Search Results

Search found 80052 results on 3203 pages for 'data load performance'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 391/3203 | < Previous Page | 387 388 389 390 391 392 393 394 395 396 397 398  | Next Page >

  • How to load file into javascript

    - by misha-moroshko
    I have an HTML table that should be updated according the file that user uploads. In other words, I would like user to be able to upload a file, and change the contents of the table according to file content. The file size can be several MB. What are my options ? Do I must to upload the file to a server, or it can be done in client side ? Thanks !

    Read the article

  • Fadeout a tiled background image in load using JQuery

    - by user346602
    Hi, I've used JQuery in the past to fade divs in and out successfully. However, I have encountered a situation I can't quite wrap my head around: I am coding a site for a designer who has based the formatting of all the elements on a grid pattern he's created. As he wants the pattern elements to be the same size independent of the browser window, I think I can only do this via a repeating background tiled image in CSS. Now he wants the background pattern (only) to come in dark and fade to very light, while not effecting any of the other elements. Am I right in thinking it's impossible to call a tiled background pattern using a CSS selector? Does anyone have any suggestions of a workaround to this problem?

    Read the article

  • Django: text fixture fails to load

    - by Esteban Feldman
    Hi all, Did a dumpdata of my project, then in my new test I added it to fixtures. from django.test import TestCase class TestGoal(TestCase): fixtures = ['test_data.json'] def test_goal(self): """ Tests that 1 + 1 always equals 2. """ self.failUnlessEqual(1 + 1, 2) When running the test I get: Problem installing fixture 'XXX/fixtures/test_data.json': DoesNotExist: XXX matching query does not exist. But manually doing loaddata works fine does not when the db is empty. I do a dropdb, createdb a simple syncdb the try loaddata and it fails, same error. Any clue? Python version 2.6.5, Django 1.1.1

    Read the article

  • How do I load all my location based content into google maps

    - by user333639
    I am writing an iPad application that uses the MapKit control. How do I get all my content into Google Maps. i.e. I have a bunch of locations along with photos, video, audio and various other information. So when the iPad user loads my App and zooms into a certain place in the world I want my Annotations to be visible and when they touch the pins they get access to more information etc.

    Read the article

  • Help with data retrieval MACRO

    - by Andrei Ciobanu
    Hello, given the following structure: struct nmslist_elem_s { nmptr data; struct nmslist_elem_s *next; }; typedef struct nmslist_elem_s nmslist_elem; Where: typedef void* nmptr; Is it possible to write a MACRO that retrieves the data from the element and cast it to the right type: MACRO(type, element) that expands to *((type*)element->data). For example for int, i would need something like this: *((int*)(element->data)) .

    Read the article

  • how to avoid sub-query to gain performance

    - by chun
    hi i have a reporting query which have 2 long sub-query SELECT r1.code_centre, r1.libelle_centre, r1.id_equipe, r1.equipe, r1.id_file_attente, r1.libelle_file_attente,r1.id_date, r1.tranche, r1.id_granularite_de_periode,r1.granularite, r1.ContactsTraites, r1.ContactsenParcage, r1.ContactsenComm, r1.DureeTraitementContacts, r1.DureeComm, r1.DureeParcage, r2.AgentsConnectes, r2.DureeConnexion, r2.DureeTraitementAgents, r2.DureePostTraitement FROM ( SELECT cc.id_centre_contact, cc.code_centre, cc.libelle_centre, a.id_equipe, a.equipe, a.id_file_attente, f.libelle_file_attente, a.id_date, g.tranche, g.id_granularite_de_periode, g.granularite, sum(Nb_Contacts_Traites) as ContactsTraites, sum(Nb_Contacts_en_Parcage) as ContactsenParcage, sum(Nb_Contacts_en_Communication) as ContactsenComm, sum(Duree_Traitement/1000) as DureeTraitementContacts, sum(Duree_Communication / 1000 + Duree_Conference / 1000 + Duree_Com_Interagent / 1000) as DureeComm, sum(Duree_Parcage/1000) as DureeParcage FROM agr_synthese_activite_media_fa_agent a, centre_contact cc, direction_contact dc, granularite_de_periode g, media m, file_attente f WHERE m.id_media = a.id_media AND cc.id_centre_contact = a.id_centre_contact AND a.id_direction_contact = dc.id_direction_contact AND dc.direction_contact ='INCOMING' AND a.id_file_attente = f.id_file_attente AND m.media = 'PHONE' AND ( ( g.valeur_min = date_format(a.id_date,'%d/%m') and g.granularite = 'Jour') or ( g.granularite = 'Heure' and a.id_th_heure = g.id_granularite_de_periode) ) GROUP by cc.id_centre_contact, a.id_equipe, a.id_file_attente, a.id_date, g.tranche, g.id_granularite_de_periode) r1, ( (SELECT cc.id_centre_contact,cc.code_centre, cc.libelle_centre, a.id_equipe, a.equipe, a.id_date, g.tranche, g.id_granularite_de_periode,g.granularite, count(distinct a.id_agent) as AgentsConnectes, sum(Duree_Connexion / 1000) as DureeConnexion, sum(Duree_en_Traitement / 1000) as DureeTraitementAgents, sum(Duree_en_PostTraitement / 1000) as DureePostTraitement FROM activite_agent a, centre_contact cc, granularite_de_periode g WHERE ( g.valeur_min = date_format(a.id_date,'%d/%m') and g.granularite = 'Jour') AND cc.id_centre_contact = a.id_centre_contact GROUP BY cc.id_centre_contact, a.id_equipe, a.id_date, g.tranche, g.id_granularite_de_periode ) UNION (SELECT cc.id_centre_contact,cc.code_centre, cc.libelle_centre, a.id_equipe, a.equipe, a.id_date, g.tranche, g.id_granularite_de_periode,g.granularite, count(distinct a.id_agent) as AgentsConnectes, sum(Duree_Connexion / 1000) as DureeConnexion, sum(Duree_en_Traitement / 1000) as DureeTraitementAgents, sum(Duree_en_PostTraitement / 1000) as DureePostTraitement FROM activite_agent a, centre_contact cc, granularite_de_periode g WHERE ( g.granularite = 'Heure' AND a.id_th_heure = g.id_granularite_de_periode) AND cc.id_centre_contact = a.id_centre_contact GROUP BY cc.id_centre_contact,a.id_equipe, a.id_date, g.tranche, g.id_granularite_de_periode) ) r2 WHERE r1.id_centre_contact = r2.id_centre_contact AND r1.id_equipe = r2.id_equipe AND r1.id_date = r2.id_date AND r1.tranche = r2.tranche AND r1.id_granularite_de_periode = r2.id_granularite_de_periode GROUP BY r1.id_centre_contact , r1.id_equipe, r1.id_file_attente, r1.id_date, r1.tranche, r1.id_granularite_de_periode ORDER BY r1.code_centre, r1.libelle_centre, r1.equipe, r1.libelle_file_attente, r1.id_date, r1.id_granularite_de_periode,r1.tranche the EXPLAIN shows | id | select_type | table | type| possible_keys | key | key_len | ref| rows | Extra | '1', 'PRIMARY', '<derived3>', 'ALL', NULL, NULL, NULL, NULL, '2520', 'Using temporary; Using filesort' '1', 'PRIMARY', '<derived2>', 'ALL', NULL, NULL, NULL, NULL, '4378', 'Using where; Using join buffer' '3', 'DERIVED', 'a', 'ALL', 'fk_Activite_Agent_centre_contact', NULL, NULL, NULL, '83433', 'Using temporary; Using filesort' '3', 'DERIVED', 'g', 'ref', 'Index_granularite,Index_Valeur_min', 'Index_Valeur_min', '23', 'func', '1', 'Using where' '3', 'DERIVED', 'cc', 'ALL', 'PRIMARY', NULL, NULL, NULL, '6', 'Using where; Using join buffer' '4', 'UNION', 'g', 'ref', 'PRIMARY,Index_granularite', 'Index_granularite', '23', '', '24', 'Using where; Using temporary; Using filesort' '4', 'UNION', 'a', 'ref', 'fk_Activite_Agent_centre_contact,fk_activite_agent_TH_heure', 'fk_activite_agent_TH_heure', '5', 'reporting_acd.g.Id_Granularite_de_periode', '2979', 'Using where' '4', 'UNION', 'cc', 'ALL', 'PRIMARY', NULL, NULL, NULL, '6', 'Using where; Using join buffer' NULL, 'UNION RESULT', '<union3,4>', 'ALL', NULL, NULL, NULL, NULL, NULL, '' '2', 'DERIVED', 'g', 'range', 'PRIMARY,Index_granularite,Index_Valeur_min', 'Index_granularite', '23', NULL, '389', 'Using where; Using temporary; Using filesort' '2', 'DERIVED', 'a', 'ALL', 'fk_agr_synthese_activite_media_fa_agent_centre_contact,fk_agr_synthese_activite_media_fa_agent_direction_contact,fk_agr_synthese_activite_media_fa_agent_file_attente,fk_agr_synthese_activite_media_fa_agent_media,fk_agr_synthese_activite_media_fa_agent_th_heure', NULL, NULL, NULL, '20903', 'Using where; Using join buffer' '2', 'DERIVED', 'cc', 'eq_ref', 'PRIMARY', 'PRIMARY', '4', 'reporting_acd.a.Id_Centre_Contact', '1', '' '2', 'DERIVED', 'f', 'eq_ref', 'PRIMARY', 'PRIMARY', '4', 'reporting_acd.a.Id_File_Attente', '1', '' '2', 'DERIVED', 'dc', 'eq_ref', 'PRIMARY', 'PRIMARY', '4', 'reporting_acd.a.Id_Direction_Contact', '1', 'Using where' '2', 'DERIVED', 'm', 'eq_ref', 'PRIMARY', 'PRIMARY', '4', 'reporting_acd.a.Id_Media', '1', 'Using where' don't know it very clear, but i think is the problem of seems it take full scaning than i change all the sub-query to views(create view as select sub-query), and the result is the same thanks for any advice

    Read the article

  • Use one Socket for send and recieve data

    - by volody
    What makes more sense? use one socket to send and receive data to/from a embedded hardware device use one socket to send data and separate socket to read data Communication is not very intensive but the important point is to receive data as fast as possible. On application side is used Windows XP and up.

    Read the article

  • How to correctly load 32-bit DLL dependencies when running a program from a batch file

    - by neilwhitaker1
    I have written a tool that references Microsoft.TeamFoundation.VersionControl.Client.dll, which is a 32-bit DLL. When I build my tool on 64-bit Windows, I set Visual Studio to specifically target X86 in order to force it to a 32-bit build. Targetting X86 instead of All-CPU's prevents me from getting a BadImageFormatException, as long as I invoke the tool directly (e.g. by typing "myTool.exe" on the command line). However, if I run a batch file that invokes the tool, I still get the exception. This happens even if the batch file runs in a 32-bit command prompt (%WINDIR%\SysWOW64\cmd.exe). What else can I do to make this work?

    Read the article

  • Laptop Backup Synch to the Data Center Without VPN

    - by Sameer
    We would like to synchronize our users or backup their laptops to the data center – looking for suggestions/alternatives to synch them to the data center where they don’t have to know about it. Blue sky like to haves: • Don’t want VPN but needs to secure • Admin can access all files • Global dedup • Select file types only – MS Office, PSTs, PDFs • Incremental change only • Right now 60 users but needs to scale (all Windows7 64 bit) • Can allocate budget if have to Don’t mean to be vague but hoping to get some proven places to start.

    Read the article

  • Delete data from a SQL Server database on a full partition

    - by aleroot
    I have a SQL Server 2005 Database on a dedicated partition, during the time the database grown and now it have occupied all the space on the partition, now the problem is that the only operation I can do on the database is detach, but i want to remove old data from some tables to save space ... How can I remove old data from the database if SQL Server interface doesn't allow to run queries on it ?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Recover data from a Windows Dynamic Volume Spanned Disk

    - by iCe
    I have a dynamic volume created with two spanned partitions over two disk. Recently, one disk has started failing, and I want to copy the data inside that disk to another disk, before replacing it. However I don't know how to select only what is inside the failing disk, because the partitions spans across both disks. Maybe imaging the entire disk should do the work? Or I have to copy all the data from both disks? Thanks in advance!

    Read the article

  • Performance implications of finalizers on JVM

    - by Alexey Romanov
    According to this post, in .Net, Finalizers are actually even worse than that. Besides that they run late (which is indeed a serious problem for many kinds of resources), they are also less powerful because they can only perform a subset of the operations allowed in a destructor (e.g., a finalizer cannot reliably use other objects, whereas a destructor can), and even when writing in that subset finalizers are extremely difficult to write correctly. And collecting finalizable objects is expensive: Each finalizable object, and the potentially huge graph of objects reachable from it, is promoted to the next GC generation, which makes it more expensive to collect by some large multiple. Does this also apply to JVMs in general and to HotSpot in particular?

    Read the article

  • Re-load Android activity data

    - by rhinds
    Hi, I am writing an Android app, part of which will be a survey involving multiple pages of checkbox question and answers. I have created an activity to display the question and options (from the DB) and what I want to do now is when i press the "Next" button it should just reload the current activity with the next question set from the database. (the activity starts with survey.getNextQuestion() - so its just a case of refreshing the activity so it updates) Im sure this is a simple thing to do -any ideas? Thanks

    Read the article

  • Change a Munin server and keep the data

    - by Khelben
    We are migrating some servers, and we need tp change our Munin server. Most of the Munin nodes are not changed, and we would want to keep track of the historical data, if possible. I can set up a new Munin server, but I like to know if it's possible to transfer the old data to the new server, and how to do it.

    Read the article

  • jQuery UI Tabs causes content to be cutoff on page load in IE6/IE7

    - by Patricker
    I have a web page with jQuery UI Tabs on it. Some of the content is in an html table. When the page loads some of the content will be cut off at the end, usually just the last few letters. If I change tabs and come back to the original tab then it fixes itself. This appears to be an issue just with Internet Explorer, specifically IE6/7, I haven't tested it on 8. I believe the issue is directly related to my use of the Blueprint CSS Framework as if I don't use Blueprint then I don't have the issue. Has anyone encountered this before or have any ideas?

    Read the article

  • basic JSON pulling data help..

    - by Webby
    New to json data and struggling i guess the answer is real easy but been bugging me for the last hour.. Sample data { "data": { "userid": "17", "dates": { "timestame": "1275528578", }, "username": "harino54", } } Ok I can pull userid or username easy enough with echo "$t->userid" or echo "$t->username " but how do I pull data from the brackets within ? in this case timestame? cant seem to figure it out.. any ideas?

    Read the article

  • ASP.NET Compiles on page load, but not on Ctrl+Shift+B

    - by Steve Syfuhs
    during debug in cassini the code runs fine, but when I explictly build it, the compile breaks on an object saying it can't find the reference. During a breakpoint shows the proper reference to the object, and I can view the debug intellisense. The code itself is simple using CFTW.Controls; ... controls_LatestPresentations c = LoadControl("~/controls/LatestPresentations.ascx") as controls_LatestPresentations; c.loadContent(); return RenderControl(c); The control is a simple user control, with the namespace CFTW.Controls. The calling code is in a webcontrol, which lives in the same folder. I even tried adding the calling code to the same namespace.

    Read the article

  • Extending hard disk size after hard drive regrow without losing data

    - by Albert Widjaja
    Hi All, I wonder if this is possible to extend or regrow the Linux hard disk partition from 8 GB to 20 GB without losing the existing data on the partition ? at the moment this Ubuntu Linux is deployed on top of VMware and I've just regrow the hard drive from 8 GB into 20 GB but can't see the effect immediately. can anyone suggest how to do this without losing the data ? and I found some strange error message when i do the fdisk -l ?

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 387 388 389 390 391 392 393 394 395 396 397 398  | Next Page >