: not available Scanner.<init>(ReadableByteChannel) line: not available Scanner.<init>(File) line: not available code used: System.out.println(System.getProperty("user.dir")); File file = new File(System.getProperty("user.dir") + "/file.txt"); Scanner scanner = new Scanner(file);

    Read the article

  • errorerror C2059: syntax error : ']', i cant figure out why this coming up in c++

    - by user320950
    void display_totals(); int exam1[100][3];// array that can hold 100 numbers for 1st column int exam2[100][3];// array that can hold 100 numbers for 2nd column int exam3[100][3];// array that can hold 100 numbers for 3rd column int main() { int go,go2,go3; go=read_file_in_array; go2= calculate_total(exam1[],exam2[],exam3[]); go3=display_totals; cout << go,go2,go3; return 0; } void display_totals() { int grade_total; grade_total=calculate_total(exam1[],exam2[],exam3[]); } int calculate_total(int exam1[],int exam2[],int exam3[]) { int calc_tot,above90=0, above80=0, above70=0, above60=0,i,j; calc_tot=read_file_in_array(exam[100][3]); exam1[][]=exam[100][3]; exam2[][]=exam[100][3]; exam3[][]=exam[100][3]; for(i=0;i<100;i++); { if(exam1[i] <=90 && exam1[i] >=100) { above90++; cout << above90; } } return exam1[i],exam2[i],exam3[i]; } int read_file_in_array(int exam[100][3]) { ifstream infile; int num, i=0,j=0; infile.open("grades.txt");// file containing numbers in 3 columns if(infile.fail()) // checks to see if file opended { cout << "error" << endl; } while(!infile.eof()) // reads file to end of line { for(i=0;i<100;i++); // array numbers less than 100 { for(j=0;j<3;j++); // while reading get 1st array or element infile >> exam[i][j]; cout << exam[i][j] << endl; } } infile.close(); return exam[i][j]; }

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • intiating lists in the constructor's initialization list

    - by bks
    i just moved from C to C++, and now work with lists. i have a class called "message", and i need to have a class called "line", which should have a list of messages in its properties. as i learned, the object's properties should be initialized in the constructor's initialization list, and i had the "urge" to initialize the messages list in addition to the rest of the properties (some strings and doubles). is that "urge" justified? does the list need to be initialized? thank you in advance

    Read the article

  • argparse coding issue

    - by Carl Skonieczny
    write a script that takes two optional boolean arguments,"--verbose‚" and ‚"--live", and two required string arguments, "base"and "pattern". Please set up the command line processing using argparse. This is the code I have so far for the question, I know I am getting close but something is not quite right. Any help is much appreciated.Thanks for all the quick useful feedback. def main(): import argparse parser = argparse.ArgumentParser(description='') parser.add_argument('base', type=str) parser.add_arguemnt('--verbose', action='store_true') parser.add_argument('pattern', type=str) parser.add_arguemnt('--live', action='store_true') args = parser.parse_args() print(args.base(args.pattern))

    Read the article

  • C# Finding 2 positions 1-dimArray

    - by Chris
    Hello, In a method i am calculating the longest row of elements. The 1-dim array is filled up with random values (0 or 1). The method looks up the longest row (being 0 or 1, whatever is the longest). Meaning in for example: 1110100 --> the longest row would be 3 (3 * 1) 0110000 --> the longest row would be 4 (4 * 0) My problem is i am trying to perform some type of linear search to show the position of the row in the array. The first example has the longest row of 3 elements (3 times 1). For 1110100 the position in the array would be 0 - 2 (index) For 0110000 the position in the array would be 3 - 6 (index) I have been trying with foreaches, for loops etc..but i cannot seem to get the proper indexes of both. Cannot seem to display both positions properly. For the first example the correct output wouldbe: The largest row of same elements of the array consists of 3 elements on the position 0 - 2. The longest row of elements gets of same elements get calculated as the following: public int BerekenDeelrij (int [] table) ( int count = 0; final int value = 0; int largest = 0; foreach (int value in table) ( if (value == last value) counter + +; else ( largest = Math.Max largest (largest, counter); final value = value count = 1; ) ) Math.Max return (largest, counter); ) Best Regards.

    Read the article

  • I need to do a BASICE For Loop algorithm for a java Pyramid

    - by user1665119
    Question 2. USE THE FOR LOOP. Design and write an algorithm that will read a single positive number from the keyboard and will then print a pyramid out on the screen. The pyramid will need to be of a height equal in lines to the number inputted by the operator. Your program is not to test for negative numbers, nor is it to cater for them. For your test, use the number 7. If you would like to take the problem further, try 18 and watch what happens. Example input: 4 Example output: 1 121 12321 1234321

    Read the article

  • Spinning a circle in J2ME using a Canvas.

    - by JohnQPublic
    Hello all! I have a problem where I need to make a multi-colored wheel spin using a Canvas in J2ME. What I need to do is have the user increase the speed of the spin or slow the spin of the wheel. I have it mostly worked out (I think) but can't think of a way for the wheel to spin without causing my cellphone to crash. Here is what I have so far, it's close but not exactly what I need. class MyCanvas extends Canvas{ //wedgeOne/Two/Three define where this particular section of circle begins to be drawn from int wedgeOne; int wedgeTwo; int wedgeThree; int spinSpeed; MyCanvas(){ wedgeOne = 0; wedgeTwo = 120; wedgeThree = 240; spinSpeed = 0; } //Using the paint method to public void paint(Graphics g){ //Redraw the circle with the current wedge series. g.setColor(255,0,0); g.fillArc(getWidth()/2, getHeight()/2, 100, 100, wedgeOne, 120); g.setColor(0,255,0); g.fillArc(getWidth()/2, getHeight()/2, 100, 100, wedgeTwo, 120); g.setColor(0,0,255); g.fillArc(getWidth()/2, getHeight()/2, 100, 100, wedgeThree, 120); } protected void keyPressed(int keyCode){ switch (keyCode){ //When the 6 button is pressed, the wheel spins forward 5 degrees. case KEY_NUM6: wedgeOne += 5; wedgeTwo += 5; wedgeThree += 5; repaint(); break; //When the 4 button is pressed, the wheel spins backwards 5 degrees. case KEY_NUM4: wedgeOne -= 5; wedgeTwo -= 5; wedgeThree -= 5; repaint(); } } I have tried using a redraw() method that adds the spinSpeed to each of the wedge values while(spinSpeed0) and calls the repaint() method after the addition, but it causes a crash and lockup (I assume due to an infinite loop). Does anyone have any tips or ideas how I could automate the spin so you do not have the press the button every time you want it to spin? (P.S - I have been lurking for a while, but this is my first post. If it's too general or asking for too much info (sorry if it is) and I either remove it or fix it. Thank you!)

    Read the article

  • Can't get Jacobi algorithm to work in Objective-C

    - by Chris Long
    Hi, For some reason, I can't get this program to work. I've had other CS majors look at it and they can't figure it out either. This program performs the Jacobi algorithm (you can see step-by-step instructions and a MATLAB implementation here). BTW, it's different from the Wikipedia article of the same name. Since NSArray is one-dimensional, I added a method that makes it act like a two-dimensional C array. After running the Jacobi algorithm many times, the diagonal entries in the NSArray (i[0][0], i[1][1], etc.) are supposed to get bigger and the others approach 0. For some reason though, they all increase exponentially. For instance, i[2][4] should equal 0.0000009, not 9999999, while i[2][2] should be big. Thanks in advance, Chris NSArray+Matrix.m @implementation NSArray (Matrix) @dynamic offValue, transposed; - (double)offValue { double sum = 0.0; for ( MatrixItem *item in self ) if ( item.nonDiagonal ) sum += pow( item.value, 2.0 ); return sum; } - (NSMutableArray *)transposed { NSMutableArray *transpose = [[[NSMutableArray alloc] init] autorelease]; int i, j; for ( i = 0; i < 5; i++ ) { for ( j = 0; j < 5; j++ ) { [transpose addObject:[self objectAtRow:j andColumn:i]]; } } return transpose; } - (id)objectAtRow:(NSUInteger)row andColumn:(NSUInteger)column { NSUInteger index = 5 * row + column; return [self objectAtIndex:index]; } - (NSMutableArray *)multiplyWithMatrix:(NSArray *)array { NSMutableArray *result = [[NSMutableArray alloc] init]; int i = 0, j = 0, k = 0; double value; for ( i = 0; i < 5; i++ ) { value = 0.0; for ( j = 0; j < 5; j++ ) { for ( k = 0; k < 5; k++ ) { MatrixItem *firstItem = [self objectAtRow:i andColumn:k]; MatrixItem *secondItem = [array objectAtRow:k andColumn:j]; value += firstItem.value * secondItem.value; } MatrixItem *item = [[MatrixItem alloc] initWithValue:value]; item.row = i; item.column = j; [result addObject:item]; } } return result; } @end Jacobi_AlgorithmAppDelegate.m // ... - (void)jacobiAlgorithmWithEntry:(MatrixItem *)entry { MatrixItem *b11 = [matrix objectAtRow:entry.row andColumn:entry.row]; MatrixItem *b22 = [matrix objectAtRow:entry.column andColumn:entry.column]; double muPlus = ( b22.value + b11.value ) / 2.0; muPlus += sqrt( pow((b22.value - b11.value), 2.0) + 4.0 * pow(entry.value, 2.0) ); Vector *u1 = [[[Vector alloc] initWithX:(-1.0 * entry.value) andY:(b11.value - muPlus)] autorelease]; [u1 normalize]; Vector *u2 = [[[Vector alloc] initWithX:-u1.y andY:u1.x] autorelease]; NSMutableArray *g = [[[NSMutableArray alloc] init] autorelease]; for ( int i = 0; i <= 24; i++ ) { MatrixItem *item = [[[MatrixItem alloc] init] autorelease]; if ( i == 6*entry.row ) item.value = u1.x; else if ( i == 6*entry.column ) item.value = u2.y; else if ( i == ( 5*entry.row + entry.column ) || i == ( 5*entry.column + entry.row ) ) item.value = u1.y; else if ( i % 6 == 0 ) item.value = 1.0; else item.value = 0.0; [g addObject:item]; } NSMutableArray *firstResult = [[g.transposed multiplyWithMatrix:matrix] autorelease]; matrix = [firstResult multiplyWithMatrix:g]; } // ...

    Read the article

  • Please quickly help with this problem I got 52 minutes left.

    - by Hamish Grubijan
    Write a program that prints the numbers from 1 to 100. But for multiples of three print "Fizz" instead of the number and for the multiples of five print "Buzz". For numbers which are multiples of both three and five print "FizzBuzz". Woman said use any common language. Please make it short and test it. My screen is small. Thanks. P.S. I have test anxiety particularly after talking to people in suits. I also stayed up all night studying Java codes.

    Read the article

  • Sorting arrays in java

    - by user360706
    Write a static method in Java : public static void sortByFour (int[] arr) That receives as a paramater an array full of non-negative numbers (zero or positive) and sorts the array in the following way : In the beginning of the array all the numbers that devide by four without a remainder will appear. After them all the numbers in the array that devide by 4 with a remainder of 1 will appear. After them all the numbers in the array that devide by 4 with a remainder of 2 will appear. In the end of the array all the rest numbers (those who divide by 4 with the remainder 3) will appear. (The order of the numbers in each group doesn't matter) The method must be the most efficient it can. This is what I wrote but unfortunately it doesn't work well... :( public static void swap( int[] arr, int left, int right ) { int temp = arr[left]; arr[left] = arr[right]; arr[right] = temp; } public static void sortByFour( int[] arr ) { int left = 0; int right = ( arr.length - 1 ); int mid = ( arr.length / 2 ); while ( left < right ) { if ( ( arr[left] % 4 ) > ( arr[right] % 4 ) ) { swap( arr, left, right ); right--; } if ( ( arr[left] % 4 ) == ( arr[right] % 4 ) ) left++; else left++; } } Can someone please help me by fixing my code so that it will work well or rewriting it?

    Read the article

  • problem with join SQL Server 2000

    - by eyalb
    I have 3 tables - Items, Props, Items_To_Props i need to return all items that match all properties that i send example items 1 2 3 4 props T1 T2 T3 items_to_props 1 T1 1 T2 1 T3 2 T1 3 T1 when i send T1,T2 i need to get only item 1

    Read the article

  • Is there a work around for invalid octal digit in an array?

    - by sircrisp
    I'm trying to create an array which will hold the hours in a day so I can loop through it for a clock. I have: int hourArray[24] = {12, 01, 02, 03, 04, 05, 06, 07, 08, 09, 10, 11, 12, 01, 02, 03, 04, 05, 06, 07, 08, 09, 10, 11}; I am getting the error on the following numbers in order 08, 09, 08, 09. It tells me: Error: invalid octal digit I've never run into this before and I'm wondering if there is any way around it?

    Read the article

  • Need help with basic optimization problem

    - by ??iu
    I know little of optimization problems, so hopefully this will be didactic for me: rotors = [1, 2, 3, 4...] widgets = ['a', 'b', 'c', 'd' ...] assert len(rotors) == len(widgets) part_values = [ (1, 'a', 34), (1, 'b', 26), (1, 'c', 11), (1, 'd', 8), (2, 'a', 5), (2, 'b', 17), .... ] Given a fixed number of widgets and a fixed number of rotors, how can you get a series of widget-rotor pairs that maximizes the total value where each widget and rotor can only be used once?

    Read the article

  • complex arguments for function

    - by myPost1
    My task is to create function funCall taking four arguments : pointer for 2d array of ints that stores pairs of numbers variable int maintaining number of numbers in 2d array pointer for table of pointers to functions int variable storing info about number of pointers to functions I was thinking about something like this : typedef int(*funPtr)(int, int); funPtr arrayOfFuncPtrs[]; void funCall( *int[][]k, int a, *funPtr z, int b); { }

    Read the article

  • Help in C with integers

    - by inferno2991
    You need to use division and remainder by 10. Consider this example: 163 divided by 10 is 16 remainder 3 16 divided by 10 is 1 remainder 6 1 divided by 10 is 0 remainder 1 You'll notice the remainder is always the last digit of the number that's being divided. Now figure out a way to do this in C... How do i do it in c Help :(

    Read the article

< Previous Page | 35 36 37 38 39 40 41 42 43 44 45 46  | Next Page >