Search Results

Search found 39440 results on 1578 pages for 'possible homework'.

Page 40/1578 | < Previous Page | 36 37 38 39 40 41 42 43 44 45 46 47  | Next Page >

  • A two player game over the intranet..

    - by Santwana
    Hi everybody.. I am a student of 3rd year engineering and only a novice in my programming skills. I need some help with my project.. I wish to develop a two player game to be played over the network (Intranet). I want to develop a simple website with a few html pages for this.My ideas for the project run as follows: 1.People can log in from different systems and check who ever is online on the network currently. the page also shows who is playing with whom. 2.If a person is interested in playing with a player who is currently online, he sends a request of which the other player is somehow notified( using a message or an alert on his profile page..) 3.If the player accepts the request, a game is started. This is exactly where I am clueless.. How can I make them play the game? I need to develop a turn based game with two players, eg chessboard.. how can I do this? The game has to be played live.. and it is time tracked. i need your help with coding the above.. the other features i wish to include are: 4.The game could not be abruptly terminated by any one if the users.The request to terminate the game should be sent to the other player first and only if he accepts can the game be terminated. Whoever wins the game would get a plus 10 on their credit and if he terminated he gets a minus 10. The credits remains constant even if he loses but the success percentage is reduced. 6.The player with highest winning percentage is projected as the player of the week on the home page and he can post a challenge to all others.. I only have an intermediate knowledge of core java and know the basics of Swing and Awt. I am not at all familiar with networking in java right now. I have 5 to 6 weeks of time for developing the project but I hope to learn the things before I start my project. i would prefer to use a lan to illustrate the project and I know only java,jsp,oracle,html and bit of xml to develop my proj. Also I wish to know if I can code this within 6 weeks, would it be too difficult or complicated? Please spare some time to tell me. Please.. please.. I need your suggestions and help.. thank you so much..

    Read the article

  • errorerror C2059: syntax error : ']', i cant figure out why this coming up in c++

    - by user320950
    void display_totals(); int exam1[100][3];// array that can hold 100 numbers for 1st column int exam2[100][3];// array that can hold 100 numbers for 2nd column int exam3[100][3];// array that can hold 100 numbers for 3rd column int main() { int go,go2,go3; go=read_file_in_array; go2= calculate_total(exam1[],exam2[],exam3[]); go3=display_totals; cout << go,go2,go3; return 0; } void display_totals() { int grade_total; grade_total=calculate_total(exam1[],exam2[],exam3[]); } int calculate_total(int exam1[],int exam2[],int exam3[]) { int calc_tot,above90=0, above80=0, above70=0, above60=0,i,j; calc_tot=read_file_in_array(exam[100][3]); exam1[][]=exam[100][3]; exam2[][]=exam[100][3]; exam3[][]=exam[100][3]; for(i=0;i<100;i++); { if(exam1[i] <=90 && exam1[i] >=100) { above90++; cout << above90; } } return exam1[i],exam2[i],exam3[i]; } int read_file_in_array(int exam[100][3]) { ifstream infile; int num, i=0,j=0; infile.open("grades.txt");// file containing numbers in 3 columns if(infile.fail()) // checks to see if file opended { cout << "error" << endl; } while(!infile.eof()) // reads file to end of line { for(i=0;i<100;i++); // array numbers less than 100 { for(j=0;j<3;j++); // while reading get 1st array or element infile >> exam[i][j]; cout << exam[i][j] << endl; } } infile.close(); return exam[i][j]; }

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Please help me in creating an update query

    - by Rajesh Rolen- DotNet Developer
    I have got a table which contains 5 column and query requirements: update row no 8 (or id=8) set its column 2, column 3's value from id 9th column 2, column 3 value. means all value of column 2, 3 should be shifted to column 2, 3 of upper row (start from row no 8) and value of last row's 2, 3 will be null For example, with just 3 rows, the first row is untouched, the second to N-1th rows are shifted once, and the Nth row has nulls. id math science sst hindi english 1 11 12 13 14 15 2 21 22 23 24 25 3 31 32 33 34 35 The result of query of id=2 should be: id math science sst hindi english 1 11 12 13 14 15 2 31 32 23 24 25 //value of 3rd row (col 2,3) shifted to row 2 3 null null 33 34 35 This process should run for all rows whose id 2 Please help me to create this update query I am using MS sqlserver 2005

    Read the article

  • Can't get Jacobi algorithm to work in Objective-C

    - by Chris Long
    Hi, For some reason, I can't get this program to work. I've had other CS majors look at it and they can't figure it out either. This program performs the Jacobi algorithm (you can see step-by-step instructions and a MATLAB implementation here). BTW, it's different from the Wikipedia article of the same name. Since NSArray is one-dimensional, I added a method that makes it act like a two-dimensional C array. After running the Jacobi algorithm many times, the diagonal entries in the NSArray (i[0][0], i[1][1], etc.) are supposed to get bigger and the others approach 0. For some reason though, they all increase exponentially. For instance, i[2][4] should equal 0.0000009, not 9999999, while i[2][2] should be big. Thanks in advance, Chris NSArray+Matrix.m @implementation NSArray (Matrix) @dynamic offValue, transposed; - (double)offValue { double sum = 0.0; for ( MatrixItem *item in self ) if ( item.nonDiagonal ) sum += pow( item.value, 2.0 ); return sum; } - (NSMutableArray *)transposed { NSMutableArray *transpose = [[[NSMutableArray alloc] init] autorelease]; int i, j; for ( i = 0; i < 5; i++ ) { for ( j = 0; j < 5; j++ ) { [transpose addObject:[self objectAtRow:j andColumn:i]]; } } return transpose; } - (id)objectAtRow:(NSUInteger)row andColumn:(NSUInteger)column { NSUInteger index = 5 * row + column; return [self objectAtIndex:index]; } - (NSMutableArray *)multiplyWithMatrix:(NSArray *)array { NSMutableArray *result = [[NSMutableArray alloc] init]; int i = 0, j = 0, k = 0; double value; for ( i = 0; i < 5; i++ ) { value = 0.0; for ( j = 0; j < 5; j++ ) { for ( k = 0; k < 5; k++ ) { MatrixItem *firstItem = [self objectAtRow:i andColumn:k]; MatrixItem *secondItem = [array objectAtRow:k andColumn:j]; value += firstItem.value * secondItem.value; } MatrixItem *item = [[MatrixItem alloc] initWithValue:value]; item.row = i; item.column = j; [result addObject:item]; } } return result; } @end Jacobi_AlgorithmAppDelegate.m // ... - (void)jacobiAlgorithmWithEntry:(MatrixItem *)entry { MatrixItem *b11 = [matrix objectAtRow:entry.row andColumn:entry.row]; MatrixItem *b22 = [matrix objectAtRow:entry.column andColumn:entry.column]; double muPlus = ( b22.value + b11.value ) / 2.0; muPlus += sqrt( pow((b22.value - b11.value), 2.0) + 4.0 * pow(entry.value, 2.0) ); Vector *u1 = [[[Vector alloc] initWithX:(-1.0 * entry.value) andY:(b11.value - muPlus)] autorelease]; [u1 normalize]; Vector *u2 = [[[Vector alloc] initWithX:-u1.y andY:u1.x] autorelease]; NSMutableArray *g = [[[NSMutableArray alloc] init] autorelease]; for ( int i = 0; i <= 24; i++ ) { MatrixItem *item = [[[MatrixItem alloc] init] autorelease]; if ( i == 6*entry.row ) item.value = u1.x; else if ( i == 6*entry.column ) item.value = u2.y; else if ( i == ( 5*entry.row + entry.column ) || i == ( 5*entry.column + entry.row ) ) item.value = u1.y; else if ( i % 6 == 0 ) item.value = 1.0; else item.value = 0.0; [g addObject:item]; } NSMutableArray *firstResult = [[g.transposed multiplyWithMatrix:matrix] autorelease]; matrix = [firstResult multiplyWithMatrix:g]; } // ...

    Read the article

  • Why does this code sample produce a memory leak?

    - by citronas
    In the university we were given the following code sample and we were being told, that there is a memory leak when running this code. The sample should demonstrate that this is a situation where the garbage collector can't work. As far as my object oriented programming goes, the only codeline able to create a memory leak would be items=Arrays.copyOf(items,2 * size+1); The documentation says, that the elements are copied. Does that mean the reference is copied (and therefore another entry on the heap is created) or the object itself is being copied? As far as I know, Object and therefore Object[] are implemented as a reference type. So assigning a new value to 'items' would allow the garbage collector to find that the old 'item' is no longer referenced and can therefore be collected. In my eyes, this the codesample does not produce a memory leak. Could somebody prove me wrong? =) import java.util.Arrays; public class Foo { private Object[] items; private int size=0; private static final int ISIZE=10; public Foo() { items= new Object[ISIZE]; } public void push(final Object o){ checkSize(); items[size++]=o; } public Object pop(){ if (size==0) throw new ///... return items[--size]; } private void checkSize(){ if (items.length==size){ items=Arrays.copyOf(items,2 * size+1); } } }

    Read the article

  • Does python have a session variable concept???

    - by gizgok
    I have a datetime.date variable in python.I need to pass it to a function do operations according to the date given and then increment the date for the next set of operations.The problem is I have to do the operations in diff pages and hence I need the date as a variable which can go from page to page. Can we do this in python.......

    Read the article

  • what is the best algorithm to use for this problem

    - by slim
    Equilibrium index of a sequence is an index such that the sum of elements at lower indexes is equal to the sum of elements at higher indexes. For example, in a sequence A: A[0]=-7 A[1]=1 A[2]=5 A[3]=2 A[4]=-4 A[5]=3 A[6]=0 3 is an equilibrium index, because: A[0]+A[1]+A[2]=A[4]+A[5]+A[6] 6 is also an equilibrium index, because: A[0]+A[1]+A[2]+A[3]+A[4]+A[5]=0 (sum of zero elements is zero) 7 is not an equilibrium index, because it is not a valid index of sequence A. If you still have doubts, this is a precise definition: the integer k is an equilibrium index of a sequence if and only if and . Assume the sum of zero elements is equal zero. Write a function int equi(int[] A); that given a sequence, returns its equilibrium index (any) or -1 if no equilibrium indexes exist. Assume that the sequence may be very long.

    Read the article

  • My PHP script for sending emails wont send

    - by James
    Well I'm working on a school project, and I uploaded my script to send emails. I'm pretty much using whats defined here: http://www.webcheatsheet.com/PHP/send_email_text_html_attachment.php . Now, all I really changed(other than the contents), is the receiver, to my email address. However, I'm not getting it in my inbox. Is there something else I need? Do I need to do something with the settings on the server(or have my school enable something)?

    Read the article

  • m:n relationship must have properties?

    - by nax
    I'm doing a E/R model for a project. I finished the ER model and, for me, all is okay. Maybe not perfect, but it's okay. When I gave the ER model to my teacher, he told me this: "the m:n relations MUST HAVE some properties" He said if the m:n relationship doesn't have the properties it will be wrong. In my opinion m:n doesn't need forcer attributes to the relationship, but if you have someone that can fit in it, just put there. What do you think? Who is wrong in this, me, or my teacher? NOTE: Reading again, it seems what he said was not due to my ER diagram, but was a general statement. The diagram I gave him doesn't have relations yet, so there where just entities and atributes.

    Read the article

  • Constructor/Destructor involving a class and a struct

    - by Bogdan Maier
    I am working on a program and need to make an array of objects, specifically I have a 31x1 array where each position is an object, (each object is basically built out of 6 ints). Here is what I have but something is wrong and i could use some help thank you. 31x1 struct header" const int days=31; struct Arr{ int days; int *M; }; typedef Arr* Array; 31x1 matrix constructor: void constr(){ int *M; M = new Expe[31]; // Expe is the class class header: class Expe { private: //0-HouseKeeping, 1-Food, 2-Transport, 3-Clothing, 4-TelNet, 5-others int *obj; } Class object constructor: Expe::Expe() { this->obj=new int[6]; } help please... because i`m pretty lost.

    Read the article

  • C# Finding 2 positions 1-dimArray

    - by Chris
    Hello, In a method i am calculating the longest row of elements. The 1-dim array is filled up with random values (0 or 1). The method looks up the longest row (being 0 or 1, whatever is the longest). Meaning in for example: 1110100 --> the longest row would be 3 (3 * 1) 0110000 --> the longest row would be 4 (4 * 0) My problem is i am trying to perform some type of linear search to show the position of the row in the array. The first example has the longest row of 3 elements (3 times 1). For 1110100 the position in the array would be 0 - 2 (index) For 0110000 the position in the array would be 3 - 6 (index) I have been trying with foreaches, for loops etc..but i cannot seem to get the proper indexes of both. Cannot seem to display both positions properly. For the first example the correct output wouldbe: The largest row of same elements of the array consists of 3 elements on the position 0 - 2. The longest row of elements gets of same elements get calculated as the following: public int BerekenDeelrij (int [] table) ( int count = 0; final int value = 0; int largest = 0; foreach (int value in table) ( if (value == last value) counter + +; else ( largest = Math.Max largest (largest, counter); final value = value count = 1; ) ) Math.Max return (largest, counter); ) Best Regards.

    Read the article

  • Is there a work around for invalid octal digit in an array?

    - by sircrisp
    I'm trying to create an array which will hold the hours in a day so I can loop through it for a clock. I have: int hourArray[24] = {12, 01, 02, 03, 04, 05, 06, 07, 08, 09, 10, 11, 12, 01, 02, 03, 04, 05, 06, 07, 08, 09, 10, 11}; I am getting the error on the following numbers in order 08, 09, 08, 09. It tells me: Error: invalid octal digit I've never run into this before and I'm wondering if there is any way around it?

    Read the article

  • Spinning a circle in J2ME using a Canvas.

    - by JohnQPublic
    Hello all! I have a problem where I need to make a multi-colored wheel spin using a Canvas in J2ME. What I need to do is have the user increase the speed of the spin or slow the spin of the wheel. I have it mostly worked out (I think) but can't think of a way for the wheel to spin without causing my cellphone to crash. Here is what I have so far, it's close but not exactly what I need. class MyCanvas extends Canvas{ //wedgeOne/Two/Three define where this particular section of circle begins to be drawn from int wedgeOne; int wedgeTwo; int wedgeThree; int spinSpeed; MyCanvas(){ wedgeOne = 0; wedgeTwo = 120; wedgeThree = 240; spinSpeed = 0; } //Using the paint method to public void paint(Graphics g){ //Redraw the circle with the current wedge series. g.setColor(255,0,0); g.fillArc(getWidth()/2, getHeight()/2, 100, 100, wedgeOne, 120); g.setColor(0,255,0); g.fillArc(getWidth()/2, getHeight()/2, 100, 100, wedgeTwo, 120); g.setColor(0,0,255); g.fillArc(getWidth()/2, getHeight()/2, 100, 100, wedgeThree, 120); } protected void keyPressed(int keyCode){ switch (keyCode){ //When the 6 button is pressed, the wheel spins forward 5 degrees. case KEY_NUM6: wedgeOne += 5; wedgeTwo += 5; wedgeThree += 5; repaint(); break; //When the 4 button is pressed, the wheel spins backwards 5 degrees. case KEY_NUM4: wedgeOne -= 5; wedgeTwo -= 5; wedgeThree -= 5; repaint(); } } I have tried using a redraw() method that adds the spinSpeed to each of the wedge values while(spinSpeed0) and calls the repaint() method after the addition, but it causes a crash and lockup (I assume due to an infinite loop). Does anyone have any tips or ideas how I could automate the spin so you do not have the press the button every time you want it to spin? (P.S - I have been lurking for a while, but this is my first post. If it's too general or asking for too much info (sorry if it is) and I either remove it or fix it. Thank you!)

    Read the article

  • Need help with basic optimization problem

    - by ??iu
    I know little of optimization problems, so hopefully this will be didactic for me: rotors = [1, 2, 3, 4...] widgets = ['a', 'b', 'c', 'd' ...] assert len(rotors) == len(widgets) part_values = [ (1, 'a', 34), (1, 'b', 26), (1, 'c', 11), (1, 'd', 8), (2, 'a', 5), (2, 'b', 17), .... ] Given a fixed number of widgets and a fixed number of rotors, how can you get a series of widget-rotor pairs that maximizes the total value where each widget and rotor can only be used once?

    Read the article

  • Cart coding help

    - by user228390
    I've made a simple Javascript code for a shopping basket but now I have realised that I have made a error with making it and don't know how to fix it. What I have is Javascript file but I have also included the images source and the addtocart button as well, but What I am trying to do now is make 2 files one a .HTML file and another .JS file, but I can't get it to because when I make a button in the HTML file to call the function from the .JS file it won't work at all. <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01//EN" "http://www.w3.org/TR/html4/strict.dtd"> <HTML> <HEAD><TITLE>shopping</TITLE> <META http-equiv=Content-Type content="text/html; charset=UTF-8"> <STYLE type=text/CSS> fieldset{width:300px} legend{font-size:24px;font-family:comic sans ms;color:#004455} </STYLE> <META content="MSHTML 6.00.2900.2963" name=GENERATOR></HEAD> <BODY scroll="auto"> <div id="products"></div><hr> <div id="inCart"></div> <SCRIPT type="text/javascript"> var items=['Xbox~149.99','StuffedGizmo~19.98','GadgetyGoop~9.97']; var M='?'; var product=[]; var price=[]; var stuff=''; function wpf(product,price){var pf='<form><FIELDSET><LEGEND>'+product+'</LEGEND>'; pf+='<img src="../images/'+product+'.jpg" alt="'+product+'" ><p>price '+M+''+price+'</p> <b>Qty</b><SELECT>'; for(i=0;i<6;i++){pf+='<option value="'+i+'">'+i+'</option>'} pf+='</SELECT>'; pf+='<input type="button" value="Add to cart" onclick="cart()" /></FIELDSET></form>'; return pf } for(j=0;j<items.length;j++){ product[j]=items[j].substring(0,items[j].indexOf('~')); price[j]=items[j].substring(items[j].indexOf('~')+1,items[j].length); stuff+=''+wpf(product[j],price[j])+''; } document.getElementById('products').innerHTML=stuff; function cart(){ var order=[]; var tot=0 for(o=0,k=0;o<document.forms.length;o++){ if(document.forms[o].elements[1].value!=0){ qnty=document.forms[o].elements[1].value; order[k]=''+product[o]+'_'+qnty+'*'+price[o]+''; tot+=qnty*price[o];k++ } } document.getElementById('inCart').innerHTML=order.join('<br>')+'<h3>Total '+tot+'</h3>'; } </SCRIPT> <input type="button" value="Add to cart" onclick="cart()" /></FIELDSET></form> </BODY></HTML>

    Read the article

  • How to calculate "holes" in timetable

    - by genesiss
    I've got a 2-dimensional array like this (it represents a timetable): http://www.shrani.si/f/28/L6/37YvFye/timetable.png Orange cells are lectures and whites are free time. How could I calculate number of free hours between lectures in the same day? (columns are days and rows are hours) For example, in this table the result should be: 2 for first column 0 for second colum -- The function returns 2 (because 2+0=2)

    Read the article

< Previous Page | 36 37 38 39 40 41 42 43 44 45 46 47  | Next Page >