Search Results

Search found 29682 results on 1188 pages for 'josh line'.

Page 395/1188 | < Previous Page | 391 392 393 394 395 396 397 398 399 400 401 402 | Next Page >

"_FILE_AND_LINE_ is not defined in this scope" (compiling RakNet NAT examples in OS X)

- by Michael F

Hello! I'm working on a RakNet-based project (using 3.8 on OS X 10.6), and I'm trying to work through the various examples that demonstrate the parts of RakNet I want to use. For the "NatCompleteClient" example, I've imported the source into a command-line project in XCode, along with the UPNP dependency. At compile time I've had a few errors in the UPNP section, though, and I can't find any guidance on this. In UPNPPortForwarder.mm, there are 7 lines that use _FILE_AND_LINE_, and the compiler is not happy; for example on line 232: foundInterfaces.Deallocate(r1,_FILE_AND_LINE_); causes: UPNPPortForwarder.mm:232: error: '_FILE_AND_LINE_' was not declared in this scope Can anyone tell me what this is all about? That variable doesn't seem to get talked about very often... or Google doesn't like to find it.

Read the article
Efficient file buffering & scanning methods for large files in python

- by eblume

The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

Read the article
Finding rank of the student -Sql Compact

- by Jankhana

I have a table like this : Name Mar1 Mar2 Mar3 Total xxx 80 80 80 240 yyy 60 70 50 180 aaa 85 65 75 225 I wanted to find the rank of the student based on total. I using SQL Compact 3.5 . As we have rank() function in sql server do we have something with which we can find the students rank??? When I used "select Total,rank() over (order by total desc) i1 from stmarks " it's giving error as " Major Error 0x80040E14, Minor Error 25501 select Total,rank() over (order by total desc) i1 from stmarks There was an error parsing the query. [ Token line number = 1,Token line offset = 21,Token in error = over ] " Do Sql Compact support rank() over or is there any another way???

Read the article
Template class implicit copy constructor issues

- by Nate

Stepping through my program in gdb, line 108 returns right back to the calling function, and doesn't call the copy constructor in class A, like (I thought) it should: template <class S> class A{ //etc... A( const A & old ){ //do stuff... } //etc... }; template <class T> class B{ //etc... A<T> ReturnsAnA(){ A<T> result; // do some stuff with result return result; //line 108 } //etc... }; Any hints? I've banged my head against the wall about this for 4 hours now, and can't seem to come up with what's happening here.

Read the article
Eclipse: Double semi-colon on an import

- by smp7d

Using Eclipse, if I have an extra semicolon on an import line (not the last import line), I see a syntax error in the IDE. However, this compiles fine outside of the IDE (Maven in this case). Example: import java.util.ArrayList;; //notice extra semicolon import java.util.List; Does anyone else see this behavior? Why is this showing as a syntax error? I am working with someone who keeps pushing these this to source control and it is irritating me (they clearly aren't using Eclipse). Full disclosure... I am using SpringSource Tool Suite 2.8.0.

Read the article
Document.oncontextmenu, component is not available (firefox)

- by Tom J Nowell

I have a script for a website, and one of the things ti does right at the end if attempt to disable an anti-right click protection in a website if($("span[class=MembersNameDisplay]").exists()){ var list_row = document.getElementsByTagName('script'); if(list_row != null){ list_row[0].parentNode.removeChild(list_row[0]); } } document.oncontextmenu=new Function("return true"); In google chrome this works, however in firefox with greasemonkey, the last line fails and the protection is not removed. Error: Component is not available Line: 171 How do I fix this, and why does it fail under firefox?

Read the article
my .jar file won't do anything.

- by David

I created a program that more or less holds an array of strings as an object and randomly prints one. so basicaly class Happy { string[] namestrings = new string[#] constructor() { fill with some strings} public static void main (String[]arg) { create instance of class do some junk with it method that prints it } method that prints it {} another method } when i compile and run it on the command line it works fine but when on the comand line i type in jar -cf Happy.jar Fun.class i get a .jar file called Happy and when i click on it i get an error message that reads "the java Jar file happy could not be launched read the consol for possible error messages" I have a mac i'm running lepord if that makes a diference. Whats going on?

Read the article
What is this for an IP in my google app engine log file?

- by Christian Harms

I get many normal log lines in my google app engine application. But today I go these instead the 4-part number: 2a01:e35:2f20:f770:6c54:3ee8:67fb:df8 What is this for an format? ipv6 are 6 numbers, mac address too... Normal logfile line: 187.14.44.208 - - [19/Mar/2010:14:31:35 -0700] "GET /geo_data.js HTTP/1.1" 200 776 "http://www.xxx.com.br/spl19/index.php?refid=gv_av_ri" "Mozilla/5.0 (Windows; U; Windows NT 5.1; pt-BR; rv:1.9.2) Gecko/20100115 Firefox/3.6 (.NET CLR 3.5.30729),gzip(gfe)" This special logfile line: 2a01:e35:2f20:f770:6c54:3ee8:67fb:df8 - - [18/Mar/2010:17:00:37 -0700] "GET /geo_data.js HTTP/1.1" 500 450 "http://www.xxx.com.br/spl19/index.php?refid=cm_av_ri" "Mozilla/5.0 (Windows; U; Windows NT 6.1; pt-PT; rv:1.9.2) Gecko/20100115 Firefox/3.6,gzip(gfe)"

Read the article
In python writing from XML to CSV, encoding error

- by user574435

Hi, I am trying to convert an XML file to CSV, but the encoding of the XML ("ISO-8859-1") apparently contains characters that are not in the ascii codec which Python uses to write rows. I get the error: Traceback (most recent call last): File "convert_folder_to_csv_PLAYER.py", line 139, in <module> xml2csv_PLAYER(filename) File "convert_folder_to_csv_PLAYER.py", line 121, in xml2csv_PLAYER fout.writerow(row) UnicodeEncodeError: 'ascii' codec can't encode character u'\xe1' in position 4: ordinal not in range(128) I have tried opening the file as follows: dom1 = parse(input_filename.encode( "utf-8" ) ) and I have tried replacing the \xe1 character in each row before it is written. Any suggestions?

Read the article
Can I use the browser's word-wrapping from JavaScript?

- by Max

I have some text in a div. It can be any Unicode text under the sun, including Chinese, Japanese, and Korean. Now, I need to take this text and word-wrap it in JavaScript in some efficient but correct manner. (Because I need to make each line start with "" in a textarea.) Browsers have an implementation of the Unicode Word Wrap algorithm, as is evidenced by word-wrapping Unicode text in a with CSS. (At least, Firefox has such an algorithm, and I suspect other browsers do as well.) What I need is some way for JavaScript to use the same word-wrapping algorithm, so that I can properly wrap and then "quote" Unicode text. Is there any way for JavaScript to use the browser's word-wrapping algorithm, or to know where text has been line-broken in a div or any other element?

Read the article
jQuery each function, getting the data out of it

- by Ankur

I am trying to use the jQuery each function (line 5) to display the results of an AJAX call. when I write resultObj.value on line 6 how come I am not getting any data? Am I making a syntax error (I am pretty sure that I must be)? success : function(resultObj) { count = count+1; $(".objHolder").filter("#"+id).append("<table border='1' cellspacing='4' cellpadding='4' class='preTable' id='"+id+"' level='"+count+"'><tr><td class='preItem' id='"+id+"' level='"+count+"'><img src='images/right.jpg' width='16' height='10' /></td><td class='preList'> </td><td class='preHolder' level='"+count+"'> </td></tr></table>"); isClicked[level]="yes"; $.each(resultObj, function(index, value){ $(".preHolder").filter("#"+id).append(resultObj.value); }); } });

Read the article
urllib alternative for iPhone

- by Pr301

hi, I am trying to create an iPhone application which in some point connects to the internet, fills an on-line form, fetches the resulting website, parses it and returns a string to the user. I want all this process to happen in the background. I know how to do this kind of things with python and urllib but in objc I can't find an alternative, from on-line search I found either sites that explain how to use webkit to retrieve webpages (I suppose this is for displaying them to the user) or how to parse an existing HTML file or string. Since I want the file to be retrieved from the internet and the whole process should be running in the background, neither of these solutions covers my needs.

Read the article
Newline character in stringbuilder - C#

- by nettguy

How do you append new line(\n\r) character in StringBuilder?

Read the article
UIViewController is popped from view stack and NSURLConnection crashes the application

- by rickharrison

I am pushing a UIViewController onto a UINavigationController. This view controller immediately starts a download of an xml feed and then parses it. However, if you hit the back button before it is done downloading, and crashes with EXC_BAD_ACCESS. The line that is crashing it is in parserDidEndDocument and is this line: if (self.delegate && [self.delegate conformsToProtocol:@protocol(ModelDelegate)]) [self.delegate modelDidFinishParsing:self]; I assume it is crashing because it is trying to access self.delegate which is not assigned anymore. How do I get around this? Also, I would release the model object in the modelDidFinishParsing method. How would I release this model if it never reaches this method.

Read the article
Running OpenMPI on Windows XP

- by iamweird

Hi there. I'm trying to build a simple cluster based on Windows XP. I compiled OpenMPI-1.4.2 successfully, and tools like mpicc and ompi_info work too, but I can't get my mpirun working properly. The only output I can see is Z:\orterun --hostfile z:\hosts.txt -np 2 hostname [host0:04728] Failed to initialize COM library. Error code = -2147417850 [host0:04728] [[8946,0],0] ORTE_ERROR_LOG: Error in file ..\..\openmpi-1.4.2 \orte\mca\ess\hnp\ess_hnp_module.c at line 218 -------------------------------------------------------------------------- It looks like orte_init failed for some reason; your parallel process is likely to abort. There are many reasons that a parallel process can fail during orte_init; some of which are due to configuration or environment problems. This failure appears to be an internal failure; here's some additional information (which may only be relevant to an Open MPI developer): orte_plm_init failed -- Returned value Error (-1) instead of ORTE_SUCCESS -------------------------------------------------------------------------- [host0:04728] [[8946,0],0] ORTE_ERROR_LOG: Error in file ..\..\openmpi-1.4.2 \orte\runtime\orte_init.c at line 132 -------------------------------------------------------------------------- It looks like orte_init failed for some reason; your parallel process is likely to abort. There are many reasons that a parallel process can fail during orte_init; some of which are due to configuration or environment problems. This failure appears to be an internal failure; here's some additional information (which may only be relevant to an Open MPI developer): orte_ess_set_name failed -- Returned value Error (-1) instead of ORTE_SUCCESS -------------------------------------------------------------------------- [host0:04728] [[8946,0],0] ORTE_ERROR_LOG: Error in file ..\..\..\..\openmpi -1.4.2\orte\tools\orterun\orterun.c at line 543 Where z:\hosts.txt appears as follows: host0 host1 Z: is a shared network drive available to both host0 and host1. What my problem is and how do I fix it? Upd: Ok, this problem seems to be fixed. It seems to me that WideCap driver and/or software components causes this error to appear. A "clean" machine runs local task successfully. Anyway, I still cannot run a task within at least 2 machines, I'm getting following message: Z:\mpirun --hostfile z:\hosts.txt -np 2 hostname connecting to host1 username:cluster password:******** Save Credential?(Y/N) y [host0:04728] This feature hasn't been implemented yet. [host0:04728] Could not connect to namespace cimv2 on node host1. Error code =-2147024891 -------------------------------------------------------------------------- mpirun was unable to start the specified application as it encountered an error. More information may be available above. -------------------------------------------------------------------------- I googled a little and did all the things as described here: http://www.open-mpi.org/community/lists/users/2010/03/12355.php but I'm still getting the same error. Can anyone help me? Upd2: Error code -2147024891 might be WMI error WBEM_E_INVALID_PARAMETER (0x80041008) which occures when one of the parameters passed to the WMI call is not correct. Does this mean that the problem is in OpenMPI source code itself? Or maybe it's because of wrong/outdated wincred.h and credui.lib I used while building OpenMPI from the source code?

Read the article
HASHREF in Perl

- by Uri

I'm trying to decrypt a Perl code which I'm not familiar with, somehow related to HashRef. I'm using Amazon::S3, but my question is a general Perl question. See the code below: use Amazon::S3; my $s3 = Amazon::S3-new( ... ); my $response = $s3-buckets; Documentation (here) sais, about s3-buckets: Returns undef on error, else HASHREF of results The following line is working for me, but I don't understand why: for $b in ( @ { $response-{buckets} } ) { print "bucket: " . $b-bucket . "\n"; } I'm buzzled by each operator on the first line. What type exactly are $response, $respone-{bucket}. Looks like the expression within the 'for' is an array, but I don't understand this syntax: @{ ... }?

Read the article
How to read tags out of m4a files in .NET?

- by dkackman

I've got some heavily modified code that ultimately came from the Windows Media SDK that works great for reading tags out of MP3 and WMV files. Somewhere along the line, Windows Media Player added support for .m4a files (was it in Windows 7?) but the Windows Media API doesn't seem to reflect that addition (or at least IWMMetadataEditor2::OpenEx pukes on an .m4a file). What would be some good C# code or links on how to dig meta data tags out of m4a files? (Google has come up dry on the C# front.) UPDATE AtomicParsley did indeed end being the best approach. Since that code is a command line tool however I ended up having to create a managed wrapper around some of its functionality in order to use in-process. It is posted on google code if anyone else needs such a thing.

Read the article
Regular expressions in python unicode

- by Remy

I need to remove all the html tags from a given webpage data. I tried this using regular expressions: import urllib2 import re page = urllib2.urlopen("http://www.frugalrules.com") from bs4 import BeautifulSoup, NavigableString, Comment soup = BeautifulSoup(page) link = soup.find('link', type='application/rss+xml') print link['href'] rss = urllib2.urlopen(link['href']).read() souprss = BeautifulSoup(rss) description_tag = souprss.find_all('description') content_tag = souprss.find_all('content:encoded') print re.sub('<[^>]*>', '', content_tag) But the syntax of the re.sub is: re.sub(pattern, repl, string, count=0) So, I modified the code as (instead of the print statement above): for row in content_tag: print re.sub(ur"<[^>]*>",'',row,re.UNICODE But it gives the following error: Traceback (most recent call last): File "C:\beautifulsoup4-4.3.2\collocation.py", line 20, in <module> print re.sub(ur"<[^>]*>",'',row,re.UNICODE) File "C:\Python27\lib\re.py", line 151, in sub return _compile(pattern, flags).sub(repl, string, count) TypeError: expected string or buffer What am I doing wrong?

Read the article
ASP.NET Treeview Control not expanding on click

- by Scott Vercuski

I having an issue with the ASP.NET Treeview control. I create the treeview just fine but the nodes will not expand or collapse. I see there is a javascript error but it is for line 1 character 0 of the webpage, there is nothing at line 1 character 0. I am using the ASP:Treeview control in conjunction with the Telerik controls, but I'm not sure if that is an issue. I saw there was a similar question here but the answer is not pertinent to my site. Has anyone run into this issue before? I've tried searching Google and tried a number of proposed solutions but so far none have worked. Thank you,

Read the article
update table in gtk

- by ali

I have window that contains a table on screen, now I want to attach a widget to that table I use gtk_table_attach(GTK_TABLE(table), label, ...) the function is correct and it runs without any error but table does not respond to that line I mean there is no change on my table, I think I need something to tell that table update it self but how? note= that line is inside a callback of a signal and I am sure that signal runs note2= I do not want to destroy window for that note3= I use gtk+ and pygtk note4= I am sure I attach that widget to a correct position ( it is free)

Read the article
Netbeans PHP require_once() problem

- by mawg

I'm stumped! In PHP in Netbeans (6.8), a project has two files, file1.php and file2.php file1.php starts require_once('file2.php'); and I get Warning: require_once(query_form.php): failed to open stream: No such file or directory in C:\xampp\htdocs\my_project\file1.php on line 3 Call Stack: 0.0741 322920 1. {main}() C:\xampp\htdocs\my_project\file1.php:0 Fatal error: require_once(): Failed opening required 'file2.php' (include_path='.;\xampp\php\PEAR') in C:\xampp\htdocs\my_project\file1.php on line 3 Call Stack: 0.0741 322920 1. {main}() C:\xampp\htdocs\my_project\file1.php:0 I tried require_once('./file2.php'); and require_once('.\file2.php'); since it is windows. I even added C:\xampp\htdocs\my_project\ to the projects include path and it shows up as such on the prject view and see file1.php and file2.php It doesn't show up on this error report, but possibly because Netbeans (or PHP ]) knows that C:\xampp\htdocs\my_project\ === . Any suggestions? Btw, I am new to Netbeans, so it i sprobably something very obvious.

Read the article
how to show the right word in my code, my code is : os.urandom(64)

- by zjm1126

My code is: print os.urandom(64) which outputs: > "D:\Python25\pythonw.exe" "D:\zjm_code\a.py" \xd0\xc8=<\xdbD' \xdf\xf0\xb3>\xfc\xf2\x99\x93 =S\xb2\xcd'\xdbD\x8d\xd0\\xbc{&YkD[\xdd\x8b\xbd\x82\x9e\xad\xd5\x90\x90\xdcD9\xbf9.\xeb\x9b>\xef#n\x84 which isn't readable, so I tried this: print os.urandom(64).decode("utf-8") but then I get: > "D:\Python25\pythonw.exe" "D:\zjm_code\a.py" Traceback (most recent call last): File "D:\zjm_code\a.py", line 17, in <module> print os.urandom(64).decode("utf-8") File "D:\Python25\lib\encodings\utf_8.py", line 16, in decode return codecs.utf_8_decode(input, errors, True) UnicodeDecodeError: 'utf8' codec can't decode bytes in position 0-3: invalid data What should I do to get human-readable output?

Read the article
Good open source analytics/stats software in PHP?

- by makeee

The url shortening service I'm building needs to display some basic click stats to users: # of clicks, conversions, referring domains, and country (filterable by a date range). I'll possibly want more advanced stats in the future. Is there existing open source software that will allow me to pass events to it and then easily display a bar or line graph of that event (for example, a line graph of "conversions" between two specified dates). It seems like something like this should exist and would be much easier then building the whole thing from scratch. I know there are graphing scripts, but that still requires me to format the data (usually as an xml file) and then pass it to the graph. I'm looking for something a bit more complete, which I can just feed the events and then it does everything else.

Read the article
PHP rewrite giving 404, .htaccess problem?

- by Hamid

I have the following .htaccess: #Options +FollowSymLinks RewriteEngine on RewriteBase /phptest on my local testing server (http://localhost) I have to uncomment the first line for the site to work. Otherwise I get Error 403 (Forbidden). Once I upload the page to my webserver (FastHosts) I get Error 500 (Internal Server Error) if the first line is not commented out. If I comment it out, my page loads but it cannot find the page content which is mydomain.com/phptest/Home I get a 404. Any suggestions on what the problem might be?

Read the article
how to manage formating of text when read a save file?

- by moon

hello i have a java applet application in which i use rich text area . i write URDU the national language of PAKISTAN. i managed to do so with uni codes. the problem is, when i write urdu in text area and select a font and color for each line it do all of this but when i save this file using UTF-8 encoding and then open it again it shows all text formatted as i choose format of last line. my requirement is to open file as it is saved. i mean each file should have same formatting as i done before saving.

Read the article

< Previous Page | 391 392 393 394 395 396 397 398 399 400 401 402 | Next Page >