Search Results

Search found 80052 results on 3203 pages for 'data load performance'.

Page 391/3203 | < Previous Page | 387 388 389 390 391 392 393 394 395 396 397 398  | Next Page >

  • JavaScript tags, performance and W3C

    - by Thomas
    Today I was looking for website optimization content and I found an article talking about move JavaScript scripts to the bottom of the HTML page. Is this valid with W3C's recommendations? I learned that all JavaScript must be inside of head tag... Thank you.

    Read the article

  • Django: text fixture fails to load

    - by Esteban Feldman
    Hi all, Did a dumpdata of my project, then in my new test I added it to fixtures. from django.test import TestCase class TestGoal(TestCase): fixtures = ['test_data.json'] def test_goal(self): """ Tests that 1 + 1 always equals 2. """ self.failUnlessEqual(1 + 1, 2) When running the test I get: Problem installing fixture 'XXX/fixtures/test_data.json': DoesNotExist: XXX matching query does not exist. But manually doing loaddata works fine does not when the db is empty. I do a dropdb, createdb a simple syncdb the try loaddata and it fails, same error. Any clue? Python version 2.6.5, Django 1.1.1

    Read the article

  • Mysql select - improve performances

    - by realshadow
    Hey, I am working on an e-shop which sells products only via loans. I display 10 products per page in any category, each product has 3 different price tags - 3 different loan types. Everything went pretty well during testing time, query execution time was perfect, but today when transfered the changes to the production server, the site "collapsed" in about 2 minutes. The query that is used to select loan types sometimes hangs for ~10 seconds and it happens frequently and thus it cant keep up and its hella slow. The table that is used to store the data has approximately 2 milion records and each select looks like this: SELECT * FROM products_loans WHERE KOD IN("X17/Q30-10", "X17/12", "X17/5-24") AND 369.27 BETWEEN CENA_OD AND CENA_DO; 3 loan types and the price that needs to be in range between CENA_OD and CENA_DO, thus 3 rows are returned. But since I need to display 10 products per page, I need to run it trough a modified select using OR, since I didnt find any other solution to this. I have asked about it here, but got no answer. As mentioned in the referencing post, this has to be done separately since there is no column that could be used in a join (except of course price and code, but that ended very, very badly). Here is the show create table, kod and CENA_OD/CENA_DO very indexed via INDEX. CREATE TABLE `products_loans` ( `KOEF_ID` bigint(20) NOT NULL, `KOD` varchar(30) NOT NULL, `AKONTACIA` int(11) NOT NULL, `POCET_SPLATOK` int(11) NOT NULL, `koeficient` decimal(10,2) NOT NULL default '0.00', `CENA_OD` decimal(10,2) default NULL, `CENA_DO` decimal(10,2) default NULL, `PREDAJNA_CENA` decimal(10,2) default NULL, `AKONTACIA_SUMA` decimal(10,2) default NULL, `TYP_VYHODY` varchar(4) default NULL, `stage` smallint(6) NOT NULL default '1', PRIMARY KEY (`KOEF_ID`), KEY `CENA_OD` (`CENA_OD`), KEY `CENA_DO` (`CENA_DO`), KEY `KOD` (`KOD`), KEY `stage` (`stage`) ) ENGINE=InnoDB DEFAULT CHARSET=utf8 And also selecting all loan types and later filtering them trough php doesnt work good, since each type has over 50k records and the select takes too much time as well... Any ides about improving the speed are appreciated. Edit: Here is the explain +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | id | select_type | table | type | possible_keys | key | key_len | ref | rows | Extra | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | 1 | SIMPLE | products_loans | range | CENA_OD,CENA_DO,KOD | KOD | 92 | NULL | 190158 | Using where | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ I have tried the combined index and it improved the performance on the test server from 0.44 sec to 0.06 sec, I cant access the production server from home though, so I will have to try it tomorrow.

    Read the article

  • Extracting data from Visual FoxPro databases

    - by whitequark
    I just got some 20Gb of data in a Visual FoxPro database with a custom frontend probably written in the same framework, and need to extract that data in any well-known format. I don't know anything about VFP in particular, but as it is SQL, there should be a way of opening an SQL console, or maybe an vfpdump utility. How can I do that? Everything I have now are a bunch of obscure binary files and a frontend executable.

    Read the article

  • Recover data from a Windows Dynamic Volume Spanned Disk

    - by iCe
    I have a dynamic volume created with two spanned partitions over two disk. Recently, one disk has started failing, and I want to copy the data inside that disk to another disk, before replacing it. However I don't know how to select only what is inside the failing disk, because the partitions spans across both disks. Maybe imaging the entire disk should do the work? Or I have to copy all the data from both disks? Thanks in advance!

    Read the article

  • How to load an image in matlab from java

    - by Ian
    Basically I am trying to create a little program that will allow me to make calls in matlab from a jave GUI It's mainly going to be used for image manipulation and deblurring but I am struggling to find a way that will effectively give me full matlab control from the java end I am hoping to have it work like so: { //create matlab execution call String loadImage = " image1 = imread ('imageOnComputer.jpg'); "; //send instruction to matlab and save the path to it so java can //use the newly created variable resultingVariablePath = java.sendInstructionToMatlab(loadImage); //display on the screen java.displayImage(resultingVariablePath); } Basically I am just trying to find out if there is a plugin for matlab (or some java package) that will grant you (pretty much) full control over matlab.

    Read the article

  • Change library load order at run time (like LD_PRELOAD but during execution)

    - by tylerl
    How do I change the library a function loads from during run time? For example, say I want to replace the standard printf function with something new, I can write my own version and compile it into a shared library, then put "LD_PRELOAD=/my/library.so" in the environment before running my executable. But let's say that instead, I want to change that linkage from within the program itself. Surely that must be possible... right?

    Read the article

  • Hyper-V Ubuntu Networking Problems Copying Large Amounts of Data

    - by Anonymous
    I am trying to copy a large amount (about 50 GB) of data over my network from a Hyper-V-hosted virtual machine running Ubuntu 11.04 (Natty Narwhal) to another (non-virtual) Ubuntu host that I plan to use for testing upgrades to one of our web applications. The problem I am having is with the virtual machine, which I shall refer to in what follows as "source.host". This machine is running 64-bit Ubuntu Server with the 2.6.38-8-server kernel and the Microsoft Linux Integration Components for Hyper-V kernel modules (hv_utils, hv_timesource, hv_netvsc, hv_blkvsc, hv_storvsc, and hv_vmbus) loaded. It uses a Hyper-V "synthetic network adapter" for its networking interface. To do the copy, I log on to the machine with the data and run the following commands (Call the remote machine "destination.host".): $ cd /path/to/data $ tar -cvf - datafolder/ | ssh [email protected] "cat > ~/data.tar" This runs for a while and then suddenly stops after transferring somewhere from 2-6 GB. The terminal on the source.host machine displays a Write failed: broken pipe error. The odd part is this: after this occurs, the "source.host" machine is no longer able to talk to the rest of the network. I cannot ping any other hosts on the network from the "source.host" machine, and I cannot ping the "source.host" machine from any other host on the network. I am equally unable to access the any of the web services hosted on "source.host". Running ifconfig on "source.host" shows the network adapter to be up and running as usual with the correct IP address and everything. I tried restarting the networking service with $ /etc/init.d/networking restart but the problem does not go away. Restarting the machine makes it capable of talking to the network again -- it can ping and be pinged by other hosts, and the web services are also accessible and usable as normal -- but attempting the copy operation again results in the same failure, requiring another restart. As an experiment, I tried replacing the tar -- ssh pipeline above with a straight scp: $ scp -r datafolder/ [email protected]:~ but to no avail Thinking that the issue might have to do with the kernel packet-send buffers filling up, I tried increasing the buffer size to 12 MB (up from the 128 KB default) with # echo 12582911 > /proc/sys/net/core/wmem_max but this also had no effect. I'm guessing at this point that it might be a problem with the Microsoft synthetic network driver, but I don't really know. Does anyone have any suggestions? Thank you very much in advance!

    Read the article

  • Performance implications of finalizers on JVM

    - by Alexey Romanov
    According to this post, in .Net, Finalizers are actually even worse than that. Besides that they run late (which is indeed a serious problem for many kinds of resources), they are also less powerful because they can only perform a subset of the operations allowed in a destructor (e.g., a finalizer cannot reliably use other objects, whereas a destructor can), and even when writing in that subset finalizers are extremely difficult to write correctly. And collecting finalizable objects is expensive: Each finalizable object, and the potentially huge graph of objects reachable from it, is promoted to the next GC generation, which makes it more expensive to collect by some large multiple. Does this also apply to JVMs in general and to HotSpot in particular?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Mysql regexp performance question

    - by Tim
    Rumour has it that this; SELECT * FROM lineage_string where lineage like '%179%' and lineage regexp '(^|/)179(/|$)' Would be faster than this; SELECT * FROM lineage_string where lineage regexp '(^|/)179(/|$)' Can anyone confirm ? Or know a decent way to test the speed of such queries. Thanks

    Read the article

  • Velocity engine fails to load template from a remote shared folder

    - by performanceuser
    I have following code File temlateFile = new File( "D:/config/emails/MailBody.vm" ); temlateFile.exists(); VelocityEngine velocityEngine = new VelocityEngine(); velocityEngine.setProperty(RuntimeConstants.RESOURCE_LOADER, "file"); velocityEngine.setProperty("file.resource.loader.class", FileResourceLoader.class.getName()); velocityEngine.setProperty("file.resource.loader.path", temlateFile.getParentFile().getAbsolutePath()); velocityEngine.init(); template = velocityEngine.getTemplate( temlateFile.getName() ); This works because it is loading a file from local file system. Once I change the first like to: File temlateFile = new File( "//remote/config/emails/MailBody.vm" ); It doesn't work. org.apache.velocity.exception.ResourceNotFoundException: Unable to find resource 'MailBody.vm' at org.apache.velocity.runtime.resource.ResourceManagerImpl.loadResource(ResourceManagerImpl.java:474) at org.apache.velocity.runtime.resource.ResourceManagerImpl.getResource(ResourceManagerImpl.java:352) at org.apache.velocity.runtime.RuntimeInstance.getTemplate(RuntimeInstance.java:1533) at org.apache.velocity.runtime.RuntimeInstance.getTemplate(RuntimeInstance.java:1514) at org.apache.velocity.app.VelocityEngine.getTemplate(VelocityEngine.java:373) at com.actuate.iserver.mail.VelocityContent.<init>(VelocityContent.java:33) at com.actuate.iserver.mail.VolumeCreationMail.<init>(VolumeCreationMail.java:40) at com.actuate.iserver.mail.VolumeCreationMail.main(VolumeCreationMail.java:67) In both cases temlateFile.exists() always return true. Any ideas?

    Read the article

  • How to load file into javascript

    - by misha-moroshko
    I have an HTML table that should be updated according the file that user uploads. In other words, I would like user to be able to upload a file, and change the contents of the table according to file content. The file size can be several MB. What are my options ? Do I must to upload the file to a server, or it can be done in client side ? Thanks !

    Read the article

  • GWT tries to load a deleted module

    - by Dmitry
    I am using Eclispe with Google plugin for AppEngine and GWT. Recently I created a test GWT module, but eventually it has been deleted from the project and I can not find any sign of it in the project now. However, whenever I run the web app locally, I get in console the following message: Loading modules com.piq.exemity.Test [ERROR] Unable to find 'com/XXXXXX/Test.gwt.xml' on your classpath; could be a typo, or maybe you forgot to include a classpath entry for source? Has anyone got any idea where it can be hiding?

    Read the article

  • how to load a module within python debugger

    - by MK
    This looks like something simple but I could not find the answer so far - I have just learnt python and need to start learning pdb. In my module I have the usual if __name__ == __main_ trick to execute some code when the module is run as a program. So far I have been running it via python -m mymod arg1 arg2 syntax Now I want to do exactly the same thing from inside pdb. Normally in C, I would just do gdb mybinary followed by run arg1 arg2 But I cannot figure out how to achieve the same thing in pdb. I am sure there has to be a simple way to achieve this but it is taking me too long to search for it.. Thanks for your help!

    Read the article

  • Stopping cookies being set from a domain (aka "cookieless domain") to increase site performance

    - by Django Reinhardt
    I was reading in Google's documentation about improving site speed. One of their recommendations is serving static content (images, css, js, etc.) from a "cookieless domain": Static content, such as images, JS and CSS files, don't need to be accompanied by cookies, as there is no user interaction with these resources. You can decrease request latency by serving static resources from a domain that doesn't serve cookies. Google then says that the best way to do this is to buy a new domain and set it to point to your current one: To reserve a cookieless domain for serving static content, register a new domain name and configure your DNS database with a CNAME record that points the new domain to your existing domain A record. Configure your web server to serve static resources from the new domain, and do not allow any cookies to be set anywhere on this domain. In your web pages, reference the domain name in the URLs for the static resources. This is pretty straight forward stuff, except for the bit where it says to "configure your web server to serve static resources from the new domain, and do not allow any cookies to be set anywhere on this domain". From what I've read, there's no setting in IIS that allows you to say "serve static resources", so how do I prevent ASP.NET from setting cookies on this new domain? At present, even if I'm just requesting a .jpg from the new domain, it sets a cookie on my browser, even though our application's cookies are set to our old domain. For example, ASP.NET sets an ".ASPXANONYMOUS" cookie that (as far as I'm aware) we're not telling it to do. Apologies if this is a real newb question, I'm new at this! Thanks.

    Read the article

  • Flex 3 - Image flickers at first load

    - by BS_C3
    Hello Community! I have an application with different components that are accessible through a viewstack in the main application. The main application looks like that: <Application> <Viewstack> <myComponent1/> <myComponent2/> <myComponent3/> . . . </Viewstack> </Application> In myComponent1, I have a horizontalList where the user can select a product. In myComponent2, I have 2 containers inside the component. A left container with a larger image of the product selected in myComponent1 and a right container with all characteristics of the product. Both containers have an embed background image. When I select a product in myComponent1, the application displays myComponent2. When the component is displayed, I first see the page without the large image of the product, then both containers flickers and the product image is displayed. How could I avoid this flickering? It's really annoying _< Thanks in advance for your help =) Regards. BS_C3

    Read the article

  • Aptana studio won`t load ?

    - by Gabri
    i`m using a standalone version of Aptana and i have just finished reformatting when i tried to launch Aptana i got this error "Could not launch the product because the specified workspace cannot be created. The specified workspace directory is either invalid or read-only." how can i solve this ?

    Read the article

  • pyInotify performance

    - by tranimatronic
    I have a very large directory tree I am wanting pyInotify to watch. Is it better to have pyInotify watch the entire tree or is it better to have a number of watches reporting changes to specific files ? Thanks

    Read the article

  • Radiobuttonlist and load page in same initial position

    - by Khalid
    Hi I have this simple code in my page, I have a long page, if the client use this button then it shall reload the page and display the page from the beginning. I wish to be reload the page and display from the last position. <asp:RadioButtonList ID="RadioButtonList5" runat="server" AutoPostBack="True" RepeatDirection="Horizontal"> <asp:ListItem Value="45">Sheet2</asp:ListItem> </asp:RadioButtonList> Any advice, apprciated. Thank you.

    Read the article

  • Extending hard disk size after hard drive regrow without losing data

    - by Albert Widjaja
    Hi All, I wonder if this is possible to extend or regrow the Linux hard disk partition from 8 GB to 20 GB without losing the existing data on the partition ? at the moment this Ubuntu Linux is deployed on top of VMware and I've just regrow the hard drive from 8 GB into 20 GB but can't see the effect immediately. can anyone suggest how to do this without losing the data ? and I found some strange error message when i do the fdisk -l ?

    Read the article

  • cURL Upload file AND send POST data

    - by kisplit
    Hello, I have a web server running some PHP that checks for an image (curl -F 'imageName=@myimage') and it also checks the POST data for username=&password=. When the PHP checks _REQUEST I can just do: curl -F 'imageName=@myimage' 'http://www.example.com/?upload=1&username=test&password=test' I need to instead check _POST for username and password due to specs. How can I upload the image and have the username=&password= post data? Any help appreciated!

    Read the article

  • wordexp followed by strcpy = EXC_BAD_ACCESS + sharedlibrary apply-load-rules-all

    - by fyngyrz
    The implication is a memory problem. I have static allocations for these: char akdir[400]; char homedir[400]; This crashes on the first strcpy(): void setuplibfoo() { long ii; double x; wordexp_t result; // This obtains the user's home directory // -------------------------------------- homedir[0]=0; // in case wordexp fails switch (wordexp("~/",&result,0)) { case 0: // Successful. We'll fall into deallocate when done. { strcpy(homedir,result.we_wordv[0]); // <<--- CRASH! strcpy(akdir,homedir); strcat(akdir,"ak-plugins/"); vs_status(akdir); } case WRDE_NOSPACE: // If the error was WRDE_NOSPACE, then { // perhaps part of the result was allocated. wordfree (&result); } default: // all other errors do not require deallocation { break; } } ...additional code clipped.. doesn't get there on crash. This is in a shared library I've written that is linked to my application, also something I've written. In this case, it doesn't get very far, although if it starts, it's fine. ...I've read the wordexp docs several times; they say they allocate new objects, so you just set up that type and call them with the address. The switch error model is right from the wordexp docs: http://www.gnu.org/s/libc/manual/html_mono/libc.html#Wordexp-Example It doesn't always crash. Just sometimes, and just under 10.6. Never under 10.5 I'm building debug mode with XCode 3.1.1, under OSX 10.5.8 it seems to run ok, I've not seen a crash -- under 10.6, it crashes... sometimes. But always with that same exception, and always in the same place. The Google has it that this actually means, somehow, that it's too soon to allocate memory. But all the instances I could find were memory errors on the part of the programmer. Overruns, etc. And I can't find any docs on when it IS safe to allocate memory. Now, the path that expands there is nowhere near 400 characters. it's this (it it completes): /Users/flake/ak-plugins/ and this: /Users/flake/ ...if it doesn't. the strcpy... copies 2nd param to first. Theirs to mine. And it works! under 10.5. :/ So is wordexp broke? Is 10.6 broke? Am I cRaZy? Here's the debugger output: 0x00013446 <+0049> call 0xc98da <dyld_stub_wordexp> 0x0001344b <+0054> test %eax,%eax 0x0001344d <+0056> je 0x13454 <setuplibfoo+63> 0x0001344f <+0058> jmp 0x134da <setuplibfoo+197> 0x00013454 <+0063> mov -0x1c(%ebp),%eax 0x00013457 <+0066> mov (%eax),%eax 0x00013459 <+0068> mov %eax,0x4(%esp) 0x0001345d <+0072> lea 0xb6cc2(%ebx),%eax 0x00013463 <+0078> mov (%eax),%eax 0x00013465 <+0080> mov %eax,(%esp) 0x00013468 <+0083> call 0xc9898 <dyld_stub_strcpy> 0x0001346d <+0088> lea 0xb6cc2(%ebx),%eax <<--CRASH!

    Read the article

  • basic JSON pulling data help..

    - by Webby
    New to json data and struggling i guess the answer is real easy but been bugging me for the last hour.. Sample data { "data": { "userid": "17", "dates": { "timestame": "1275528578", }, "username": "harino54", } } Ok I can pull userid or username easy enough with echo "$t->userid" or echo "$t->username " but how do I pull data from the brackets within ? in this case timestame? cant seem to figure it out.. any ideas?

    Read the article

< Previous Page | 387 388 389 390 391 392 393 394 395 396 397 398  | Next Page >