Search Results

Search found 29682 results on 1188 pages for 'josh line'.

Page 393/1188 | < Previous Page | 389 390 391 392 393 394 395 396 397 398 399 400  | Next Page >

• zeromq installtion on mac os snow leopard

  - by Ashish

  I have installed zeromq 2.1.11 on mac os x using the steps given on http://www.zeromq.org/area:download Then i installed pyzmq (python bindings ) But i get the following error : import zmq Traceback (most recent call last): File "<pyshell#1>", line 1, in <module> import zmq File "/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/zmq/__init__.py", line 35, in <module> from zmq.utils import initthreads # initialize threads ImportError: dlopen(/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/zmq/utils/initthreads.so, 2): no suitable image found. Did find: /Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/zmq/utils/initthreads.so: no matching architecture in universal wrapper

  Read the article

• How do you move the pointer up or down multiple lines with Emacs?

  - by Peter

  I can move my pointer up and down one line with my arrow key just fine in Emacs, so I'd like to redefine C-n and C-p to move up and down 5 lines at a time. I'm just beginning to learn how to use Emacs, and elisp is very alien to me. I tried using the GNU Emacs lisp reference, but I couldn't find how to bind a keystroke to multiple commands. Here's what I have so far (concentrating on the moving up definition): (global-set-key "\C-p" '(loop for i in '(1 2 3 4 5) do ('previous-line))) But, this brings up an error message when I hit C-p, "Wrong type argument." Any suggestions? Thanks!

  Read the article

• NSUserDefaults and default language used for I18N

  - by fedmest

  I have searched around a lot for this and found some answers that sounded quite like what I wanted but never worked. I simply need to have my iPhone app load NIBs and Localizable.strings that I decide (through user selection) rather than the ones that are established through the global iPhone/iPad settings. General consensus seems to be that this line [[NSUserDefaults standardUserDefaults] setObject:[NSArray arrayWithObject:@"ro"] forKey:@"AppleLanguages"]; would do the trick (in this specific case, load the NIBs and Localizable.strings in ro.lproj) but I have not had such luck. It keeps on looking for the files in en.lproj or whatever language I chose in the Settings app. I have then tried adding this line [[NSUserDefaults standardUserDefaults] setObject:[NSArray arrayWithObject:@"ro_RO"] forKey:@"AppleLocale"]; and to my great surprise, it worked! ...only once :-( then back to the same issue. Has anyone got any idea how to solve this issue? The aforementioned code was added at the very start of applicationDidFinishLaunching, which is before any NIBs or strings files should be loaded.

  Read the article

• Why first arg to execve() must be path to executable

  - by EBM

  I understand that execve() and family require the first argument of its argument array to be the same as the executable that is also pointed to by its first argument. That is, in this: execve(prog, args, env); args[0] will usually be the same as prog. But I can't seem to find information as to why this is. I also understand that executables (er, at least shell scripts) always have their calling path as the first argument when running, but I would think that the shell would do the work to put it there, and execve() would just call the executable using the path given in its first argument ("prog" from above), then passing the argument array ("args" from above) as one would on the command line.... i.e., I don't call scripts on the command line with a duplicate executable path in the args list.... /bin/ls /bin/ls /home/john Can someone explain?

  Read the article

• Use matching value of a RegExp to name the output file.

  - by fx42

  I have this file "file.txt" which I want to split into many smaller ones. Each line of the file has an id field which looks like "id:1" for a line belonging to id 1. For each id in the file, I like to create a file named idid.txt and put all lines that belong to this id in that file. My brute force bash script solution reads as follows. count=1 while [ $count -lt 19945 ] do cat file.txt | grep "id:$count " >> ./sets/id$count.txt count='expr $count + 1' done Now this is very inefficient as I have do read through the file about 20.000 times. Is there a way to do the same operation with only one pass through the file? - What I'm probably asking for is a way to use the value that matches for a regular expression to name the associated output file.

  Read the article

• Which network protocol to use for lightweight notification of remote apps?

  - by Chris Thornton

  I have this situation.... Client-initiated SOAP 1.1 communication between one server and let's say, tens of thousands of clients. Clients are external, coming in through our firewall, authenticated by certificate, https, etc.. They can be anywhere, and usually have their own firewalls, NAT routers, etc... They're truely external, not just remote corporate offices. They could be in a corporate/campus network, DSL/Cable, even Dialup. Client uses Delphi (2005 + SOAP fixes from 2007), and the server is C#, but from an architecture/design standpoint, that shouldn't matter. Currently, clients push new data to the server and pull new data from the server on 15-minute polling loop. The server currently does not push data - the client hits the "messagecount" method, to see if there is new data to pull. If 0, it sleeps for another 15 min and checks again. We're trying to get that down to 7 seconds. If this were an internal app, with one or just a few dozen clients, we'd write a cilent "listener" soap service, and would push data to it. But since they're external, sit behind their own firewalls, and sometimes private networks behind NAT routers, this is not practical. So we're left with polling on a much quicker loop. 10K clients, each checking their messagecount every 10 seconds, is going to be 1000/sec messages that will mostly just waste bandwidth, server, firewall, and authenticator resources. So I'm trying to design something better than what would amount to a self-inflicted DoS attack. I don't think it's practical to have the server send soap messages to the client (push) as this would require too much configuration at the client end. But I think there are alternatives that I don't know about. Such as: 1) Is there a way for the client to make a request for GetMessageCount() via Soap 1.1, and get the response, and then perhaps, "stay on the line" for perhaps 5-10 minutes to get additional responses in case new data arrives? i.e the server says "0", then a minute later in response to some SQL trigger (the server is C# on Sql Server, btw), knows that this client is still "on the line" and sends the updated message count of "5"? 2) Is there some other protocol that we could use to "ping" the client, using information gathered from their last GetMessageCount() request? 3) I don't even know. I guess I'm looking for some magic protocol where the client can send a GetMessageCount() request, which would include info for "oh by the way, in case the answer changes in the next hour, ping me at this address...". Also, I'm assuming that any of these "keep the line open" schemes would seriously impact the server sizing, as it would need to keep many thousands of connections open, simultaneously. That would likely impact the firewalls too, I think. Is there anything out there like that? Or am I pretty much stuck with polling? TIA, Chris

  Read the article

• Python: User-Defined Exception That Proves The Rule

  - by bandana

  Python documentations states: Exceptions should typically be derived from the Exception class, either directly or indirectly. the word 'typically' leaves me in an ambiguous state. consider the code: class good(Exception): pass class bad(object): pass Heaven = good() Hell = bad() >>> raise Heaven Traceback (most recent call last): File "<pyshell#163>", line 1, in <module> raise Heaven good >>> raise Hell Traceback (most recent call last): File "<pyshell#171>", line 1, in <module> raise Hell TypeError: exceptions must be classes or instances, not bad so when reading the python docs, should i change 'typically' with ''? what if i have a class hierarchy that has nothing to do with the Exception class, and i want to 'raise' objects belonging to the hierarchy? i can always raise an exception with an argument: raise Exception, Hell This seems slightly awkward to me What's so special about the Exception class, that only its family members can be raised?

  Read the article

• Visual C++ 2008 doesn't recognize Windows declared types

  - by David Thornley

  I have a program that doesn't seem to recognize declared types in the latest U3D software. There's a line typedef BOOL (WINAPI* GMI)(HMON, LPMONITORINFOEX); which gets the error: Error 1 error C2061: syntax error : identifier 'LPMONITORINFOEX' c:\Projects\U3D\Source\RTL\Platform\Common\Win32\IFXOSRender.cpp 28 and a line MONITORINFOEX miMon; which gets Error 5 error C2065: 'miMon' : undeclared identifier c:\Projects\U3D\Source\RTL\Platform\Common\Win32\IFXOSRender.cpp 49 Error 3 error C2065: 'MONITORINFOEX' : undeclared identifier c:\Projects\U3D\Source\RTL\Platform\Common\Win32\IFXOSRender.cpp 49 The program's first non-comment statement is #include <windows.h>, which includes winuser.h, which defines these identifiers. In Visual Studio, I can right-click on them and go to the definition (a typedef) and from the typedef to the struct. WINAPI is defined in WinDef.h, so that seems to be working. There are no redefinitions of LPMONITORINFOEX or MONITORINFOEX in any other file. So, how can this be happening, and what can I do about it?

  Read the article

• Sending message from one server to another in Twisted

  - by Casey Patton

  I've implemented my servers in the following way: def makeServer(application, port): factory = protocol.ServerFactory() factory.protocol = MyChat factory.clients = [] internet.TCPServer(port, factory).setServiceParent(application) application = service.Application("chatserver") server1 = makeServer(application, port=1025) server2 = makeServer(application, port=1026) server3 = makeServer(application, port=1027) Note that MyChat is an event handling class that has a "receiveMessage" action: def lineReceived(self, line): print "received", repr(line) for c in self.factory.clients: c.transport.write(message + '\n') I want server1 to be able to pass messages to server2. Rather, I want server1 to be treated as a client of server2. If server1 receives the message "hi" then I want it to send that same exact message to server2. How can I accomplish this?

  Read the article

• System.Diagnostics.Debugger.Debug() stopped working

  - by Andrew Miner

  I'm working on a program which uses the System.Diagnostics.Debugger.Break() method to allow the user to set a breakpoint from the command-line. This has worked fine for many weeks now. However, when I was working on fixing a unit test today, I tried to use the debug switch from the command-line, and it didn't work. Here's what I've tried: I've confirmed that the Debug() method is really being called (by putting a System.Console.WriteLine() after it) I've confirmed that the build is still in Debug I've done a clean build I've restarted Product Studio A quick Google search didn't reveal anything, and the API documentation for .Net doesn't mention anything about this function not performing correctly. So... any ideas?

  Read the article

• Scanner cuts off my String after about 2400 characters

  - by Ventrue

  I've got some very basic code like while (scan.hasNextLine()) { String temp = scan.nextLine(); System.out.println(temp); } where scan is a Scanner over a file. However, on one particular line, which is about 6k chars long, temp cuts out after something like 2470 characters. There's nothing special about when it cuts out; it's in the middle of the word "Australia." If I delete characters from the line, the place where it cuts out changes; e.g. if I delete characters 0-100 in the file then Scanner will get what was previously 100-2570. I've used Scanner for larger strings before. Any idea what could be going wrong?

  Read the article

• Saving a movie generated with Jython/JES on local disk

  - by Golgauth

  I made an autogenerated movie clip using JES (Jython Environment for Students). I can play it without any problem using playMovie(), but I can't figure out how to have it saved physically on disk. The full script is located here. ... movie = synthesizeFrameAndCreateMovie("D:\\FOLDER") print movie writeQuicktime(movie,"D:\\FOLDER\\movie.mov", 30) [LINE 35] #playMovie(movie) I get this error when calling the function writeQuicktime(): >>> ======= Loading Progam ======= Movie, frames: 60 The error was: Index: 0, Size: 0 I wasn't able to do what you wanted. The error java.lang.IndexOutOfBoundsException has occured Please check line 35 Note : I also tried the function writeAVI(), with the exact same result. This error sounds like a java bug in Jython/JES library. I am running JES under Windows 7 and have all the common Quicktime and AVI codex installed as well as the QTjava library in my jre... Any brilliant idea ? EDIT : Also tried the Linux version with same result for both QuickTime and AVI...

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• how can i create .lib files in VC++ commandline

  - by Vineel Kumar Reddy

  HI how can i create .lib files and .dll files in VC++ (cl.exe) from command line Thanks in advance

  Read the article

• cutting a text file into multiple parts in emacs

  - by Gaurish Telang

  Hi I am using the GNU-Emacs-23 editor. I have this huge text file containing about 10,000 lines which I want to chop into multiple files. Using the mouse to select the required text to paste in another file is the really painful. Also this is prone to errors too. If I want to divide the text file according to the line numbers into say 4 file where first file:lines 1-2500 second file:lines 2500-5000 third file :lines 5000-7500 fourth file: lines: 7500-10000 how do I do this? At the very least, is there any efficient way to copy large regions of the file just by specifying line numbers

  Read the article

• How do I do a join in ActiveRecord after records have been returned?

  - by Russ Bradberry

  I am using ActiveRecord in Rails 3 to pull data from two different tables in two different databases. These databases can not join on each other, but I have the need to do a simple join after-the-fact. I would like to preserve the relation so that I can chain it down the line. here is a simplified version of what I am doing browsers = Browser.all # <-- this is fairly small and can reside in memory events = Event.where(:row_date=>Date.today).select(:name, :browser_id) So as you can see, I want to join browsers in on the events relation, where browser_id should equal browsers.name. events is a relation and I can still add clauses to it down the line, so I dont want to run the query on the db just yet. How would I accomplish this?

  Read the article

• Error with swig: undefined symbol: _ZN7hosters11hostersLink7getLinkEi

  - by Eduardo

  I'm trying to make a python binding for the this library: http://code.google.com/p/hosterslib/. I'm using swig, heres is the code: %module pyhosters %{ include "hosters/hosters.hpp" %} %include "hosters/hosters.hpp" I run "swig -c++ -python -o swig_wrap.cxx swig.i" and I compile with "g++ -O2 -fPIC -shared -o _pyhosters.so swig_wrap.cxx python-config --libs --cflags -lhosters -lcln -lhtmlcxx pkg-config libglog --libs --cflags -I/usr/include/python2.6 -Wall -Wextra" But when I run python and I import it, I get: import pyhosters Traceback (most recent call last): File "", line 1, in File "./pyhosters.py", line 7, in import _pyhosters ImportError: ./_pyhosters.so: undefined symbol: _ZN7hosters11hostersLink7getLinkEi How can I solve that? Thanks.

  Read the article

• Kerning problems when drawing text character by character

  - by shekel

  I'm trying to draw strings character by character to add lighting effects to shapes composed of text. while (i != line.length()) { c = line.substring(i, i + 1); cWidth = g.getFontMetrics().stringWidth(c); g.drawString(c, xx += cWidth, yy); i++; } The problem is, the width of a character isn't the actual distance it's drawn from another character when those two characters are printed as a string. Is there any way to get the correct distance in graphics2d?

  Read the article

• How to skew a Textfield in Actionscript 3.0 ?

  - by algro

  How can I skew a Textfield in order to set a ascending space for each line. Following image should illustrate my intention:

  Read the article

• how to merge file lines having the same first word in python?

  - by user1377135

  I have written a program to merge lines in a file containing the same first word in python. However I am unable to get the desired output. Can anyone please suggest me the mistake in my program? input "file.txt" line1: a b c line2: a b1 c1 line3: d e f line4: i j k line5: i s t line6: i m n ` output a b c a b1 c1 d e f i j k i s t i m n my code a = [line.split() for line in open('file.txt')] L=[] for i in range(0,len(a)): j=i while True: if a[j][0] == a[j+1][0]: L.append(a[j]) L.append(a[j+1]) j=j+2 else: print a[i] print L break

  Read the article

• Having issue with OpenGL 1.0 for HP slate 7

  - by Roy Coder

  I have issue with HP slate when i am trying to draw Line in OpenGL Draw method. But working in other devices. In Hp Slate Green line not drawn properly as like in another device. My Code is: gl.glPushMatrix(); gl.glEnableClientState(GL10.GL_VERTEX_ARRAY); gl.glVertexPointer(2, GL10.GL_FLOAT, 0, vertexFloatBuffer); gl.glColorMask(true, true, true, true); gl.glDepthMask(true); gl.glLineWidth(8.0f); setColor(gl); gl.glDrawArrays(GL10.GL_LINES, 0, fPoints.length / 2); gl.glDisableClientState(GL10.GL_VERTEX_ARRAY); gl.glPopMatrix(); Suggest me at which place i am wrong or missing something? UpdateImage

  Read the article

• update a column in input file by taking value from Database in perl.

  - by Rahul Singh

  input file: 1,a,USA,, 2,b,UK,, 3,c,USA,, i want to update the 4th column in the input file from taking values from one of the table. my code looks like this: my $customer_dbh = DBI-connect("DBI:Oracle:$INST", $USER, $PASS ) or die "Couldn't connect to datbase $INST"; my $cust_smh; print "connected \n "; open FILE , "+$input_file" or die "can't open the input file"; print "echo \n"; while(my $line=) { my @line_a=split(/\,/,$line); my $customer_id=$line_a[3]; print "$customer_id\n"; $cust_smh = $customer_dbh-prepare("SELECT phone_no from book where number = $line_a[0]"); $cust_smh-execute() or die "Couldn't execute stmt, error : $DBI::errstr"; my $number = $cust_smh-fetchrow_array(); $line_a[3]=$number; }

  Read the article

• PHP does not work over ssl connections

  - by Haluk

  Hi, I just got my ssl certificate to work for the first time. For some reason when I connect to my website using https my browser tries to download the php file. I have the following line in my httpd.conf. Isn't this the line which makes sure php files are run using php? AddType application/x-httpd-php .php What else do I need to change so that I can get the php files to work over the https connection. Thanks!

  Read the article

• writing XML with Xerces 3.0.1 and C++ on windows

  - by Jon

  Hi, i have the following function i wrote to create an XML file using Xerces 3.0.1, if i call this function with a filePath of "foo.xml" or "../foo.xml" it works great, but if i pass in "c:/foo.xml" then i get an exception on this line XMLFormatTarget *formatTarget = new LocalFileFormatTarget(targetPath); can someone explain why my code works for relative paths, but not absolute paths please? many thanks. const int ABSOLUTE_PATH_FILENAME_PREFIX_SIZE = 9; void OutputXML(xercesc::DOMDocument* pmyDOMDocument, std::string filePath) { //Return the first registered implementation that has the desired features. In this case, we are after a DOM implementation that has the LS feature... or Load/Save. DOMImplementation *implementation = DOMImplementationRegistry::getDOMImplementation(L"LS"); // Create a DOMLSSerializer which is used to serialize a DOM tree into an XML document. DOMLSSerializer *serializer = ((DOMImplementationLS*)implementation)->createLSSerializer(); // Make the output more human readable by inserting line feeds. if (serializer->getDomConfig()->canSetParameter(XMLUni::fgDOMWRTFormatPrettyPrint, true)) serializer->getDomConfig()->setParameter(XMLUni::fgDOMWRTFormatPrettyPrint, true); // The end-of-line sequence of characters to be used in the XML being written out. serializer->setNewLine(XMLString::transcode("\r\n")); // Convert the path into Xerces compatible XMLCh*. XMLCh *tempFilePath = XMLString::transcode(filePath.c_str()); // Calculate the length of the string. const int pathLen = XMLString::stringLen(tempFilePath); // Allocate memory for a Xerces string sufficent to hold the path. XMLCh *targetPath = (XMLCh*)XMLPlatformUtils::fgMemoryManager->allocate((pathLen + ABSOLUTE_PATH_FILENAME_PREFIX_SIZE) * sizeof(XMLCh)); // Fixes a platform dependent absolute path filename to standard URI form. XMLString::fixURI(tempFilePath, targetPath); // Specify the target for the XML output. XMLFormatTarget *formatTarget = new LocalFileFormatTarget(targetPath); //XMLFormatTarget *myFormTarget = new StdOutFormatTarget(); // Create a new empty output destination object. DOMLSOutput *output = ((DOMImplementationLS*)implementation)->createLSOutput(); // Set the stream to our target. output->setByteStream(formatTarget); // Write the serialized output to the destination. serializer->write(pmyDOMDocument, output); // Cleanup. serializer->release(); XMLString::release(&tempFilePath); delete formatTarget; output->release(); }

  Read the article

• What Kind of Knowledge is Necessary For a Permon Who Does Not Have IT Background? [closed]

  - by skyflyer

  One of my colleagues joined our company, which by the way is a internet company, months ago as an on-line marketing specialist. He majored English in his college and has never deeply touched IT before. He says that to be a good on-line marketing specialist he needs to lean some basic IT skills in order to deliver superb work. According to him, things like Search Engine Optimization, monitoring competitors' web sites, design some functionality on web site and so on require IT entree-level knowledge. And he asks me what kind knowledge is helpful for him to do his job. I am stunted by his question. It is easy enough to answer, things like HTML, CSS, even Photo-shop are required in some job descriptions. Also, I believe some basic understanding of dynamic web site, static web site is helpful to him. On the other hand, as a techie I still feel my answer is awkward. What is your opinion on this? Always lot of thanks to you guys on SO.

  Read the article

< Previous Page | 389 390 391 392 393 394 395 396 397 398 399 400  | Next Page >