Search Results

Search found 11380 results on 456 pages for 'cpu speed'.

Page 390/456 | < Previous Page | 386 387 388 389 390 391 392 393 394 395 396 397  | Next Page >

• How to modernize an enormous legacy database?

  - by smayers81

  I have a question, just looking for suggestions here. So, my application is 'modernizing' a desktop application by converting it to the web, with an ICEFaces UI and server side written in Java. However, they are keeping around the same Oracle database, which at current count has about 700-900 tables and probably a billion total records in the tables. Some individual tables have 250 million rows, many have over 25 million. Needless to say, the database is not scaling well. As a result, the performance of the application is looking to be abysmal. The architects / decision makers-that-be have all either refused or are unwilling to restructure the persistence. So, basically we are putting a fresh coat of paint on a functional desktop application that currently serves most user needs and does so with relative ease and quick performance. I am having trouble sleeping at night thinking of how poorly this application is going to perform and how difficult it is going to be for everyday users to do their job. So, my question is, what options do I have to mitigate this impending disaster? Is there some type of intermediate layer I can put in between the database and the Java code to speed up performance while at the same time keeping the database structure intact? Caching is obviously an option, but I don't see that as being a cure-all. Is it possible to layer a NoSQL DB in between or something?

  Read the article

• Loading a RSA private key from memory using libxmlsec

  - by ereOn

  Hello, I'm currently using libxmlsec into my C++ software and I try to load a RSA private key from memory. To do this, I searched trough the API and found this function. It takes binary data, a size, a format string and several PEM-callback related parameters. When I call the function, it just stucks, uses 100% of the CPU time and never returns. Quite annoying, because I have no way of finding out what is wrong. Here is my code: d_xmlsec_dsig_context->signKey = xmlSecCryptoAppKeyLoadMemory( reinterpret_cast<const xmlSecByte*>(data), static_cast<xmlSecSize>(datalen), xmlSecKeyDataFormatBinary, NULL, NULL, NULL ); data is a const char* pointing to the raw bytes of my RSA key (using i2d_RSAPrivateKey(), from OpenSSL) and datalen the size of data. My test private key doesn't have a passphrase so I decided not to use the callbacks for the time being. Has someone already done something similar ? Do you guys see anything that I could change/test to get forward on this problem ? I just discovered the library on yesterday, so I might miss something obvious here; I just can't see it. Thank you very much for your help.

  Read the article

• Delphi threads deadlock

  - by Lobuno

  Hello! I am having a problem sometimes with a deadlock when destroying some threads. I've tried to debug the problem but the deadlock never seems to exist when debugging in the IDE, perhaps because of the low speed of the events in the ide. The problem: The main thread creates several threads when the application starts. The threads are always alive and synchronizing with the main thread. No problems at all. The threads are destroyed when the applcation ends (mainform.onclose) like this: thread1.terminate; thread1.waitfor; thread1.free; and so on. but some times one of the threads (which logs some string to a memo, using synchronize) will lock the whole application when closing. I suspect that the thread is synchronizing when I call waitform and the harmaggeddon happens, but that's is just a guess because the deadlock never happens when debbuging (or I've never been able to reproduce it anyway). Any advice?

  Read the article

• JSON: Jackson stream parser - is it really worth it?

  - by synic

  I'm making pretty heavy use of JSON parsing in an app I'm writing. Most of what I have done is already implemented using Android's built in JSONObject library (is it json-lib?). JSONObject appears to create instances of absolutely everything in the JSON string... even if I don't end up using all of them. My app currently runs pretty well, even on a G1. My question is this: are the speed and memory benefits from using a stream parser like Jackson worth all the trouble? By trouble, I mean this: As far as I can tell, there are three downsides to using Jackson instead of the built in library: Dependency on an external library. This makes your .apk bigger in the end. Not a huge deal. Your app is more fragile. Since the parsing is not done automatically, it is more vulnerable to changes in the JSON text that it's parsing. I'm extremely worried that malformed JSON will result in infinite loops (as pull parsing requires a lot of while loops). Writing code to parse JSON via a stream parser is ugly and tedious.

  Read the article

• How to temporarily replace one primitive type with another when compiling to different targets in c#

  - by Keith

  How to easily/quickly replace float's for doubles (for example) for compiling to two different targets using these two particular choices of primitive types? Discussion: I have a large amount of c# code under development that I need to compile to alternatively use float, double or decimals depending on the use case of the target assembly. Using something like “class MYNumber : Double” so that it is only necessary to change one line of code does not work as Double is sealed, and obviously there is no #define in C#. Peppering the code with #if #else statements is also not an option, there is just too much supporting Math operators/related code using these particular primitive types. I am at a loss on how to do this apparently simple task, thanks! Edit: Just a quick comment in relation to boxing mentioned in Kyles reply: Unfortunately I need to avoid boxing, mainly since float's are being chosen when maximum speed is required, and decimals when maximum accuracy is the priority (and taking the 20x+ performance hit is acceptable). Boxing would probably rules out decimals as a valid choice and defeat the purpose somewhat. Edit2: For reference, those suggesting generics as a possible answer to this question note that there are many issues which count generics out (at least for our needs). For an overview and further references see Using generics for calculations

  Read the article

• iPhone - dequeueReusableCellWithIdentifier usage

  - by Jukurrpa

  Hi, I'm working on a iPhone app which has a pretty large UITableView with data taken from the web, so I'm trying to optimize its creation and usage. I found out that dequeueReusableCellWithIdentifier is pretty useful, but after seeing many source codes using this, I'm wondering if the usage I make of this function is the good one. Here is what people usually do: UITableViewCell* cell = [tableView dequeueReusableCellWithIdentifier:@"Cell"]; if (cell == nil) { cell = [[UITableViewCell alloc] initWithFrame:CGRectZero reuseIdentifier:@"Cell"]; // Add elements to the cell return cell; And here is the way I did it: NSString identifier = [NSString stringWithFormat:@"Cell @d", indexPath.row]: // The cell row UITableViewCell* cell = [tableView dequeueReusableCellWithIdentifier:identifier]; if (cell != nil) return cell; cell = [[UITableViewCell alloc] initWithFrame:CGRectZero reuseIdentifier:identifier]; // Add elements to the cell return cell; The difference is that people use the same identifier for every cell, so dequeuing one only avoids to alloc a new one. For me, the point of queuing was to give each cell a unique identifier, so when the app asks for a cell it already displayed, neither allocation nor element adding have to be done. In fine I don't know which is best, the "common" method ceils the table's memory usage to the exact number of cells it display, whislt the method I use seems to favor speed as it keeps all calculated cells, but can cause large memory consumption (unless there's an inner limit to the queue). Am I wrong to use it this way? Or is it just up to the developper, depending on his needs?

  Read the article

• Is there any special tool for interactive GUI development

  - by niko

  Hi, Currently I am preparing exercises about networks and mobile communications for students. I was thinking about creating an interactive user-interface which enables the user to drag&drop predefined elements and then implement a logic based upon element distances etc. An example would be to place two base stations (a predefined element with several properties), set the scale in the interface and then check the signal interferrence in the environment (user-interface). The first part might be too abstract whereas the example might be too specific, but I was wondering whether there already exists any friendly framework or language which enables developers to create interactive interfaces (for teaching/learning purpouses) in short ammount of time. Usually I write applications for PC environment in .NET but in this case it would take too much time to create a specific interface for every exercise. I would appreciate if anyone could suggest any way to create interactive user-interface in short ammount of time. Are there any special programming languages or development tools for this kind of applications or are there any useful frameworks for .NET, Java or any other language to speed up the development of user-interfaces? Thank you!

  Read the article

• LINQ compiled query DataBind issue

  - by Brian

  Hello All, I have a pretty extensive reporting page that uses LINQ. There is one main function that returns an IQueryable object. I then further filter / aggregate the returned query depending on the report the user needs. I changed this function to a compiled query, it worked great, and the speed increase was astonishing. The only problem comes when i want to databind the results. I am databinding to a standard asp.net GridView and it works fine, no problems. I am also databinding to an asp.net chart control, this is where my page is throwing an error. this works well: GridView gv = new GridView(); gv.DataSource = gridSource; But this does not: Series s1 = new Series("Series One"); s1.Points.DataBindXY(gridSource, "Month", gridSource, "Success"); The error i receive is this: System.NotSupportedException Specified method is not supported When i look into my gridSource var at run time i see this using a typical linq query: SELECT [t33].[value2] AS [Year], [t33].[value22] AS [Month], [t33].[value3] AS [Calls]...... I see this after i change the query to compiled: {System.Linq.OrderedEnumerable<<>f__AnonymousType15<string,int,int,int,int,int,int,int>,string>} This is obviously the reason why the databindxy is no longer working, but i am not sure how to get around it. Any help would be appreciated! Thanks

  Read the article

• Vote on Pros and Cons of Java HTML to XML cleaners

  - by George Bailey

  I am looking to allow HTML emails (and other HTML uploads) without letting in scripts and stuff. I plan to have a white list of safe tags and attributes as well as a whitelist of CSS tags and value regexes (to prevent automatic return receipt). I asked a question: Parse a badly formatted XML document (like an HTML file) I found there are many many ways to do this. Some systems have built in sanitizers (which I don't care so much about). This page is a very nice listing page but I get kinda lost http://java-source.net/open-source/html-parsers It is very important that the parsers never throw an exception. There should always be best guess results to the parse/clean. It is also very important that the result is valid XML that can be traversed in Java. I posted some product information and said Community Wiki. Please post any other product suggestions you like and say Community Wiki so they can be voted on. Also any comments or wiki edits on what part of a certain product is better and what is not would be greatly appreciated. (for example,, speed vs accuracy..) It seems that we will go with either jsoup (seems more active and up to date) or TagSoup (compatible with JDK4 and been around awhile). A +1 for any of these products would be if they could convert all style sheets into inline style on the elements.

  Read the article

• python / sqlite - database locked despite large timeouts

  - by Chris Phillips

  Hi, I'm sure I'm missing something pretty obvious, but I can't for the life of me stop my pysqlite scripts crashing out with a database is locked error. I have two scripts, one to load data into the database, and one to read data out, but both will frequently, and instantly, crash depending on what the other is doing with the database at any given time. I've got the timeout on both scripts set to 30 seconds: cx = sqlite.connect("database.sql", timeout=30.0) and think I can see some evidence of the timeouts in that i get what appears to be a timing stamp (e.g 0.12343827e-06 0.1 - and how do I stop that being printed?) dumped occasionally in the middle of my curses formatted output screen, but no delay that ever gets remotely near the 30 second timeout, but still one of the other keeps crashing again and again from this. I'm running RHEL5.4 on a 64 bit 4 cpu HS21 IBM blade, and have heard some mention about issues about multi-threading and am not sure if this might be relevant. Packages in use are sqlite-3.3.6-5 and python-sqlite-1.1.7-1.2.1, and upgrading to newer versions outside of RedHat's official provisions is not a great option for me. Possible, but not desirable due to the environment in general. I have had autocommit=1 on previously on both scripts, but have since disabled on both, and am now cx.commit()ing on the inserting script and not committing on the select script. Ultimately as I only ever have one script actually making any modifications, I don't really see why this locking should ever ever happen. I have noticed that this is significantly worse over time when the database has gotten larger. It was recently at 13mb with 3 equal sized tables, which was about 1 day's worth of data. creating a new file has significantly improved this, which seems understandable, but the timeout ultimately just doesn't seem to be being obeyed. Any pointers very much appreciated. Thanks Chris

  Read the article

• What is more viable to use? Javascript libraries or UI Programming tools?

  - by Haresh Karkar

  What is more viable to use:- Javascript Libraries: YUI, jQuery, ExtJs OR UI Programming tools: GWT, ExtGWT, SmartGWT It has become very difficult to choose between them as they are constantly increasing their capabilities to meet newer requirements. We all know the power of jQuery in UI manipulations. The latest news from Microsoft about jQuery being officially part of .Net developr’s toolkit will definitely make jQuery a preferred choice against other JavaScript libraries [See link: http://weblogs.asp.net/scottgu/archive/2008/09/28/jquery-and-microsoft.aspx]. But on the other hand, GWT is building a framework which could be used on client as well as on the sever side. This is definitely going to make developers’ life easy as it does not require developer to be an expert in browser quirks, XMLHttpRequest, and JavaScript in order to develop high-performance web applications. It includes SDK (Java API libraries, compiler, and development server which allows to write client-side applications in Java and deploy them as JavaScript), Speed Tracer and plug-in for Eclipse. GWT is used by many products like Google Wave and AdWords. So question is still un-answered, what is more viable to use? Any thoughts?

  Read the article

• YUI: ensuring DOM elements and scripts are ready

  - by dound

  If I put my inline script after the DOM elements it interacts with, should I still use YUI 3's domready event? I haven't noticed any problems, and it seems like I can count on the browser loading the page sequentially. (I already use YUI().use('node', ... to make sure the YUI functions I need have been loaded since the YUI script is a separate file.) Is there a way to speed up the loading of widgets like YUI 2's calendar? I load the appropriate script in <head> element of my page. I use YUI().use('yui2-calendar', ... to make sure the Calendar widget is available. Unfortunately, this causes a short but noticeable delay when I load my page with the calendar. If I omit the YUI().use('yui2-calendar', ... code then it shows up without a noticeable delay - but I guess this could cause the Calendar to not show up at all if the YUI script doesn't load in time? With regards to #2, is it possible to reduce the visual artifact of the calendar not being present and then showing up? I've made it slightly better by specifying a height and width for the parent div so that at least the space is already allocated = minimal shifting around when it does load.

  Read the article

• WCF Double Hop questions about Security and Binding.

  - by Ken Maglio

  Background information: .Net Website which calls a service (aka external service) facade on an app server in the DMZ. This external service then calls the internal service which is on our internal app server. From there that internal service calls a stored procedure (Linq to SQL Classes), and passes the serialized data back though to the external service, and from there back to the website. We've done this so any communication goes through an external layer (our external app server) and allows interoperability; we access our data just like our clients consuming our services. We've gotten to the point in our development where we have completed the system and it all works, the double hop acts as it should. However now we are working on securing the entire process. We are looking at using TransportWithMessageCredentials. We want to have WS2007HttpBinding for the external for interoperability, but then netTCPBinding for the bridge through the firewall for security and speed. Questions: If we choose WS2007HttpBinding as the external services binding, and netTCPBinding for the internal service is this possible? I know WS-* supports this as does netTCP, however do they play nice when passing credential information like user/pass? If we go to Kerberos, will this impact anything? We may want to do impersonation in the future. If you can when you answer post any reference links about why you're answering the way you are, that would be very helpful to us. Thanks!

  Read the article

• Error displaying a WinForm in Design mode with a custom control on it.

  - by George

  I have a UserControl that is part of a Class library. I reference this project from my solution. This adds a control from the referenced project to my toolbox. I add tghe control to a form. Everything looks good, I compile all and run. Perfect... But when I close the .frm with the control on it and re-open it, I get this error. The code continues to run. It may have something to do with namespaces. The original namespace was simply "Design" and this was ambiguous and conflicting so i decided to rename it. I think that's when my problems began. To prevent possible data loss before loading the designer, the following errors must be resolved: 2 Errors Ignore and Continue Why am I seeing this page? Could not find type 'Besi.Winforms.HtmlEditor.Editor'. Please make sure that the assembly that contains this type is referenced. If this type is a part of your development project, make sure that the project has been successfully built using settings for your current platform or Any CPU. Instances of this error (1) 1. There is no stack trace or error line information available for this error. Help with this error Could not find an associated help topic for this error. Check Windows Forms Design-Time error list Forum posts about this error Search the MSDN Forums for posts related to this error The variable 'Editor1' is either undeclared or was never assigned. Go to code Instances of this error (1) 1. BesiAdmin frmOrder.Designer.vb Line:775 Column:1 Show Call Stack at System.ComponentModel.Design.Serialization.CodeDomSerializerBase.Error(IDesignerSerializationManager manager, String exceptionText, String helpLink) at System.ComponentModel.Design.Serialization.CodeDomSerializerBase.DeserializeExpression(IDesignerSerializationManager manager, String name, CodeExpression expression) at System.ComponentModel.Design.Serialization.CodeDomSerializerBase.DeserializeExpression(IDesignerSerializationManager manager, String name, CodeExpression expression) at System.ComponentModel.Design.Serialization.CodeDomSerializerBase.DeserializeStatement(IDesignerSerializationManager manager, CodeStatement statement) Help with this error MSDN Help Forum posts about this error Search the MSDN Forums for posts related to this error

  Read the article

• GAE Task Queue oddness

  - by b3nw

  I have been testing the taskqueue with mixed success. Currently I am using the default queue, in default settings ect ect.... I have a test url setup which inserts about 8 tasks into the queue. With short order, all 8 are completed properly. So far so good. The problem comes up when I re-load that url twice under say a minute. Now watching the task queue, all the tasks are added properly, but only the first batch execute it seems. But the "Run in Last Minute" # shows the right number of tasks being run.... The request logs tell a different story. They show only the first set of 8 running, but all task creation urls working successfully. The oddness of this is that if I wait say a minute between the task creation url requests, it will work fine. Oddly enough changing the bucket_size or execution speed does not seem to help. Only the first batch are executed. I have also reduced the number of requests all the way down to 2, and still found only the first 2 execute. Any others added display the same issues as above. Any suggestions? Thanks

  Read the article

• Is SQLDataReader slower than using the command line utility sqlcmd?

  - by Andrew

  I was recently advocating to a colleague that we replace some C# code that uses the sqlcmd command line utility with a SqlDataReader. The old code uses: System.Diagnostics.ProcessStartInfo procStartInfo = new System.Diagnostics.ProcessStartInfo("cmd", "/c " + sqlCmd); wher sqlCmd is something like "sqlcmd -S " + serverName + " -y 0 -h-1 -Q " + "\"" + "USE [" + database + "]" + ";+ txtQuery.Text +"\"";\ The results are then parsed using regular expressions. I argued that using a SQLDataReader woud be more in line with industry practices, easier to debug and maintain and probably faster. However, the SQLDataReader approach is at least the same speed and quite possibly slower. I believe I'm doing everything correctly with SQLDataReader. The code is: using (SqlConnection connection = new SqlConnection()) { try { SqlConnectionStringBuilder builder = new SqlConnectionStringBuilder(connectionString); connection.ConnectionString = builder.ToString(); ; SqlCommand command = new SqlCommand(queryString, connection); connection.Open(); SqlDataReader reader = command.ExecuteReader(); // do stuff w/ reader reader.Close(); } catch (Exception ex) { outputMessage += (ex.Message); } } I've used System.Diagnostics.Stopwatch to time both approaches and the command line utility (called from C# code) does seem faster (20-40%?). The SqlDataReader has the neat feature that when the same code is called again, it's lightening fast, but for this application we don't anticipate that. I have already done some research on this problem. I note that the command line utility sqlcmd uses OLE DB technology to hit the database. Is that faster than ADO.NET? I'm really suprised, especially since the command line utility approach involves starting up a process. I really thought it would be slower. Any thoughts? Thanks, Dave

  Read the article

• Extremely slow MFMailComposeViewControllerDelegate

  - by Jeff B

  I have a bit of a strange problem. I am trying to send in-app email. I am also using Cocos2d. It works, so far as I get the mail window and I can send mail, but it is extremely slow. It seems to only accept touches every second or so. I checked the cpu usage, and it is quite low. I paused my director, so nothing else should be happening. Any ideas? I am pulling my hair out. I looked at some examples and did the following: Made my scene the mail delegate: @interface MyLayer : CCLayer <MFMailComposeViewControllerDelegate> { ... } And implemented the following function in the scenes: -(void) showEmailWindow: (id) sender { [[CCDirector sharedDirector] pause]; MFMailComposeViewController *picker = [[MFMailComposeViewController alloc] init]; picker.mailComposeDelegate = self; [picker setSubject: @"My subject here"]; NSString *emailBody = @"<h1>Here is my email!</h1>"; [picker setMessageBody:emailBody isHTML:YES]; [myMail presentModalViewController:picker animated:NO]; [picker release]; } I also implemented the mailComposeController, to handle the callback.

  Read the article

• Infinite loop in regex in java

  - by carpediem

  Hello, My purpose is to match this kind of different urls: url.com my.url.com my.extended.url.com a.super.extended.url.com and so on... So, I decided to build the regex to have a letter or a number at start and end of the url, and to have a infinite number of "subdomains" with alphanumeric characters and a dot. For example, in "my.extended.url.com", "m" from "my" is the first class of the regex, "m" from "com" is the last class of the regex, and "y.", "extended." and "url." are the second class of the regex. Using the pattern and subject in the code below, I want the find method to return me a false because this url must not match, but it uses 100% of CPU and seems to stay in an infinite loop. String subject = "www.association-belgo-palestinienne-be"; Pattern pattern = Pattern.compile("^[A-Za-z0-9]\\.?([A-Za-z0-9_-]+\\.?)*[A-Za-z0-9]\\.[A-Za-z]{2,6}"); Matcher m = pattern.matcher(subject); System.out.println(" Start"); boolean hasFind = m.find(); System.out.println(" Finish : " + hasFind); Which only prints: Start I can't reproduce the problem using regex testers. Is it normal ? Is the problem coming from my regex ? Could it be due to my Java version (1.6.0_22-b04 / JVM 64 bit 17.1-b03) ? Thanks in advance for helping.

  Read the article

• What strategy do you use to sync your code when working from home

  - by Ben Daniel

  At my work I currently have my development environment inside a Virtual Machine. When I need to do work from home I copy my VM and any databases I need onto a laptop drive sized external USB drive. After about 10 minutes of copying I put the drive in my pocket and head home, copy back the VM and databases onto my personal computer and I'm ready to work. I follow the same steps to take the work back with me. So if I count the total amount of time I spend waiting around for files to finish copying in order for me to take work home and bring it back again, it comes to around 40 minutes! I do have a VPN connection to my work from home (providing the internet is up at both sites) and a decent internet speed (8mbits down/?up) but I find Remote Desktoping into my work machine laggy enough for me to want to work on my VM directly. So in looking at what other options I have or how I could improve my existing option I'm interested in what strategy you use or recommend to do work at home and keeping your code/environment in sync. EDIT: I'd prefer an option where I don't have to commit my changes into version control before I leave work - as I like to make meaningful descriptive comments in my commits, committing would take longer than just copying my VM onto a portable drive! lol Also I'd prefer a solution where my dev environment stays in sync too. Having said that I'm still very interested in your own solutions even if they don't exactly solve my problem as best as I'd like. :)

  Read the article

• Haskell Linear Algebra Matrix Library for Arbitrary Element Types

  - by Johannes Weiß

  I'm looking for a Haskell linear algebra library that has the following features: Matrix multiplication Matrix addition Matrix transposition Rank calculation Matrix inversion is a plus and has the following properties: arbitrary element (scalar) types (in particular element types that are not Storable instances). My elements are an instance of Num, additionally the multiplicative inverse can be calculated. The elements mathematically form a finite field (??2256). That should be enough to implement the features mentioned above. arbitrary matrix sizes (I'll probably need something like 100x100, but the matrix sizes will depend on the user's input so it should not be limited by anything else but the memory or the computational power available) as fast as possible, but I'm aware that a library for arbitrary elements will probably not perform like a C/Fortran library that does the work (interfaced via FFI) because of the indirection of arbitrary (non Int, Double or similar) types. At least one pointer gets dereferenced when an element is touched (written in Haskell, this is not a real requirement for me, but since my elements are no Storable instances the library has to be written in Haskell) I already tried very hard and evaluated everything that looked promising (most of the libraries on Hackage directly state that they wont work for me). In particular I wrote test code using: hmatrix, assumes Storable elements Vec, but the documentation states: Low Dimension : Although the dimensionality is limited only by what GHC will handle, the library is meant for 2,3 and 4 dimensions. For general linear algebra, check out the excellent hmatrix library and blas bindings I looked into the code and the documentation of many more libraries but nothing seems to suit my needs :-(. Update Since there seems to be nothing, I started a project on GitHub which aims to develop such a library. The current state is very minimalistic, not optimized for speed at all and only the most basic functions have tests and therefore should work. But should you be interested in using or helping out developing it: Contact me (you'll find my mail address on my web site) or send pull requests.

  Read the article

• Cloud-aware programming and help choosing a good framework

  - by Shoaibi

  How can i write a cloud-aware application? e.g. an application that takes benefit of being deployed on cloud. Is it same as an application that runs or a vps/dedicated server? if not then what are the differences? are there any design changes? What are the procedures that i need to take if i am to migrate an application to cloud-aware? Also i am about to implement a web application idea which would need features like security, performance, caching, and more importantly free. I have been comparing some frameworks and found that django has least RAM/CPU usage and works great in prefork+threaded mode, but i have also read that django based sites stop to respond with huge load of connections. Other frameworks that i have seen/know are Zend, CakePHP, Lithium/Cake3, CodeIgnitor, Symfony, Ruby on Rails.... So i would leave this to your opinion as well, suggest me a good free framework based on my needs. Finally thanks for reading the essay ;)

  Read the article

• Better why of looping to detect change.

  - by Dremation

  As of now I'm using a while(true) method to detect changes in memory. The problem with this is it's kill the applications performance. I have a list of 30 pointers that need checked as rapidly as possible for changes, without sacrificing a huge performance loss. Anyone have ideas on this? memScan = new Thread(ScanMem); public static void ScanMem() { int i = addy.Length; while (true) { Thread.Sleep(30000); //I do this to cut down on cpu usage for (int j = 0; j < i; j++) { string[] values = addy[j].Split(new char[] { Convert.ToChar(",") }); //MessageBox.Show(values[2]); try { if (Memory.Scanner.getIntFromMem(hwnd, (IntPtr)Convert.ToInt32(values[0], 16), 32).ToString() != values[1].ToString()) { //Ok, it changed lets do our work //work if (Globals.Working) return; SomeFunction("Results: " + values[2].ToString(), "Memory"); Globals.Working = true; }//end if }//end try catch { } }//end for }//end while }//end void

  Read the article

• when long polling, Why are my other requests taking so long?

  - by Pascal

  The client makes 2 concurrent requests. (1 which takes 60 seconds - long polling) and another which is NOT long polling - supposed to return right away. It does return right away when I'm not doing long polling. But as soon as I start doing long polling with the other thread, the other one takes forever to execute. Firebug shows that the request is waiting for 10-50 seconds. On the server, I profiled ALL requests from the moment the php script starts to the time it goes back to the client, and it shows that each one only took 300ms or less. This problem started about the same time I started doing long polling (with the other XHR requests). I'm using jquery for both requests. The server shows that it is under very light load. CPU and memory less then 2%. 8 processes running out of a pool of 15. (it doesn't seem to deviate much from that number 8, even when I run more ajax requests). I guess each process can run multiple ajax threads concurrently. I made sure to EXIT from all processes as soon as their done executing. I don't see how the process pool has run out, if there are still 7 unused processes listed under prstat -J. Also, the problem happens somewhat intermittently. Firefox should be able to handle 2 concurrent ajax requests. i dont get what the problem is.

  Read the article

• Search for string allowing for one mismatches in any location of the string, Python

  - by Vincent

  I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

  Read the article

• Refactoring ADO.NET - SqlTransaction vs. TransactionScope

  - by marc_s

  I have "inherited" a little C# method that creates an ADO.NET SqlCommand object and loops over a list of items to be saved to the database (SQL Server 2005). Right now, the traditional SqlConnection/SqlCommand approach is used, and to make sure everything works, the two steps (delete old entries, then insert new ones) are wrapped into an ADO.NET SqlTransaction. using (SqlConnection _con = new SqlConnection(_connectionString)) { using (SqlTransaction _tran = _con.BeginTransaction()) { try { SqlCommand _deleteOld = new SqlCommand(......., _con); _deleteOld.Transaction = _tran; _deleteOld.Parameters.AddWithValue("@ID", 5); _con.Open(); _deleteOld.ExecuteNonQuery(); SqlCommand _insertCmd = new SqlCommand(......, _con); _insertCmd.Transaction = _tran; // add parameters to _insertCmd foreach (Item item in listOfItem) { _insertCmd.ExecuteNonQuery(); } _tran.Commit(); _con.Close(); } catch (Exception ex) { // log exception _tran.Rollback(); throw; } } } Now, I've been reading a lot about the .NET TransactionScope class lately, and I was wondering, what's the preferred approach here? Would I gain anything (readibility, speed, reliability) by switching to using using (TransactionScope _scope = new TransactionScope()) { using (SqlConnection _con = new SqlConnection(_connectionString)) { .... } _scope.Complete(); } What you would prefer, and why? Marc

  Read the article

< Previous Page | 386 387 388 389 390 391 392 393 394 395 396 397  | Next Page >