Search Results

Search found 10536 results on 422 pages for 'dan course'.

Page 391/422 | < Previous Page | 387 388 389 390 391 392 393 394 395 396 397 398  | Next Page >

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Loading the last related record instantly for multiple parent records using Entity framework

    - by Guillaume Schuermans
    Does anyone know a good approach using Entity Framework for the problem described below? I am trying for our next release to come up with a performant way to show the placed orders for the logged on customer. Of course paging is always a good technique to use when a lot of data is available I would like to see an answer without any paging techniques. Here's the story: a customer places an order which gets an orderstatus = PENDING. Depending on some strategy we move that order up the chain in order to get it APPROVED. Every change of status is logged so we can see a trace for statusses and maybe even an extra line of comment per status which can provide some extra valuable information to whoever sees this order in an interface. So an Order is linked to a Customer. One order can have multiple orderstatusses stored in OrderStatusHistory. In my testscenario I am using a customer which has 100+ Orders each with about 5 records in the OrderStatusHistory-table. I would for now like to see all orders in one page not using paging where for each Order I show the last relevant Status and the extra comment (if there is any for this last status; both fields coming from OrderStatusHistory; the record with the highest Id for the given OrderId). There are multiple scenarios I have tried, but I would like to see any potential other solutions or comments on the things I have already tried. Trying to do Include() when getting Orders but this still results in multiple queries launched on the database. Each order triggers an extra query to the database to get all orderstatusses in the history table. So all statusses are queried here instead of just returning the last relevant one, plus 100 extra queries are launched for 100 orders. You can imagine the problem when there are 100000+ orders in the database. Having 2 computed columns on the database: LastStatus, LastStatusInformation and a regular Linq-Query which gets those columns which are available through the Entity-model. The problem with this approach is the fact that those computed columns are determined using a scalar function which can not be changed without removing the formula from the computed column, etc... In the end I am very familiar with SQL and Stored procedures, but since the rest of the data-layer uses Entity Framework I would like to stick to it as long as possible, even though I have my doubts about performance. Using the SQL approach I would write something like this: WITH cte (RN, OrderId, [Status], Information) AS ( SELECT ROW_NUMBER() OVER (PARTITION BY OrderId ORDER BY Id DESC), OrderId, [Status], Information FROM OrderStatus ) SELECT o.Id, cte.[Status], cte.Information AS StatusInformation, o.* FROM [Order] o INNER JOIN cte ON o.Id = cte.OrderId AND cte.RN = 1 WHERE CustomerId = @CustomerId ORDER BY 1 DESC; which returns all orders for the customer with the statusinformation provided by the Common Table Expression. Does anyone know a good approach using Entity Framework?

    Read the article

  • ASP.NET MVC: How can I explain an invalid type violation to an end-user with Html.ValidationSummary?

    - by Terminal Frost
    Serious n00b warning here; please take mercy! So I finished the Nerd Dinner MVC Tutorial and I'm now in the process of converting a VB.NET application to ASP.NET MVC using the Nerd Dinner program as a sort of rough template. I am using the "IsValid / GetRuleViolations()" pattern to identify invalid user input or values that violate business rules. I am using LINQ to SQL and am taking advantage of the "OnValidate()" hook that allows me to run the validation and throw an application exception upon trying to save changes to the database via the CustomerRepository class. Anyway, everything works well, except that by the time the form values reach my validation method invalid types have already been converted to a default or existing value. (I have a "StreetNumber" property that is an integer, though I imagine this would be a problem for DateTime or any other non-strings as well.) Now, I am guessing that the UpdateModel() method throws an exception and then alters the value because the Html.ValidationMessage is displayed next to the StreetNumber field but my validation method never sees the original input. There are two problems with this: While the Html.ValidationMessage does signal that something is wrong, there is no corresponding entry in the Html.ValidationSummary. If I could even get the exception message to show up there indicating an invalid cast or something that would be better than nothing. My validation method which resides in my Customer partial class never sees the original user input so I do not know if the problem is a missing entry or an invalid type. I can't figure out how I can keep my validation logic nice and neat in one place and still get access to the form values. I could of course write some logic in the View that processes the user input, however that seems like the exact opposite of what I should be doing with MVC. Do I need a new validation pattern or is there some way to pass the original form values to my model class for processing? CustomerController Code // POST: /Customers/Edit/[id] [AcceptVerbs(HttpVerbs.Post)] public ActionResult Edit(int id, FormCollection formValues) { Customer customer = customerRepository.GetCustomer(id); try { UpdateModel(customer); customerRepository.Save(); return RedirectToAction("Details", new { id = customer.AccountID }); } catch { foreach (var issue in customer.GetRuleViolations()) ModelState.AddModelError(issue.PropertyName, issue.ErrorMessage); } return View(customer); }

    Read the article

  • Remove links with Javascript

    - by Arlen Beiler
    How do I remove links from a webpage with Javascript. I am using Google Chrome. The code I tried is: function removehyperlinks() { try { alert(document.anchors.length); alert(document.getElementsByTagName('a')); for(i=0;i=document.anchors.length;i++) { var a = document.anchors[i]; a.outerHTML = a.innerHTML; var b = document.getElementsByTagName('a'); b[i].outerHTML = b[i].innerHTML; } } catch(e) { alert (e);} alert('done'); } Of course, this is test code, which is why I have the alerts and 2 things trying at the same time. The first alert returns "0" the second [Object NodeList] and the third returns "done". My html body looks like this: <body onload="removehyperlinks()"> <ol style="text-align:left;" class="messagelist"> <li class="accesscode"><a href="#">General information, Updates, &amp; Meetings<span class="extnumber">141133#</span></a> <ol> <li><a href="#">...</a></li> <li><a href="#">...</a></li> <li><a href="#">...</a></li> <li><a href="#">...</a></li> <li><a href="#">...</a></li> <li><a href="#">...</a></li> <li><a href="#">...</a></li> <li><a href="#">...</a></li> <li start="77"><a href="#"">...</a></li> <li start="88"><a href="#">...</a></li> <li start="99"><a href="#">...</a></li> </ol> </li> </ol> </body>

    Read the article

  • Mysql select - improve performances

    - by realshadow
    Hey, I am working on an e-shop which sells products only via loans. I display 10 products per page in any category, each product has 3 different price tags - 3 different loan types. Everything went pretty well during testing time, query execution time was perfect, but today when transfered the changes to the production server, the site "collapsed" in about 2 minutes. The query that is used to select loan types sometimes hangs for ~10 seconds and it happens frequently and thus it cant keep up and its hella slow. The table that is used to store the data has approximately 2 milion records and each select looks like this: SELECT * FROM products_loans WHERE KOD IN("X17/Q30-10", "X17/12", "X17/5-24") AND 369.27 BETWEEN CENA_OD AND CENA_DO; 3 loan types and the price that needs to be in range between CENA_OD and CENA_DO, thus 3 rows are returned. But since I need to display 10 products per page, I need to run it trough a modified select using OR, since I didnt find any other solution to this. I have asked about it here, but got no answer. As mentioned in the referencing post, this has to be done separately since there is no column that could be used in a join (except of course price and code, but that ended very, very badly). Here is the show create table, kod and CENA_OD/CENA_DO very indexed via INDEX. CREATE TABLE `products_loans` ( `KOEF_ID` bigint(20) NOT NULL, `KOD` varchar(30) NOT NULL, `AKONTACIA` int(11) NOT NULL, `POCET_SPLATOK` int(11) NOT NULL, `koeficient` decimal(10,2) NOT NULL default '0.00', `CENA_OD` decimal(10,2) default NULL, `CENA_DO` decimal(10,2) default NULL, `PREDAJNA_CENA` decimal(10,2) default NULL, `AKONTACIA_SUMA` decimal(10,2) default NULL, `TYP_VYHODY` varchar(4) default NULL, `stage` smallint(6) NOT NULL default '1', PRIMARY KEY (`KOEF_ID`), KEY `CENA_OD` (`CENA_OD`), KEY `CENA_DO` (`CENA_DO`), KEY `KOD` (`KOD`), KEY `stage` (`stage`) ) ENGINE=InnoDB DEFAULT CHARSET=utf8 And also selecting all loan types and later filtering them trough php doesnt work good, since each type has over 50k records and the select takes too much time as well... Any ides about improving the speed are appreciated. Edit: Here is the explain +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | id | select_type | table | type | possible_keys | key | key_len | ref | rows | Extra | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | 1 | SIMPLE | products_loans | range | CENA_OD,CENA_DO,KOD | KOD | 92 | NULL | 190158 | Using where | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ I have tried the combined index and it improved the performance on the test server from 0.44 sec to 0.06 sec, I cant access the production server from home though, so I will have to try it tomorrow.

    Read the article

  • dynamically embedding youtube videos with jquery

    - by danwoods
    Hello all, I'm trying to retrieve a listing of a user's youtube videos and embed them in a page using jQuery. My code looks something like this: $(document).ready(function() { //some variables var fl_obj_template = $('<object width="260" height="140">' + '<param name="movie" value=""></param>' + '<param name="allowFullScreen" value="true"></param>' + '<param name="allowscriptaccess" value="always"></param>' + '<embed src="" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" width="260" height="140"></embed>' + '</object>'); var video_elm_arr = $('.video'); //hide videos until ready $('.video').addClass('hidden'); //pull video data from youtube $.ajax({ url: 'http://gdata.youtube.com/feeds/api/users/username/uploads?alt=json', dataType: 'jsonp', success: function(data) { $.each(data.feed.entry, function(i,item){ //only take the first 7 videos if(i > 6) return; //give the video element a flash object var cur_flash_obj = fl_obj_template; //assign title $(video_elm_arr[i]).find('.video_title').html(item.title.$t); //clean url var video_url = item.media$group.media$content[0].url; var index = video_url.indexOf("?"); if (index > 0) video_url = video_url.substring(0, index); //and asign it to the player's parameters $(cur_flash_obj).find('object param[name="movie"]').attr('value', video_url); $(cur_flash_obj).find('object embed').attr('src', video_url); //alert(cur_flash_obj); //insert flash object in video element $(video_elm_arr[i]).append(cur_flash_obj); //and show $(video_elm_arr[i]).removeClass('hidden'); }); } }); }); (of course with 'username' being the actual username). The video titles appear correctly but no videos show up. What gives? The target html looks like: <div id="top_row_center" class="video_center video"> <p class="video_title"></p> </div>

    Read the article

  • Why is this simple Mobile Form not closed when using the player

    - by ajhvdb
    Hi, I created this simple sample Form with the close button. Everything is working as expected when NOT using the Interop.WMPLib.dll I've seen other applications using this without problems but why isn't the Form process closed when I just add the line: SoundPlayer myPlayer = new SoundPlayer(); and of course dispose it: if (myPlayer != null) { myPlayer.Dispose(); myPlayer = null; } The Form closes but the debugger VS2008 is still active. The Form project and the dll are still active. If you send me an email to [email protected], I can send you the zipped project. Below is the class for the dll: using System; using System.Collections.Generic; using System.Text; using System.Threading; using System.Runtime.InteropServices; using WMPLib; namespace WindowsMobile.Utilities { public delegate void SoundPlayerStateChanged(SoundPlayer sender, SoundPlayerState newState); public enum SoundPlayerState { Stopped, Playing, Paused, } public class SoundPlayer : IDisposable { [DllImport("coredll")] public extern static int waveOutSetVolume(int hwo, uint dwVolume); [DllImport("coredll")] public extern static int waveOutGetVolume(int hwo, out uint dwVolume); WindowsMediaPlayer myPlayer = new WindowsMediaPlayer(); public SoundPlayer() { myPlayer.uiMode = "invisible"; myPlayer.settings.volume = 100; } string mySoundLocation = string.Empty; public string SoundLocation { get { return mySoundLocation; } set { mySoundLocation = value; } } public void Pause() { myPlayer.controls.pause(); } public void PlayLooping() { Stop(); myPlayer.URL = mySoundLocation; myPlayer.settings.setMode("loop", true); } public int Volume { get { return myPlayer.settings.volume; } set { myPlayer.settings.volume = value; } } public void Play() { Stop(); myPlayer.URL = mySoundLocation; myPlayer.controls.play(); } public void Stop() { myPlayer.controls.stop(); myPlayer.close(); } #region IDisposable Members public void Dispose() { try { Stop(); } catch (Exception) { } // need this otherwise the process won't exit?! try { int ret = Marshal.FinalReleaseComObject(myPlayer); } catch (Exception) { } myPlayer = null; GC.Collect(); } #endregion } }

    Read the article

  • output with "Private`" Content in Mathematica Package

    - by madalina
    Hello everyone, I am trying to solve the following implementation problem in Mathematica 7.0 for some days now and I do not understand exactly what is happening so I hope someone can give me some hints. I have 3 functions that I implemented in Mathematica in a source file with extension *.nb. They are working okay to all the examples. Now I want to put these functions into 3 different packages. So I created three different packages with extension .*m in which I put all the desired Mathematica function. An example in the "stereographic.m" package which contain the code: BeginPackage["stereographic`"] stereographic::usage="The package stereographic...." formEqs::usage="The function formEqs[complexBivPolyEqn..." makePoly::usage="The function makePoly[algebraicEqn] ..." getFixPolys::usage="The function..." milnorFibration::usage="The function..." Begin["Private`"] Share[]; formEqs[complex_,{m_,n_}]:=Block[{complexnew,complexnew1, realeq, imageq, expreal, expimag, polyrealF, polyimagF,s,t,u,v,a,b,c,epsilon,x,y,z}, complexnew:=complex/.{m->s+I*t,n->u+I*v}; complexnew1:=complexnew/.{s->(2 a epsilon)/(1+a^2+b^2+c^2),t->(2 b epsilon)/(1+a^2+b^2+c^2),u->(2 c epsilon)/(1+a^2+b^2+c^2),v->(- epsilon+a^2 epsilon+b^2 epsilon+c^2 epsilon)/(1+a^2+b^2+c^2)}; realeq:=ComplexExpand[Re[complexnew1]]; imageq:=ComplexExpand[Im[complexnew1]]; expreal:=makePoly[realeq]; expimag:=makePoly[imageq]; polyrealF:=expreal/.{a->x,b->y,c->z}; polyimagF:=expimag/.{a->x,b->y,c->z}; {polyrealF,polyimagF} ] End[] EndPackage[] Now to test the function I load the package Needs["stereographic`"] everything is okay. But when I test the function for example with formEqs[x^2-y^2,{x,y}] I get the following ouput: {Private`epsilon^2 + 2 Private`x^2 Private`epsilon^2 + Private`x^4 Private`epsilon^2 - 6 Private`y^2 Private`epsilon^2 + 2 Private`x^2 Private`y^2 Private`epsilon^2 + Private`y^4 Private`epsilon^2 - 6 Private`z^2 Private`epsilon^2 + 2 Private`x^2 Private`z^2 Private`epsilon^2 + 2 Private`y^2 Private`z^2 Private`epsilon^2 + Private`z^4 Private`epsilon^2, 8 Private`x Private`y Private`epsilon^2 + 4 Private`z Private`epsilon^2 - 4 Private`x^2 Private`z Private`epsilon^2 - 4 Private`y^2 Private`z Private`epsilon^2 - 4 Private`z^3 Private`epsilon^2} Of course I do not understand why Private` appears in front of any local variable which I returned in the final result. I would want not to have this Private` in the computed output. Any idea or better explanations which could indicate me why this happens? Thank you very much for your help. Best wishes, madalina

    Read the article

  • get renamed file names of multiple upload form [js array] in codeigniter

    - by artmania
    Hi friends, I use codeigniter. I have a multiple image upload form. The code below is working well for uploading, but I also need to save file names to database. How can I get the names in here? I spent hours & hours :/ but could not sort it :/ Appreciate helps!!! uploadform.php echo form_open_multipart('gallery/upload'); <input type="file" name="photo" size="50" /> <input type="file" name="thumb" size="50" /> <input type="submit" value="Upload" /> </form> I have a controller between form view and model load model (of course : )) but didnt post here because of no need. gallery_model.php function multiple_upload($upload_dir = 'uploads/', $config = array()) { /* Upload */ $CI =& get_instance(); $files = array(); if(empty($config)) { $config['upload_path'] = realpath($upload_dir); $config['allowed_types'] = 'gif|jpg|jpeg|jpe|png'; $config['max_size'] = '2048'; } $CI->load->library('upload', $config); $errors = FALSE; foreach($_FILES as $key => $value) { if( ! empty($value['name'])) { if( ! $CI->upload->do_upload($key)) { $data['upload_message'] = $CI->upload->display_errors(ERR_OPEN, ERR_CLOSE); // ERR_OPEN and ERR_CLOSE are error delimiters defined in a config file $CI->load->vars($data); $errors = TRUE; } else { // Build a file array from all uploaded files $files[] = $CI->upload->data(); } } } // There was errors, we have to delete the uploaded files if($errors) { foreach($files as $key => $file) { @unlink($file['full_path']); } } elseif(empty($files) AND empty($data['upload_message'])) { $CI->lang->load('upload'); $data['upload_message'] = ERR_OPEN.$CI->lang->line('upload_no_file_selected').ERR_CLOSE; $CI->load->vars($data); } else { return $files; } /* ------------------------------- Insert to database */ // problem is here, i need file names to add db. // if there is already same names file at the folder, it rename file itself. so in such case, I need renamed file name :/ } }

    Read the article

  • BULK INSERT from one table to another all on the server

    - by steve_d
    I have to copy a bunch of data from one database table into another. I can't use SELECT ... INTO because one of the columns is an identity column. Also, I have some changes to make to the schema. I was able to use the export data wizard to create an SSIS package, which I then edited in Visual Studio 2005 to make the changes desired and whatnot. It's certainly faster than an INSERT INTO, but it seems silly to me to download the data to a different computer just to upload it back again. (Assuming that I am correct that that's what the SSIS package is doing). Is there an equivalent to BULK INSERT that runs directly on the server, allows keeping identity values, and pulls data from a table? (as far as I can tell, BULK INSERT can only pull data from a file) Edit: I do know about IDENTITY_INSERT, but because there is a fair amount of data involved, INSERT INTO ... SELECT is kinda of slow. SSIS/BULK INSERT dumps the data into the table without regards to indexes and logging and whatnot, so it's faster. (Of course creating the clustered index on the table once it's populated is not fast, but it's still faster than the INSERT INTO...SELECT that I tried in my first attempt) Edit 2: The schema changes include (but are not limited to) the following: 1. Splitting one table into two new tables. In the future each will have its own IDENTITY column, but for the migration I think it will be simplest to use the identity from the original table as the identity for the both new tables. Once the migration is over one of the tables will have a one-to-many relationship to the other. 2. Moving columns from one table to another. 3. Deleting some cross reference tables that only cross referenced 1-to-1. Instead the reference will be a foreign key in one of the two tables. 4. Some new columns will be created with default values. 5. Some tables aren’t changing at all, but I have to copy them over due to the "put it all in a new DB" request.

    Read the article

  • grdb not working variables

    - by stupid_idiot
    hi, i know this is kinda retarded but I just can't figure it out. I'm debugging this: xor eax,eax mov ah,[var1] mov al,[var2] call addition stop: jmp stop var1: db 5 var2: db 6 addition: add ah,al ret the numbers that I find on addresses var1 and var2 are 0x0E and 0x07. I know it's not segmented, but that ain't reason for it to do such escapades, because the addition call works just fine. Could you please explain to me where is my mistake? I see the problem, dunno how to fix it yet though. The thing is, for some reason the instruction pointer starts at 0x100 and all the segment registers at 0x1628. To address the instruction the used combination is i guess [cs:ip] (one of the segment registers and the instruction pointer for sure). The offset to var1 is 0x10 (probably because from the begining of the code it's the 0x10th byte in order), i tried to examine the memory and what i got was: 1628:100 8 bytes 1628:108 8 bytes 1628:110 <- wtf? (assume another 8 bytes) 1628:118 ... whatever tricks are there in the memory [cs:var1] points somewhere else than in my code, which is probably where the label .data would usually address ds.... probably.. i don't know what is supposed to be at 1628:10 ok, i found out what caused the assness and wasted me whole fuckin day. the behaviour described above is just correct, the code is fully functional. what i didn't know is that grdb debugger for some reason sets the begining address to 0x100... the sollution is to insert the directive ORG 0x100 on the first line and that's the whole thing. the code was working because instruction pointer has the right address to first instruction and goes one by one, but your assembler doesn't know what effective address will be your program stored at so it pretty much remains relative to first line of the code which means all the variables (if not using label for data section) will remain pointing as if it started at 0x0. which of course wouldn't work with DOS. and grdb apparently emulates some DOS features... sry for the language, thx everyone for effort, hope this will spare someone's time if having the same problem... heheh.. at least now i know the reason why to use .data section :))))

    Read the article

  • Subband decomposition using Daubechies filter

    - by misha
    I have the following two 8-tap filters: h0 ['-0.010597', '0.032883', '0.030841', '-0.187035', '-0.027984', '0.630881', '0.714847', '0.230378'] h1 ['-0.230378', '0.714847', '-0.630881', '-0.027984', '0.187035', '0.030841', '-0.032883', '-0.010597'] Here they are on a graph: I'm using it to obtain the approximation (lower subband of an image). This is a(m,n) in the following diagram: I got the coefficients and diagram from the book Digital Image Processing, 3rd Edition, so I trust that they are correct. The star symbol denotes one dimensional convolution (either over rows or over columns). The down arrow denotes downsampling in one dimension (either over rows, or columns). My problem is that the filter coefficients for h0 and h1 sum to greater than 1 (approximately 1.4 or sqrt(2) to be exact). Naturally, if I convolve any image with the filter, the image will get brighter. Indeed, here's what I get (expected result on right): Can somebody suggest what the problem is here? Why should it work if the convolution filter coefficients sum to greater than 1? I have the source code, but it's quite long so I'm hoping to avoid posting it here. If it's absolutely necessary, I'll put it up later. EDIT What I'm doing is: Decompose into subbands Filter one of the subbands Recompose subbands into original image Note that the point isn't just to have a displayable subband-decomposed image -- I have to be able to perfectly reconstruct the original image from the subbands as well. So if I scale the filtered image in order to compensate for my decomposition filter making the image brighter, this is what I will have to do: Decompose into subbands Apply intensity scaling Filter one of the subbands Apply inverse intensity scaling Recompose subbands into original image Step 2 performs the scaling. This is what @Benjamin is suggesting. The problem is that then step 4 becomes necessary, or the original image will not be properly reconstructed. This longer method will work. However, the textbook explicitly says that no scaling is performed on the approximation subband. Of course, it's possible that the textbook is wrong. However, what's more possible is I'm misunderstanding something about the way this all works -- this is why I'm asking this question.

    Read the article

  • C++ - Breaking code implementation into different parts

    - by Kotti
    Hi! The question plot (a bit abstract, but answering this question will help me in my real app): So, I have some abstract superclass for objects that can be rendered on the screen. Let's call it IRenderable. struct IRenderable { // (...) virtual void Render(RenderingInterface& ri) = 0; virtual ~IRenderable() { } }; And suppose I also have some other objects that derive from IRenderable, e.g. Cat and Dog. So far so good. I add some Cat and Dog specific methods, like SeekForWhiskas(...) and Bark(...). After that I add specific Render(...) method for them, so my code looks this way: class Cat : public IRenderable { public: void SeekForWhiskas(...) { // Implementation could be here or moved // to a source file (depends on me wanting // to inline it or not) } virtual void Render(...) { // Here comes the rendering routine, that // is specific for cats SomehowDrawAppropriateCat(...); } }; class Dog : public IRenderable { public: void Bark(...) { // Same as for 'SeekForWhiskas(...)' } virtual void Render(...) { // Here comes the rendering routine, that // is specific for dogs DrawMadDog(...); } }; And then somewhere else I can do drawing the way that an appropriate rendering routine is called: IRenderable* dog = new Dog(); dog->Render(...); My question is about logical wrapping of such kind of code. I want to break apart the code, that corresponds to rendering of the current object and it's own methods (Render and Bark in this example), so that my class implementation doesn't turn into a mess (imagine that I have 10 methods like Bark and of course my Render method doesn't fit in their company and would be hard to find). Two ways of making what I want to (as far as I know) are: Making appropriate routines that look like RenderCat(Cat& cat, RenderInterface* ri), joining them to render namespace and then the functions inside a class would look like virtual void Render(...) { RenderCat(*this, ...); }, but this is plain stupid, because I'll lose access to Cat's private members and friending these functions looks like a total design disaster. Using visitor pattern, but this would also mean I have to rebuild my app's design and looks like an inadequate way to make my code complicated from the very beginning. Any brilliant ideas? :)

    Read the article

  • Creating multiple heads in remote repository

    - by Jab
    We are looking to move our team (~10 developers) from SVN to mercurial. We are trying to figure out how to manage our workflow. In particular, we are trying to see if creating remote heads is the right solution. We currently have a very large repository with multiple, related projects. They share a lot of code, but pieces of the project are deployed by different teams (3 teams) independent of other portions of the code-base. So each team is working on concurrent large features. The way we currently handles this in SVN are branches. Team1 has a branch for Feature1, same deal for the other teams. When Team1 finishes their change, it gets merged into the trunk and deployed out. The other teams follow suite when their project is complete, merging of course. So my initial thought are using Named Branches for these situations. Team1 makes a Feature1 branch off of the default branch in Hg. Now, here is the question. Should the team PUSH that branch, in it's current/half-state to the repository. This will create a second head in the core repo. My initial reaction was "NO!" as it seems like a bad idea. Handling multiple heads on our repository just sounds awful, but there are some advantages... First, the teams want to setup Continuous Integration to build this branch during their development cycle(months long). This will only work if the CI can pull this branch from the repo. This is something we do now with SVN, copy a CI build and change the branch. Easy. Second, it makes it easier for any team member to jump onto the branch and start working. Without pushing to the core repo, they would have to receive a push from a developer on that team with the changeset information. It is also possible to lose local commits to hardware failure. The chances increase a lot if it's a branch by a single developer who has followed the "don't push until finished" approach. And lastly is just for ease of use. The developers can easily just commit and push on their branch at any time without consequence(as they do today, in their SVN branches). Is there a better way to handle this scenario that I may be missing? I just want a veteran's opinion before moving forward with the strategy. For bug fixes we like the general workflow of mecurial, anonymous branches that only consist of 1-2 commits. The simplicity is great for those cases. By the way, I've read this , great article which seems to favor Named branches.

    Read the article

  • Learning... anything really

    - by WebDevHobo
    I'm particularly interested in Windows PowerShell, but here's a somewhat more general complaint: When asking for help on learning something new, be it a small subject on PHP or understanding a class in Java, what usually happens is that people direct me towards the documentation pages. What I'm looking for is somewhat of a course. A deep explanation of why something works the way it does. I know my basic programming, like Java and C#. I've never seen C or C++, though I have seen a bit of assembler. I know what the Stack and Heap are, how boxing and unboxing works, why you have to deep-copy an array instead of copying the pointer and some other things. Windows PowerShell on the other hand, I know nothing about. And I notice that when reading the small document or some code, I usually forget what it does or why it works. What I am looking for is preferably, a nice tutorial that explains the beginnings, the concepts, and goes to more difficult things at a steady pace. The only thing documentation can do is explain what a function does. That's no good to me since I don't know what I want to do yet. I could read about a thousand functions, and forget about most of them, because I don't need to implement them right after it. Randomly wandering through the documentation doesn't do me any good. So conclude, what is a good tutorial on Windows Powershell? One which explains in clear language what is happening, one which builds on previous things learned. I don't think googling this is a good idea. Doing a Google search on this would turn up numerous tutorials. And experience tells me that you have to look long and hard to find the gem you're looking for. That's why I'm asking here. Because this is the place where you can find more experienced people. Many of the PowerShell guys among you will know the good ones already, and by asking you, I avoid wasting time that could be spent learning. So to summarize: I will not google this!

    Read the article

  • JAXB doesn't unmarshal list of interfaces

    - by Joker_vD
    It seems JAXB can't read what it writes. Consider the following code: interface IFoo { void jump(); } @XmlRootElement class Bar implements IFoo { @XmlElement public String y; public Bar() { y = ""; } public Bar(String y) { this.y = y; } @Override public void jump() { System.out.println(y); } } @XmlRootElement class Baz implements IFoo { @XmlElement public int x; public Baz() { x = 0; } public Baz(int x) { this.x = x; } @Override public void jump() { System.out.println(x); } } @XmlRootElement public class Holder { private List<IFoo> things; public Holder() { things = new ArrayList<>(); } @XmlElementWrapper @XmlAnyElement public List<IFoo> getThings() { return things; } public void addThing(IFoo thing) { things.add(thing); } } // ... try { JAXBContext context = JAXBContext.newInstance(Holder.class, Bar.class, Baz.class); Holder holder = new Holder(); holder.addThing(new Bar("1")); holder.addThing(new Baz(2)); holder.addThing(new Baz(3)); for (IFoo thing : holder.getThings()) { thing.jump(); } StringWriter s = new StringWriter(); context.createMarshaller().marshal(holder, s); String data = s.toString(); System.out.println(data); StringReader t = new StringReader(data); Holder holder2 = (Holder)context.createUnmarshaller().unmarshal(t); for (IFoo thing : holder2.getThings()) { thing.jump(); } } catch (Exception e) { System.err.println(e.getMessage()); } It's a simplified example, of course. The point is that I have to store two very differently implemented classes, Bar and Baz, in one collection. Well, I observed that they have pretty similar public interface, so I created an interface IFoo and made them two to implement it. Now, I want to have tools to save and load this collection to/from XML. Unfortunately, this code doesn't quite work: the collection is saved, but then it cannot be loaded! The intended output is 1 2 3 some xml 1 2 3 But unfortunately, the actual output is 1 2 3 some xml com.sun.org.apache.xerces.internal.dom.ElementNSImpl cannot be cast to testapplication1.IFoo Apparently, I need to use the annotations in a different way? Or to give up on JAXB and look for something else? I, well, can write "XMLNode toXML()" method for all classes I wan't to (de)marshal, but...

    Read the article

  • drupal (CMS) or codeigniter (MVC) for creating a new web application?

    - by ajsie
    im going to create a new web application that is very customized. it will contain images, that are fully searchable - in a very, very customized way. when you click on the pictures you can add comments and so on. it requires users to be registered, but the registration/login process will be highly customized too. at the moment im using CodeIgniter for this. But i've read a lot of posts about CMS like Drupal and it sounds like i could let it handle basic stuff, maybe design and other front end work. i have no experience with CMS, in fact, i just started to use a MVC framework like CI and was impressed of how much easier it gets to start developing. so i wonder, if i'm going to create this kind of application, could i use drupal and then add the usual stuff, as i was going to do with CodeIgniter, like controllers, views, models, config files, my own libraries and so on? how does it work on a system like Drupal. how do you code PHP with it as with any MVC framework. it sounds like it has a lot of modules, i just wonder, if i can use it as a MVC framework but have the benefit of having all these basic stuff and design ready to use? cause then it sounds like the best "library" to provide for a web application from scratch. or is it difficult to create a customized app with it? i guess it has modules like images and users, but then how could i customize these so that every image has tags on it and country information, or have every user subscribing to changes to an image, that email will be sent to users and so on? cause i guess its easy to install a module. the question is, how do i customize it. maybe i don't need all that table columns. maybe i want to add/remove business logic. what are the pros and cons with using Drupal for this? is it even the right way to go? can you make a Stackoverflow with Drupal? Facebook? Twitter? Youtube? assuming that you know php of course. share your thoughts cause im totally new on creating a web application! thanks

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Openlayers and Bing Maps (POLYGONS)

    - by Jordan
    When trying to draw polygons onto a bing map, the initial marker is set differently on the map. How can I fix this? OpenLayers Bing Example <script src="OpenLayers.js"></script> <script> var map; function init(){ map = new OpenLayers.Map("map"); map.addControl(new OpenLayers.Control.LayerSwitcher()); var shaded = new OpenLayers.Layer.VirtualEarth("Shaded", { type: VEMapStyle.Shaded }); var hybrid = new OpenLayers.Layer.VirtualEarth("Hybrid", { type: VEMapStyle.Hybrid }); var aerial = new OpenLayers.Layer.VirtualEarth("Aerial", { type: VEMapStyle.Aerial }); var POLY_LAYER = new OpenLayers.Layer.Vector(); map.addLayers([shaded, hybrid, aerial, POLY_LAYER]); map.setCenter(new OpenLayers.LonLat(-110, 45), 3); var polygon = new OpenLayers.Control.DrawFeature(POLY_LAYER, OpenLayers.Handler.Polygon); map.addControl(polygon); polygon.activate(); } </script> Bing Example <div id="tags"> Bing, Microsoft, Virtual Earth </div> <p id="shortdesc"> Demonstrates the use of Bing layers. </p> <div id="map" class="smallmap"></div> <div id="docs">This example demonstrates the ability to create layers using tiles from Bing maps.</div> Of course the above is being initialized and page works. You can draw the polygon shapes. Notice if you zoom in or out one time, the markers are set at the correct coordinates. My app I was testing this on is really using the bing maps API keys and not VirtualEarth. But it's doing a similar thing. Is this an Openlayers bug? The below source came directly from the open layers example site, I just added and activated polygons to the map. Please let me know how I can fix this for using the Bing Map API.. I've been stuck on this for HOURS! :(

    Read the article

  • How should I handle the case in which a username is already in use?

    - by idealmachine
    I'm a JavaScript programmer and new to PHP and MySQL (want to get into server-side coding). Because I'm trying to learn PHP by building a simple online game (more specifically, correspondence chess), I'm starting by implementing a simple user accounts system. Of course, user registration comes first. What are the best practices for: How I should handle the (likely) possibility that when a user tries to register, the username he has chosen is already in use, particularly when it comes to function return values?($result === true is rather ugly, and I'm not sure whether checking the MySQL error code is the best way to do it either) How to cleanly handle varying page titles?($gPageTitle = '...'; require_once 'bgsheader.php'; is also rather ugly) Anything else I'm doing wrong? In some ways, PHP is rather different from JavaScript... Here is a (rather large) excerpt of the code I have written so far. Note that this is a work in progress and is missing security checks that I will add as my next step. function addUser( $username, $password ) { global $gDB, $gPasswordSalt; $stmt = $gDB->prepare( 'INSERT INTO user(user_name, user_password, user_registration) VALUES(?, ?, NOW())' ); $stmt || trigger_error( 'Failed to prepare statement: ' . htmlspecialchars( $gDB->error ) ); $hashedPassword = hash_hmac( 'sha256', $password, $gPasswordSalt, true ); $stmt->bind_param( 'ss', $username, $hashedPassword ); if( $stmt->execute() ) { return true; } elseif( $stmt->errno == 1062) { return 'exists'; } else { trigger_error( 'Failed to execute statement: ' . htmlspecialchars( $stmt->error ) ); } } $username = $_REQUEST['username']; $password = $_REQUEST['password']; $result = addUser( $username, $password ); if( $result === true ) { $gPageTitle = 'Registration successful'; require_once 'bgsheader.php'; echo '<p>You have successfully registered as ' . htmlspecialchars( $username ) . ' on this site.</p>'; } elseif( $result == 'exists' ) { $gPageTitle = 'Username already taken'; require_once 'bgsheader.php'; echo '<p>Someone is already using the username you have chosen. Please try using another one instead.'; } else { trigger_error('This should never happen'); } require_once 'bgsfooter.php';

    Read the article

  • sed - trying to replace first occurrence after a match

    - by wakkaluba
    I am facing a situation that drives me nuts. I am setting up an update server which uses a json file. Don't ask why or how, it sucks and is my only possibility to achieve it. I have been trying and researching for HOURS (many) because I went ballistic and wanted to crack this on my own. But I have to realize I got stuck and need help. So sorry for this chunk but I think it is somewhat important to see... The file is a one liner and repeating the following sequence with changing values (of course). "plugin_name_foo_bar": {"buildDate": "bla", "dependencies": [{"name": "bla", "optional": true, "version": "1.00"}], "developers": [{"developerId": "bla", "email": "[email protected]", "name": "Bla bla2nd"}], "excerpt": "some text {excerpt} !bla.png|thumbnail,border=1! ", "gav": "bla", "labels": ["report", "scm-related"], "name": "plugin_name_foo_bar", "previousTimestamp": "bla", "previousVersion": "1.0", "releaseTimestamp": "bla", "requiredCore": "1", "scm": "github.com", "sha1": "ynnBM2jWo25ZLDdP3ybBOnV/Pio=", "title": "bla", "url": "http://bla.org", "version": "1.0", "wiki": "https://bla.org"}, "Exclusion": {"buildDate": "bla", "dependencies": [], and the next plugin block is glued straight afterwards. What I now want to do is to search for "plugin_foo_bar": {" as this is the unique identifier for a new plugin description block. I want to replace the first sha1 value occuring afterwards. That's where I keep failing. I always grab the first,last or any occurrence in the entire file and not the block :( "title" is the unique identifier after the sha1 value. So I tried to make the .* less greedy but it ain't working out. last attempt was heading towards: sed -i 's/("name": "plugin_name_foo_bar.*sha1": ")([a-zA-Z0-9!@#\$%^&*()\[\]]*)(", "title"\)/\1blablabla\2/1' default.json to find the sha1 value of that plugin but still no joy. I hope someone knows - preferably a simpler approach - before I now continue with trial and error until I have to puke and freakout. I am working with SED on Windows, so Unix approach might help me to figure out how to achieve this in batch but please make it as one-liner if possible. Scripts are a real pain to convert. And I just need SED and no other solution with other tools like AWK. That is absolutely out of discussion. Any help is appreciated :) Cheers Jan

    Read the article

  • Thoughts on streamlining multiple .Net apps

    - by John Virgolino
    We have a series of ASP.Net applications that have been written over the course of 8 years. Mostly in the first 3-4 years. They have been running quite well with little maintenance, but new functionality is being requested and we are running into IDE and platform issues. The apps were written in .Net 1.x and 2.x and run in separate spaces but are presented as a single suite of applications which use a common navigation toolbar (implemented as a user control). Every time we want to add something to a menu in the nav we have to modify it in all the apps which is a pain. Also, the various versions of Crystal reports and that we used tables to organize the visual elements and we end up with a mess, especially with all the multi-platform .Net versions running. We need to streamline the suite of apps and make it easier to add on new apps without a hassle. We also need to bring all these apps under one .Net platform and IDE. In addition, there is a WordPress blog styled to match the style of the application suite "integrated" into the UI and a link to a MediaWiki Wiki application as well. My current thinking is to use an open source content management system (CMS) like Joomla (PHP based unfortunately, but it works well) as the user interface framework for style templating and menu management. Joomla's article management would allow us to migrate the Wiki content into articles which could be published without interfering with the .Net apps. Then essentially use an IFrame within an "article" to "host" the .Net application, then... Upgrade the .Net apps to VS2010, strip out all the common header/footer controls and migrate the styles to use the style sheets used in the CMS. As I write this, I certainly realize this is a lot of work and there are optimization issues which this may cause as well as using IFrames seems a bit like cheating and I've read about issues with IFrames. I know that we could use .Net application styling, but it seems like a lot more work (not sure really). Also, the use of a CMS to handle the blog and wiki also seems appealing, unless there is a .Net CMS out there that can handle all of these requirements. Given this information, I am looking to know if I am totally going in the wrong direction? We tried to use open source and integrate it over time, but not this has become hard to maintain. Am I not aware of some technology out there that will meet our requirements? Did we do this right and should we just focus on getting the .Net streamlined? I understand that no matter what we do, it's going to be a lot of work. The communities considerable experience would be helpful. Thanks!! PS - A complete rewrite is not an option.

    Read the article

  • Settings designer file complains when protecting configuration for connectionStrings in App.Config i

    - by Joe
    Hi, I am trying to encrypt Configuration Information Using Protected Configuration in Visual Studio 2010. I have the following info speicifed in the App.Config file: <connectionStrings configProtectionProvider="TheProviderName"> <EncryptedData> <CipherData> <CipherValue>VALUE GOES HERE</CipherValue> </CipherData> </EncryptedData> </connectionStrings> <appSettings configProtectionProvider="TheProviderName"> <EncryptedData> <CipherData> <CipherValue>VALUE GOES HERE</CipherValue> </CipherData> </EncryptedData> </appSettings> However, when I then go to the Settings area of the Projects Properties to view the settings in the Designer, I get prompted with the following error "An error occured while reading the App.config file. The file might be corrupted or contain invalid XML." I understand that my changes are causing the error, however, is there anyway I can bypass that the information is not read into at design view? (Of course the best way would be to make the tags be recognized by the designer, is there any way to do this?) I tried adding <connectionStrings configProtectionProvider="TheProviderName" xmlns="http://schemas.microsoft.com/.NetConfiguration/v2.0"> to connectionStrings as well as to the appSettings, but with no luck, the intellisense is bypassed in the config file, but the designer still complains. I would be satisfied if the designer would not complain about this "error", which is not actually an error because Microsoft states here that it should work. ASP.NET 2.0 provides a new feature, called protected configuration, that enables you to encrypt sensitive information in a configuration file. Although primarily designed for ASP.NET, protected configuration can also be used to encrypt configuration file sections in Windows applications. For a detailed description of the new protected configuration capabilities, see Encrypting Configuration Information Using Protected Configuration. And yes, it does work to encrypt it and to decrypt it and use it, it is just very annoying and frustrating that the designer complains about it. Anyone who knows which xsd file that is used (if used) to verify the contents of the App.config file in the design view? Any help appreciated.

    Read the article

  • L-Soft LISTSERV TCPGUI Interface for PHP Creation

    - by poolnoodl
    I'm trying to use LISTSERV's "API" in PHP. L-Soft calls this TCPGUI, and essentially, you can request data like over Telnet. To do this, I'm using PHP's TCP socket functions. I've seen this done in other languages but can't quite convert it to PHP. I can connect, I can change set ASCII or BINARY mode. But I can never quite craft the header packet the way I need to authenticate, so I'm thinking I'm messing up my conversion. C: http://www.lsoft.com/manuals/16.0/htmlhelp/advanced%20topics/TCPGUI.html#2334328 $origin = '[email protected]'; $pwd = 'password'; $host = "example.com"; $port = 2306; $email = "[email protected]"; $list = "mailinglist"; $command = "Query $list FOR $email"; $fp = stream_socket_client("tcp://$host:$port", $errno, $errstr, 30); $cmd = $command . " PW=" . $pwd; $len = strlen($cmd); $orglen = strlen($origin); $n = $len + $orglen + 1; $headerPacket[0] = "1"; $headerPacket[1] = "B"; $headerPacket[2] = "\r"; $headerPacket[3] = "\n"; $headerPacket[4] = ord($n / 256); $headerPacket[5] = ord($n + 255); $headerPacket[6] = ord($orglen); for ($i = 0; $i < $orglen; $i++) { $headerPacket[$i + 7] = ord($origin[$i]); } for ($i = 0; $i < $len; $i++) { $cmdPacket[$i] = ord($cmd[$i]); } fwrite($fp, implode($headerPacket)); while (!feof($fp)) { echo fgets($fp, 1024); } Any thoughts on where I'm going wrong? I'd much appreciate it if anyone could point me toward some code to do this, days of googling and searching here on SO has only lead me to examples in other languages. Of course, if you know C (or Java or Perl as linked below in my comment to bypass the spam filter), PHP, and socket programming fairly well, you could probably rewrite the whole of the code in an hour, maybe a few minutes. You'd have my eternal thanks for that.

    Read the article

  • Spring MVC, REST, and HATEOAS

    - by SingleShot
    I'm struggling with the correct way to implement Spring MVC 3.x RESTful services with HATEOAS. Consider the following constraints: I don't want my domain entities polluted with web/rest constructs. I don't want my controllers polluted with view constructs. I want to support multiple views. Currently I have a nicely put together MVC app without HATEOAS. Domain entities are pure POJOs without any view or web/rest concepts embedded. For example: class User { public String getName() {...} public String setName(String name) {...} ... } My controllers are also simple. They provide routing and status, and delegate to Spring's view resolution framework. Note my application supports JSON, XML, and HTML, yet no domain entities or controllers have embedded view information: @Controller @RequestMapping("/users") class UserController { @RequestMapping public ModelAndView getAllUsers() { List<User> users = userRepository.findAll(); return new ModelAndView("users/index", "users", users); } @RequestMapping("/{id}") public ModelAndView getUser(@PathVariable Long id) { User user = userRepository.findById(id); return new ModelAndView("users/show", "user", user); } } So, now my issue - I'm not sure of a clean way to support HATEOAS. Here's an example. Let's say when the client asks for a User in JSON format, it comes out like this: { firstName: "John", lastName: "Smith" } Let's also say that when I support HATEOAS, I want the JSON to contain a simple "self" link that the client can then use to refresh the object, delete it, or something else. It might also have a "friends" link indicating how to get the user's list of friends: { firstName: "John", lastName: "Smith", links: [ { rel: "self", ref: "http://myserver/users/1" }, { rel: "friends", ref: "http://myserver/users/1/friends" } ] } Somehow I want to attach links to my object. I feel the right place to do this is in the controller layer as the controllers all know the correct URLs. Additionally, since I support multiple views, I feel like the right thing to do is somehow decorate my domain entities in the controller before they are converted to JSON/XML/whatever in Spring's view resolution framework. One way to do this might be to wrap the POJO in question with a generic Resource class that contains a list of links. Some view tweaking would be required to crunch it into the format I want, but its doable. Unfortunately nested resources could not be wrapped in this way. Other things that come to mind include adding links to the ModelAndView, and then customizing each of Spring's out-of-the-box view resolvers to stuff links into the generated JSON/XML/etc. What I don't want is to be constantly hand-crafting JSON/XML/etc. to accommodate various links as they come and go during the course of development. Thoughts?

    Read the article

< Previous Page | 387 388 389 390 391 392 393 394 395 396 397 398  | Next Page >