Search Results

Search found 80052 results on 3203 pages for 'data load performance'.

Page 391/3203 | < Previous Page | 387 388 389 390 391 392 393 394 395 396 397 398  | Next Page >

  • Pre-load audio files at the client-side for later use

    - by awj
    I'm building an online test which implements audio (mp3) using the native audio player (i.e. non Flash-based). The test shows one question at a time and loads each subsequent question asynchronously. Some questions have an accompanying audio file, others don't, and the audio files can be several MB in size. So what I'm hoping to do is to preload the audio files client-side at the start of the test and then move these into place when the relevant question comes up. So far I've tried loading an audio file into a QuickTime player, then when that question comes up I use jQuery's clone(true) method to copy this into a part of the page which is displayed. However, when I do this the QuickTime player has to reload the audio file from source. Same is true for Windows Media Player. Does anyone have any suggestions as to how I can preload the audio client-side and then call it forward when needed?

    Read the article

  • Mysql select - improve performances

    - by realshadow
    Hey, I am working on an e-shop which sells products only via loans. I display 10 products per page in any category, each product has 3 different price tags - 3 different loan types. Everything went pretty well during testing time, query execution time was perfect, but today when transfered the changes to the production server, the site "collapsed" in about 2 minutes. The query that is used to select loan types sometimes hangs for ~10 seconds and it happens frequently and thus it cant keep up and its hella slow. The table that is used to store the data has approximately 2 milion records and each select looks like this: SELECT * FROM products_loans WHERE KOD IN("X17/Q30-10", "X17/12", "X17/5-24") AND 369.27 BETWEEN CENA_OD AND CENA_DO; 3 loan types and the price that needs to be in range between CENA_OD and CENA_DO, thus 3 rows are returned. But since I need to display 10 products per page, I need to run it trough a modified select using OR, since I didnt find any other solution to this. I have asked about it here, but got no answer. As mentioned in the referencing post, this has to be done separately since there is no column that could be used in a join (except of course price and code, but that ended very, very badly). Here is the show create table, kod and CENA_OD/CENA_DO very indexed via INDEX. CREATE TABLE `products_loans` ( `KOEF_ID` bigint(20) NOT NULL, `KOD` varchar(30) NOT NULL, `AKONTACIA` int(11) NOT NULL, `POCET_SPLATOK` int(11) NOT NULL, `koeficient` decimal(10,2) NOT NULL default '0.00', `CENA_OD` decimal(10,2) default NULL, `CENA_DO` decimal(10,2) default NULL, `PREDAJNA_CENA` decimal(10,2) default NULL, `AKONTACIA_SUMA` decimal(10,2) default NULL, `TYP_VYHODY` varchar(4) default NULL, `stage` smallint(6) NOT NULL default '1', PRIMARY KEY (`KOEF_ID`), KEY `CENA_OD` (`CENA_OD`), KEY `CENA_DO` (`CENA_DO`), KEY `KOD` (`KOD`), KEY `stage` (`stage`) ) ENGINE=InnoDB DEFAULT CHARSET=utf8 And also selecting all loan types and later filtering them trough php doesnt work good, since each type has over 50k records and the select takes too much time as well... Any ides about improving the speed are appreciated. Edit: Here is the explain +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | id | select_type | table | type | possible_keys | key | key_len | ref | rows | Extra | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | 1 | SIMPLE | products_loans | range | CENA_OD,CENA_DO,KOD | KOD | 92 | NULL | 190158 | Using where | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ I have tried the combined index and it improved the performance on the test server from 0.44 sec to 0.06 sec, I cant access the production server from home though, so I will have to try it tomorrow.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Radiobuttonlist and load page in same initial position

    - by Khalid
    Hi I have this simple code in my page, I have a long page, if the client use this button then it shall reload the page and display the page from the beginning. I wish to be reload the page and display from the last position. <asp:RadioButtonList ID="RadioButtonList5" runat="server" AutoPostBack="True" RepeatDirection="Horizontal"> <asp:ListItem Value="45">Sheet2</asp:ListItem> </asp:RadioButtonList> Any advice, apprciated. Thank you.

    Read the article

  • Improve performance writing 10 million records to text file using windows service

    - by user1039583
    I'm fetching more than 10 millions of records from database and writing to a text file. It takes hours of time to complete this operation. Is there any option to use TPL features here? It would be great if someone could get me started implementing this with the TPL. using (FileStream fStream = new FileStream("d:\\file.txt", FileMode.OpenOrCreate, FileAccess.ReadWrite)) { BufferedStream bStream = new BufferedStream(fStream); TextWriter writer = new StreamWriter(bStream); for (int i = 0; i < 100000000; i++) { writer.WriteLine(i); } bStream.Flush(); writer.Flush(); // empty buffer; fStream.Flush(); }

    Read the article

  • Flex 3 - Image flickers at first load

    - by BS_C3
    Hello Community! I have an application with different components that are accessible through a viewstack in the main application. The main application looks like that: <Application> <Viewstack> <myComponent1/> <myComponent2/> <myComponent3/> . . . </Viewstack> </Application> In myComponent1, I have a horizontalList where the user can select a product. In myComponent2, I have 2 containers inside the component. A left container with a larger image of the product selected in myComponent1 and a right container with all characteristics of the product. Both containers have an embed background image. When I select a product in myComponent1, the application displays myComponent2. When the component is displayed, I first see the page without the large image of the product, then both containers flickers and the product image is displayed. How could I avoid this flickering? It's really annoying _< Thanks in advance for your help =) Regards. BS_C3

    Read the article

  • How to load file into javascript

    - by misha-moroshko
    I have an HTML table that should be updated according the file that user uploads. In other words, I would like user to be able to upload a file, and change the contents of the table according to file content. The file size can be several MB. What are my options ? Do I must to upload the file to a server, or it can be done in client side ? Thanks !

    Read the article

  • Laptop Backup Synch to the Data Center Without VPN

    - by Sameer
    We would like to synchronize our users or backup their laptops to the data center – looking for suggestions/alternatives to synch them to the data center where they don’t have to know about it. Blue sky like to haves: • Don’t want VPN but needs to secure • Admin can access all files • Global dedup • Select file types only – MS Office, PSTs, PDFs • Incremental change only • Right now 60 users but needs to scale (all Windows7 64 bit) • Can allocate budget if have to Don’t mean to be vague but hoping to get some proven places to start.

    Read the article

  • Aptana studio won`t load ?

    - by Gabri
    i`m using a standalone version of Aptana and i have just finished reformatting when i tried to launch Aptana i got this error "Could not launch the product because the specified workspace cannot be created. The specified workspace directory is either invalid or read-only." how can i solve this ?

    Read the article

  • pyInotify performance

    - by tranimatronic
    I have a very large directory tree I am wanting pyInotify to watch. Is it better to have pyInotify watch the entire tree or is it better to have a number of watches reporting changes to specific files ? Thanks

    Read the article

  • Stopping cookies being set from a domain (aka "cookieless domain") to increase site performance

    - by Django Reinhardt
    I was reading in Google's documentation about improving site speed. One of their recommendations is serving static content (images, css, js, etc.) from a "cookieless domain": Static content, such as images, JS and CSS files, don't need to be accompanied by cookies, as there is no user interaction with these resources. You can decrease request latency by serving static resources from a domain that doesn't serve cookies. Google then says that the best way to do this is to buy a new domain and set it to point to your current one: To reserve a cookieless domain for serving static content, register a new domain name and configure your DNS database with a CNAME record that points the new domain to your existing domain A record. Configure your web server to serve static resources from the new domain, and do not allow any cookies to be set anywhere on this domain. In your web pages, reference the domain name in the URLs for the static resources. This is pretty straight forward stuff, except for the bit where it says to "configure your web server to serve static resources from the new domain, and do not allow any cookies to be set anywhere on this domain". From what I've read, there's no setting in IIS that allows you to say "serve static resources", so how do I prevent ASP.NET from setting cookies on this new domain? At present, even if I'm just requesting a .jpg from the new domain, it sets a cookie on my browser, even though our application's cookies are set to our old domain. For example, ASP.NET sets an ".ASPXANONYMOUS" cookie that (as far as I'm aware) we're not telling it to do. Apologies if this is a real newb question, I'm new at this! Thanks.

    Read the article

  • how to work with datagridview if need show many columns data (approx 1Mio)

    - by ruprog
    is a problem to display data in Datagridview. A large amount of data (stock quotes) data to be displayed from left to right Tell me what to do to display an array of data in datagridviev Public dat As New List(Of act) Public Class act Public time As Date Public price As Integer End Class Sub work() Dim r As New Random For x As Integer = 0 To 1000000 Dim el As New act el.time = Now el.price = r.Next(0, 1000) dat.Add(New act) Next End Sub

    Read the article

  • Performance implications of finalizers on JVM

    - by Alexey Romanov
    According to this post, in .Net, Finalizers are actually even worse than that. Besides that they run late (which is indeed a serious problem for many kinds of resources), they are also less powerful because they can only perform a subset of the operations allowed in a destructor (e.g., a finalizer cannot reliably use other objects, whereas a destructor can), and even when writing in that subset finalizers are extremely difficult to write correctly. And collecting finalizable objects is expensive: Each finalizable object, and the potentially huge graph of objects reachable from it, is promoted to the next GC generation, which makes it more expensive to collect by some large multiple. Does this also apply to JVMs in general and to HotSpot in particular?

    Read the article

  • basic JSON pulling data help..

    - by Webby
    New to json data and struggling i guess the answer is real easy but been bugging me for the last hour.. Sample data { "data": { "userid": "17", "dates": { "timestame": "1275528578", }, "username": "harino54", } } Ok I can pull userid or username easy enough with echo "$t->userid" or echo "$t->username " but how do I pull data from the brackets within ? in this case timestame? cant seem to figure it out.. any ideas?

    Read the article

  • Django: text fixture fails to load

    - by Esteban Feldman
    Hi all, Did a dumpdata of my project, then in my new test I added it to fixtures. from django.test import TestCase class TestGoal(TestCase): fixtures = ['test_data.json'] def test_goal(self): """ Tests that 1 + 1 always equals 2. """ self.failUnlessEqual(1 + 1, 2) When running the test I get: Problem installing fixture 'XXX/fixtures/test_data.json': DoesNotExist: XXX matching query does not exist. But manually doing loaddata works fine does not when the db is empty. I do a dropdb, createdb a simple syncdb the try loaddata and it fails, same error. Any clue? Python version 2.6.5, Django 1.1.1

    Read the article

  • how to load a module within python debugger

    - by MK
    This looks like something simple but I could not find the answer so far - I have just learnt python and need to start learning pdb. In my module I have the usual if __name__ == __main_ trick to execute some code when the module is run as a program. So far I have been running it via python -m mymod arg1 arg2 syntax Now I want to do exactly the same thing from inside pdb. Normally in C, I would just do gdb mybinary followed by run arg1 arg2 But I cannot figure out how to achieve the same thing in pdb. I am sure there has to be a simple way to achieve this but it is taking me too long to search for it.. Thanks for your help!

    Read the article

  • How to load an image in matlab from java

    - by Ian
    Basically I am trying to create a little program that will allow me to make calls in matlab from a jave GUI It's mainly going to be used for image manipulation and deblurring but I am struggling to find a way that will effectively give me full matlab control from the java end I am hoping to have it work like so: { //create matlab execution call String loadImage = " image1 = imread ('imageOnComputer.jpg'); "; //send instruction to matlab and save the path to it so java can //use the newly created variable resultingVariablePath = java.sendInstructionToMatlab(loadImage); //display on the screen java.displayImage(resultingVariablePath); } Basically I am just trying to find out if there is a plugin for matlab (or some java package) that will grant you (pretty much) full control over matlab.

    Read the article

  • Extracting data from Visual FoxPro databases

    - by whitequark
    I just got some 20Gb of data in a Visual FoxPro database with a custom frontend probably written in the same framework, and need to extract that data in any well-known format. I don't know anything about VFP in particular, but as it is SQL, there should be a way of opening an SQL console, or maybe an vfpdump utility. How can I do that? Everything I have now are a bunch of obscure binary files and a frontend executable.

    Read the article

  • cURL Upload file AND send POST data

    - by kisplit
    Hello, I have a web server running some PHP that checks for an image (curl -F 'imageName=@myimage') and it also checks the POST data for username=&password=. When the PHP checks _REQUEST I can just do: curl -F 'imageName=@myimage' 'http://www.example.com/?upload=1&username=test&password=test' I need to instead check _POST for username and password due to specs. How can I upload the image and have the username=&password= post data? Any help appreciated!

    Read the article

  • Use one Socket for send and recieve data

    - by volody
    What makes more sense? use one socket to send and receive data to/from a embedded hardware device use one socket to send data and separate socket to read data Communication is not very intensive but the important point is to receive data as fast as possible. On application side is used Windows XP and up.

    Read the article

  • Hyper-V Ubuntu Networking Problems Copying Large Amounts of Data

    - by Anonymous
    I am trying to copy a large amount (about 50 GB) of data over my network from a Hyper-V-hosted virtual machine running Ubuntu 11.04 (Natty Narwhal) to another (non-virtual) Ubuntu host that I plan to use for testing upgrades to one of our web applications. The problem I am having is with the virtual machine, which I shall refer to in what follows as "source.host". This machine is running 64-bit Ubuntu Server with the 2.6.38-8-server kernel and the Microsoft Linux Integration Components for Hyper-V kernel modules (hv_utils, hv_timesource, hv_netvsc, hv_blkvsc, hv_storvsc, and hv_vmbus) loaded. It uses a Hyper-V "synthetic network adapter" for its networking interface. To do the copy, I log on to the machine with the data and run the following commands (Call the remote machine "destination.host".): $ cd /path/to/data $ tar -cvf - datafolder/ | ssh [email protected] "cat > ~/data.tar" This runs for a while and then suddenly stops after transferring somewhere from 2-6 GB. The terminal on the source.host machine displays a Write failed: broken pipe error. The odd part is this: after this occurs, the "source.host" machine is no longer able to talk to the rest of the network. I cannot ping any other hosts on the network from the "source.host" machine, and I cannot ping the "source.host" machine from any other host on the network. I am equally unable to access the any of the web services hosted on "source.host". Running ifconfig on "source.host" shows the network adapter to be up and running as usual with the correct IP address and everything. I tried restarting the networking service with $ /etc/init.d/networking restart but the problem does not go away. Restarting the machine makes it capable of talking to the network again -- it can ping and be pinged by other hosts, and the web services are also accessible and usable as normal -- but attempting the copy operation again results in the same failure, requiring another restart. As an experiment, I tried replacing the tar -- ssh pipeline above with a straight scp: $ scp -r datafolder/ [email protected]:~ but to no avail Thinking that the issue might have to do with the kernel packet-send buffers filling up, I tried increasing the buffer size to 12 MB (up from the 128 KB default) with # echo 12582911 > /proc/sys/net/core/wmem_max but this also had no effect. I'm guessing at this point that it might be a problem with the Microsoft synthetic network driver, but I don't really know. Does anyone have any suggestions? Thank you very much in advance!

    Read the article

  • Change library load order at run time (like LD_PRELOAD but during execution)

    - by tylerl
    How do I change the library a function loads from during run time? For example, say I want to replace the standard printf function with something new, I can write my own version and compile it into a shared library, then put "LD_PRELOAD=/my/library.so" in the environment before running my executable. But let's say that instead, I want to change that linkage from within the program itself. Surely that must be possible... right?

    Read the article

< Previous Page | 387 388 389 390 391 392 393 394 395 396 397 398  | Next Page >