Search Results

Search found 11042 results on 442 pages for 'side'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 410/442 | < Previous Page | 406 407 408 409 410 411 412 413 414 415 416 417  | Next Page >

  • Safari Frames Invisible Scrollbar

    - by mobiuschic42
    I'm working on a website that uses not just frames, but frames within frames (ew, I know, but I don't get to choose). It actually works OK most of the time, but I'm running into a problem with some of the frames within frames in Safari (only). Some of the two-deep frames render in Safari with a small space on the right-hand side of the frame - I think it's just the ones with scroll set to "no", but fiddling with the scroll settings hasn't fixed it yet. It basically looks like there should be a scroll bar there, but there isn't. I've been working on this awhile and tried a lot of things: changing the heights of the rows, changing the scroll settings, adding a colls='100%' tag, changing the heights of the contents of the frames, as well as checking to make sure widths are set to 100% throughout. Nothing's fixed it so far. Does any one know what's happening here? Here's the basic gist of the code and some screenshots - please forgive the lack of proper quotes; it still renders and fixing them all in this codebase would be a losing battle: <html> <frameset id=fset frameborder=0 border=0 framespacing=0 onbeforeunload="onAppClosing()" onload="onAppInit()" rows="125px,*,0"> <frame src="navFrame.html" name=ControlPanel marginwidth=0 marginheight=0 frameborder=0 scrolling=no noresize> <frame src="contentFrame.html" name=C marginwidth=0 marginheight=0 frameborder=0 scrolling=no> <frame src="invisiFrame.html" name=PING marginwidth=0 marginheight=0 frameborder=0 noresize> <noframes><body>Tough luck.</center></body></noframes> </frameset></html> Inside that second frame (named "C" and with src of "contentFrame") is this: <HTML> <HEAD><META HTTP-EQUIV="Content-Type" CONTENT="text/html; charset=utf-8"></head> <frameset rows="48px,*,28px" border=0 frameborder=0 framespacing=0> <frame src="pageTitle.html" name=Title marginwidth=0 marginheight=0 noresize scrolling=no frameborder=0> <frame src="content.html" name=ScreenBody marginwidth=0 marginheight=0 frameborder=0> <frame src="submitBar.html" name=ContextPanel marginwidth=0 marginheight=0 frameborder=0 scrolling=no noresize> </FRAMESET> </HTML> The frames that are troublesome are the first frame (named "Title" with src of "pageTitle.html") and the last frame (named "ContextPanel" with src of "submitBar.html") both have their widths set to 100% and heights are either 100%, not set, or a value less than or equal to their row height. Here is an image of the problem:

    Read the article

  • Why does my entire page reload in Chrome and Firefox when using asynchronous UpdatePanel postbacks?

    - by Alex
    Being a bit perplexed about this issue by now, I hope some of you gurus can shed some light on my problem... I've developed a AJAX-enhanced website, which has been running fine in IE, Chrome and Firefox for a year or so. I use a Timer-control to check for incoming messages every 30 seconds, and this updates an UpdatePanel showing potential new messages. Now several one of my Firefox users complain about the page refreshing every 30 seconds! I my self cannot reproduce this behaviour, but given the "30 seconds"-description, I cursed my Timer-solution as the culprit. But now, I'm experiencing this error myself, not in Firefox though, but in Google Chrome! (And only on one of my two computers!) Every 30 seconds the page reloads! But I found that it's not only related to the Timer, because all other asynchronous postbacks to the server within UpdatePanels reloads the entire page as well. This error has never been experienced in Internet Explorer (to my knowledge). As I said, this it not only related to the Timer postback, but if it's of interest to anybody the code is like this: <asp:Timer runat="server" ID="MailCheckTimer" Interval="30000" OnTick="MailChecker_Tick"></asp:Timer> <asp:UpdatePanel runat="server" ID="MailCheckerUpdatePanel" UpdateMode="Conditional"> <ContentTemplate> <div class="newmail_box" runat="server" id="newmail_box"> <!-- Content stripped for this example --> </div> </ContentTemplate> <Triggers> <asp:AsyncPostBackTrigger ControlID="MailCheckTimer" /> </Triggers> </asp:UpdatePanel> In other places of the website I call the client side __doPostBack function directly from JavaScript in relation to an UpdatePanel. Normal behaviour for this call is to updated the referenced UpdatePanel with some content, but now in Chrome this refreshes the entire page! (but again not consistently, and never in IE) Even the most fundamental UpdatePanel operations like refreshing the content after a button (inside the panel) is clicked, forces the page to reload completely: <asp:Button ID="btnSearch" runat="server" Text="Search" OnClick="btnSearch_Click"></asp:Button> And just to torment me further, I only experience this on my public website, and not in my local development environment, making it a tedious affair for me to find the actual cause! :( Any ideas on why this happens? Why so inconsistently? Has it to do with my UpdatePanel-design? Or does some security setting in Firefox/Chrome that prevent some asynchronous UpdatePanel callbacks? Any help or idea is highly appreciated!

    Read the article

  • Stretch panel with splitter

    - by user1153896
    I want to implement a basic WPF layout with three panels and two splitters (Horizontal and Vertical splitter). Two panels on the left and on the bottom has to be callapsable and one panel has to stretch accordingly. Here is a simple XAML: <Grid> <Grid.ColumnDefinitions> <ColumnDefinition Width="*"/> <ColumnDefinition Width="5"/> <ColumnDefinition Width="*"/> </Grid.ColumnDefinitions> <StackPanel Background="Aqua" Grid.Column="0" Name="leftPanel" > <TextBlock FontSize="35" Foreground="#58290A" TextWrapping="Wrap">Left Hand Side</TextBlock> </StackPanel> <GridSplitter Grid.Column="1" HorizontalAlignment="Stretch"/> <Grid Grid.Column="2" HorizontalAlignment="Stretch" VerticalAlignment="Stretch"> <Grid.RowDefinitions> <RowDefinition Height="*" /> <RowDefinition Height="5" /> <RowDefinition Height="*" /> </Grid.RowDefinitions> <StackPanel HorizontalAlignment="Stretch" VerticalAlignment="Stretch"> <Label Content="... Clien Area .. Has to Stretch vertically and horizontally" Margin="10"></Label> <Button Click="LeftButton_Click" Margin="10">Close Left Panel</Button> <Button Click="BottomButton_Click" Margin="10">Close Bottom Panel</Button> </StackPanel> <GridSplitter Grid.Row="1" Background="Gray" HorizontalAlignment="Stretch"/> <ListBox Grid.Row="2" Background="Violet" Name="bottomPanel"> <ListBoxItem>Hello</ListBoxItem> <ListBoxItem>World</ListBoxItem> </ListBox> </Grid> </Grid> and codebehind: private void LeftButton_Click(object sender, RoutedEventArgs e) { leftPanel.Visibility = (leftPanel.Visibility == System.Windows.Visibility.Visible)? System.Windows.Visibility.Collapsed : System.Windows.Visibility.Visible; } private void BottomButton_Click(object sender, RoutedEventArgs e) { bottomPanel.Visibility = (bottomPanel.Visibility == System.Windows.Visibility.Visible) ? System.Windows.Visibility.Collapsed : System.Windows.Visibility.Visible; } This code doesn't work as expected :(. Any WPF experts around? to suggest a solution for having Client Area (stretched) and splitter at the same time? DockPanel will work perfectly, but I need splitter! Thanks.

    Read the article

  • iPhone RSS thumbnail

    I have a simple RSS reader. Stories are downloaded, put into a UITableView, and when you click it, each story loads in a UIWebView. It works great. Now though, I'd like to incorporate an image on the left side (like you'd see in the YouTube app). However, since my app pulls from an RSS feed, I can't simply specify image X to appear in row X because row X will be row Y tomorrow, and things will get out of order, you know? I am currently pulling from a YouTube RSS feed, and can get the video title, description, publication date, but I'm stuck as to how to pull the little thumbnail besides each entry in the feed. As you can probably tell, I'm a coding newbie (this being my first application other than a Hello World app) and I'm getting so frustrated by my own lack of knowledge. Thanks! BTW, here's some sample code: - (void)parser:(NSXMLParser *)parser didStartElement:(NSString *)elementName namespaceURI:(NSString *)namespaceURI qualifiedName:(NSString *)qName attributes:(NSDictionary *)attributeDict{ //NSLog(@"found this element: %@", elementName); if (currentElement) { [currentElement release]; currentElement = nil; } currentElement = [elementName copy]; if ([elementName isEqualToString:@"item"]) { // clear out our story item caches... item = [[NSMutableDictionary alloc] init]; currentTitle = [[NSMutableString alloc] init]; currentDate = [[NSMutableString alloc] init]; currentSummary = [[NSMutableString alloc] init]; currentLink = [[NSMutableString alloc] init]; } } - (void)parser:(NSXMLParser *)parser didEndElement:(NSString *)elementName namespaceURI:(NSString *)namespaceURI qualifiedName:(NSString *)qName{ //NSLog(@"ended element: %@", elementName); if ([elementName isEqualToString:@"item"]) { // save values to an item, then store that item into the array... [item setObject:currentTitle forKey:@"title"]; [item setObject:currentLink forKey:@"link"]; [item setObject:currentSummary forKey:@"summary"]; [item setObject:currentDate forKey:@"date"]; [stories addObject:[item copy]]; NSLog(@"adding story: %@", currentTitle); } } - (void)parser:(NSXMLParser *)parser foundCharacters:(NSString *)string{ //NSLog(@"found characters: %@", string); // save the characters for the current item... if ([currentElement isEqualToString:@"title"]) { [currentTitle appendString:string]; } else if ([currentElement isEqualToString:@"link"]) { [currentLink appendString:string]; } else if ([currentElement isEqualToString:@"description"]) { [currentSummary appendString:string]; } else if ([currentElement isEqualToString:@"pubDate"]) { [currentDate appendString:string]; } }

    Read the article

  • What's wrong with this code? Values not saved to db

    - by Scott B
    Been trying to get this code to work for several days now to no avail. I'm at wits end. I've managed, with the code below, to create a customized category picker widget that appears on the PAGE editor. However, for the life of me, I cannot get the checked categories to save. function my_post_options_box() { if ( function_exists('add_meta_box') ) { //add_meta_box( $id, $title, $callback, $page, $context, $priority ); add_meta_box('categorydiv', __('Page Options'), 'post_categories_meta_box_modified', 'page', 'side', 'core'); } } //adds the custom categories box function post_categories_meta_box_modified($post) { $noindexCat = get_cat_ID('noindex'); $nofollowCat = get_cat_ID('nofollow'); if(in_category("noindex")){ $noindexChecked = " checked='checked'";} else {$noindexChecked = "";} if(in_category("nofollow")){ $nofollowChecked = " checked='checked'";} else {$noindexChecked = "";} ?> <div id="categories-all" class="ui-tabs-panel"> <ul id="categorychecklist" class="list:category categorychecklist form-no-clear"> <li id='category-<?php echo $noindexCat ?>' class="popular-category"><label class="selectit"><input value="<?php echo $noindexCat ?>" type="checkbox" name="post_category[]" id="in-category-<?php echo $noindexCat ?>"<?php echo $noindexChecked ?> /> noindex</label></li> <li id='category-<?php echo $nofollowCat ?>' class="popular-category"><label class="selectit"><input value="<?php echo $noindexCat ?>" type="checkbox" name="post_category[]" id="in-category-<?php echo $nofollowCat ?>"<?php echo $nofollowChecked ?> /> nofollow</label></li> <li id='category-1' class="popular-category"><label class="selectit"><input value="1" type="checkbox" name="post_category[]" id="in-category-1" checked="checked"/> Uncategorized</label></li> </ul> </div> <?php }

    Read the article

  • Monitoring UDP socket in glib(mm) eats up CPU time

    - by Gyorgy Szekely
    Hi, I have a GTKmm Windows application (built with MinGW) that receives UDP packets (no sending). The socket is native winsock and I use glibmm IOChannel to connect it to the application main loop. The socket is read with recvfrom. My problem is: this setup eats 25% percent CPU time on a 3GHz workstation. Can somebody tell me why? The application is idle in this case, and if I remove the UDP code, CPU usage drops down to almost zero. As the application has to perform some CPU intensive tasks, I could image better ways to spend that 25% Here are some code excerpts: (sorry for the printf's ;) ) /* bind */ void UDPInterface::bindToPort(unsigned short port) { struct sockaddr_in target; WSADATA wsaData; target.sin_family = AF_INET; target.sin_port = htons(port); target.sin_addr.s_addr = 0; if ( WSAStartup ( 0x0202, &wsaData ) ) { printf("WSAStartup failed!\n"); exit(0); // :) WSACleanup(); } sock = socket( AF_INET, SOCK_DGRAM, 0 ); if (sock == INVALID_SOCKET) { printf("invalid socket!\n"); exit(0); } if (bind(sock,(struct sockaddr*) &target, sizeof(struct sockaddr_in) ) == SOCKET_ERROR) { printf("failed to bind to port!\n"); exit(0); } printf("[UDPInterface::bindToPort] listening on port %i\n", port); } /* read */ bool UDPInterface::UDPEvent(Glib::IOCondition io_condition) { recvfrom(sock, (char*)buf, BUF_SIZE*4, 0, NULL, NULL); /* process packet... */ } /* glibmm connect */ Glib::RefPtr channel = Glib::IOChannel::create_from_win32_socket(udp.sock); Glib::signal_io().connect( sigc::mem_fun(udp, &UDPInterface::UDPEvent), channel, Glib::IO_IN ); I've read here in some other question, and also in glib docs (g_io_channel_win32_new_socket()) that the socket is put into nonblocking mode, and it's "a side-effect of the implementation and unavoidable". Does this explain the CPU effect, it's not clear to me? Whether or not I use glib to access the socket or call recvfrom() directly doesn't seem to make much difference, since CPU is used up before any packet arrives and the read handler gets invoked. Also glibmm docs state that it's ok to call recvfrom() even if the socket is polled (Glib::IOChannel::create_from_win32_socket()) I've tried compiling the program with -pg and created a per function cpu usage report with gprof. This wasn't usefull because the time is not spent in my program, but in some external glib/glibmm dll.

    Read the article

  • Cannot export a fusionchart with 'Embedding Charts Using <OBJECT>/<EMBED> Tags'

    - by zoom_pat277
    I am trying to export a fusion chart created using 'Embedding Charts Using / Tags'. Export works just perfect with the right click (on the chart) and chose a pdf to export. But I am not able to make this work via javascript. I have a button outside the chart which upon clicking calls the function below function myexport() { var object = getChartFromId('myChartid'); if( object.hasRendered() ) object.exportChart({exportFormat: 'PDF'}); } the object above returned is null and this fails on the next line here is the full prototype <html> <head> <title>My Chart</title> <script type="text/javascript" src="fusionCharts.debug.js"></script> <script type="text/javascript" src="fusionChartsExportComponent.js"></script> <script type="text/javascript"> function ExportMyChart() { var cObject = getChartFromId('Column3D'); if( cObject.hasRendered() ) cObject.exportChart({exportFormat: 'PDF'}); } </script> </head> <body> <object width="400" height="400" id="Column3D" classid="clsid:d27cdb6e-ae6d-11cf-96b8-444553540000" codebase="http://fpdownload.macromedia.com/pub/shockwave/cabs/flash/swflash.cab#version=8,0,0,0" > <param name="testname" value="Column3D.swf" /> <param name="FlashVars" value="&dataURL=testData.xml&chartWidth=400&chartHeight=300&DOMId=myChart1&registerWithJS=1&debugMode=0"> <param name="quality" value="high" /> <embed src="Column3D.swf" flashVars="&dataURL=testData.xml&chartWidth=400&chartHeight=300&DOMId=myChart1&registerWithJS=1&debugMode=0" width="400" height="300" name="Column3D" quality="high" type="application/x-shockwave-flash" pluginspage="http://www.macromedia.com/go/getflashplayer" /> </object> <!-- We also create a DIV to contain the FusionCharts client-side exporter component --> <div id="holderDiv" align="center">FusionCharts Export Handler Component</div> <script type="text/javascript"> var myExportComponent = new FusionChartsExportObject("testExporter1", "FCExporter.swf"); //Render the exporter SWF in our DIV fcexpDiv myExportComponent.Render("holderDiv"); </script> <input type="button" value="Export My Chart" onclick="ExportMyChart()" />

    Read the article

  • Navigation bar(s) disappear when the window gets too small

    - by Leron
    The title maybe is a little misleading but I'm not 100% sure how this effect is called. I'm pretty sure what I meant is that my navigation bar is disappearing instead of collapsing. However my set up is this - I am working on the Layout view of ASP.NET MVC 4 project. I'm using bootstrap 3x but also have included jQuery libs so my <head> part is like this: @Scripts.Render("~/Scripts/bootstrap.min.js") @Styles.Render("~/Content/bootstrap.css") @Styles.Render("~/Content/themes/base/jquery.ui.smoothness.css") @Scripts.Render("~/Scripts/jquery-2.0.3.min.js") @Scripts.Render("~/Scripts/jquery-ui-1.10.3.min.js") //just skipped the standard stuff In the body I want to have two navbars and one side menu which will be the same for all my pages but I've noticed that when I start to narrow the window at some point instead of getting an effect similar to this example (noticed how the elements get repositioned) I just got both my navbars gone, I can't see them. The markup for my first navbar is this : <div class="navbar navbar-static-top navbar-inverse navbar-collapse collapse" role="navigation"> <ul class="nav navbar-nav "> <li><a href="#">Info</a></li> <li><a href="#">Info</a></li> </ul> </div> and the second one is : <div class="navbar navbar-collapse collapse" role="navigation" id="main-navigation-bar"> <ul class="nav nav-pills nav-justified"> <li style="border: 1px solid grey"><a href="#">Link</a></li> <li><a href="#">Link</a></li> <li><a href="#">Link</a></li> </ul> In fact the only thing left in my _Layout body is this: <div class="container-fluid"> @RenderBody() </div> which is just for compiling purposes and renders this view : <p>1</p> <p>2</p> <p>3</p> <p>4</p> <p>5</p> So when I make the window small enough so that my navbars disappear the only thing left is 1..5 numbers from the rendered view. I tested with only one navbar (commented the other) - no matter which one is commented, when I narrow the window I loose the navbar. How can I keep them using bootstrap 3x?

    Read the article

  • SQL Server 2008: If Multiple Values Set In Other Mutliple Values Set

    - by AJH
    In SQL, is there anyway to accomplish something like this? This is based off a report built in SQL Server Report Builder, where the user can specify multiple text values as a single report parameter. The query for the report grabs all of the values the user selected and stores them in a single variable. I need a way for the query to return only records that have associations to EVERY value the user specified. -- Assume there's a table of Elements with thousands of entries. -- Now we declare a list of properties for those Elements to be associated with. create table #masterTable ( ElementId int, Text varchar(10) ) insert into #masterTable (ElementId, Text) values (1, 'Red'); insert into #masterTable (ElementId, Text) values (1, 'Coarse'); insert into #masterTable (ElementId, Text) values (1, 'Dense'); insert into #masterTable (ElementId, Text) values (2, 'Red'); insert into #masterTable (ElementId, Text) values (2, 'Smooth'); insert into #masterTable (ElementId, Text) values (2, 'Hollow'); -- Element 1 is Red, Coarse, and Dense. Element 2 is Red, Smooth, and Hollow. -- The real table is actually much much larger than this; this is just an example. -- This is me trying to replicate how SQL Server Report Builder treats -- report parameters in its queries. The user selects one, some, all, -- or no properties from a list. The written query treats the user's -- selections as a single variable called @Properties. -- Example scenario 1: User only wants to see Elements that are BOTH Red and Dense. select e.* from Elements e where (@Properties) --ideally a set containing only Red and Dense in (select Text from #masterTable where ElementId = e.Id) --ideally a set containing only Red, Coarse, and Dense --Both Red and Dense are within Element 1's properties (Red, Coarse, Dense), so Element 1 gets returned, but not Element 2. -- Example scenario 2: User only wants to see Elements that are BOTH Red and Hollow. select e.* from Elements e where (@Properties) --ideally a set containing only Red and Hollow in (select Text from #masterTable where ElementId = e.Id) --Both Red and Hollow are within Element 2's properties (Red, Smooth, Hollow), so Element 2 gets returned, but not Element 1. --Example Scenario 3: User only picked the Red option. select e.* from Elements e where (@Properties) --ideally a set containing only Red in (select Text from #masterTable where ElementId = e.Id) --Red is within both Element 1 and Element 2's properties, so both Element 1 and Element 2 get returned. The above syntax doesn't actually work because SQL doesn't seem to allow multiple values on the left side of the "in" comparison. Error that returns: Subquery returned more than 1 value. This is not permitted when the subquery follows =, !=, <, <= , >, >= or when the subquery is used as an expression. Am I even on the right track here? Sorry if the example looks long-winded or confusing.

    Read the article

  • JQuery Datepicker Date highlight Issue

    - by Isola Olufemi
    I have an in-line date picker in which I want to highlight some dates based on array of strings from the server side. I found out the on load of the page with the datepicker, events the matches in the current month will not be highlighted. when I click the next month button the events on the next moth will be highlighted. What I discovered that i the matching only get highlighted when I click to the next month and not when I click back to the previous month. Below is my script: var actionCalDates = new Array(); function getDates(month, year) { $.ajax({ url: "/Index/GetAllAlerts", data: { month: month, year: year }, success: function (result) { var date = new Date(); var i = new Number(date.getMonth()); i += 1; actionCalDates = result.split(","); } }); } function getTitle(ar, d) { var result = ""; for (var i = 0; i < ar.length; i++) { if (ar[i].indexOf(d) != -1) { var e = actionCalDates[i].split(";"); result += e[0] + "\n"; } } return result; } $('#calendar').datepicker({ numberOfMonths: [1, 1], showCurrentAtPos: 0, dateFormat: 'dd/mm/y', beforeShowDay: function (thedate) { var theday = thedate.getDate(); var x = new Number(thedate.getMonth()); x += 1; var date = thedate.getDate() + "/" + x + "/" + thedate.getFullYear(); getDates(x, thedate.getFullYear()); for (var i = 0; i < actionCalDates.length; i++) { var entry = actionCalDates[i].split(";"); if (date == entry[1]) { return [true, "highlight", getTitle(actionCalDates, date)]; } } return [true, "", ""]; }, onChangeMonthYear: function (year, month, inst) { getDates(month, year); }, onSelect: function (d, instance) { $.ajax({ url: '/Index/AlertConvertDate', datatype: 'text', data: { dateString: d }, error: function (xhr, ajaxOptions, thrownError) { alert(xhr.statusText); alert(thrownError); }, success: function (data) { window.SetHomeContent(data); } }); } }); Please can someone point out where I went wrong? Thank you all.

    Read the article

  • Selecting the contents of an ASP.NET TextBox in an UpdatePanel after a partial page postback

    - by Scott Mitchell
    I am having problems selecting the text within a TextBox in an UpdatePanel. Consider a very simple page that contains a single UpdatePanel. Within that UpdatePanel there are two Web controls: A DropDownList with three statically-defined list items, whose AutoPostBack property is set to True, and A TextBox Web control The DropDownList has a server-side event handler for its SelectedIndexChanged event, and in that event handler there's two lines of code: TextBox1.Text = "Whatever"; ScriptManager.RegisterStartupScript(this, this.GetType(), "Select-" + TextBox1.ClientID, string.Format("document.getElementById('{0}').select();", TextBox1.ClientID), true); The idea is that whenever a user chooses and item from the DropDownList there is a partial page postback, at which point the TextBox's Text property is set and selected (via the injected JavaScript). Unfortunately, this doesn't work as-is. (I have also tried putting the script in the pageLoad function with no luck, as in: ScriptManager.RegisterStartupScript(..., "function pageLoad() { ... my script ... }");) What happens is the code runs, but something else on the page receives focus at the conclusion of the partial page postback, causing the TextBox's text to be unselected. I can "fix" this by using JavaScript's setTimeout to delay the execution of my JavaScript code. For instance, if I update the emitted JavaScript to the following: setTimeout("document.getElementById('{0}').select();", 111); It "works." I put works in quotes because it works for this simple page on my computer. In a more complex page on a slower computer with more markup getting passed between the client and server on the partial page postback, I have to up the timeout to over a second to get it to work. I would hope that there is a more foolproof way to achieve this. Rather than saying, "Delay for X milliseconds," it would be ideal to say, "Run this when you're not going to steal the focus." What's perplexing is that the .Focus() method works beautifully. That is, if I scrap my JavaScript and replace it with a call to TextBox1.Focus(); then the TextBox receives focus (although the text is not selected). I've examined the contents of MicrosoftAjaxWebForms.js and see that the focus is set after the registered scripts run, but I'm my JavaScript skills are not strong enough to decode what all is happening here and why the selected text is unselected between the time it is selected and the end of the partial page postback. I've also tried using Firebug's JavaScript debugger and see that when my script runs the TextBox's text is selected. As I continue to step through it the text remains selected, but then after stepping off the last line of script (apparently) it all of the sudden gets unselected. Any ideas? I am pulling my hair out. Thanks in advance...

    Read the article

  • How to stream semi-live audio over internet

    - by Thomas Tempelmann
    I want to write something like Skype, i.e. I have a constant audio stream on one computer and then recompress it in a format that's suitable for a latent internet connection, receive it on the other end and play it. Let's also assume that the internet connection is fairly modern and fast, i.e. DSL or alike, no slow connections over phone and such. The involved computers will also be rather modern (Dual Core Intel CPUs at 2GHz or more). I know how to handle the audio on the machines. What I don't know is how to transmit the audio in an efficient way. The challenges are: I'd like get good audio quality across the line. The stream should be received without drops. The stream may, however, be received with a little delay (a second delay is acceptable). I imagine that the transport software could first determine the average (and max) latency, then start the stream and tell the receiver to wait for that max latency before starting to play the audio. With that, if the latency doesn't get any higher, the entire stream will be playable on the other side without stutter or drops. If, due to unexpected IP latencies or blockages, the stream does get cut off, I want to be able to notice this so that I can take actions (e.g. abort the stream) and eventually start a new transmission. What are my options if I want do use ready-made software for the compression and tranmission? I have no intention to write my own audio compression engine, really. OTOH, I plan to sell the solution in a vertical market, meaning I can afford a few dollars of license fees per copy, but not $100s. I guess the simplest solution would be to just open a TCP stream, send a few packets back and forth to determine their running time (or even use UDP for that), then use the results as the guide for my max latency value, then simply fire the audio data in its raw form (uncompressed 16 bit stereo), along with a timing code over the TCP connection. The receiver reads the data and plays it with the pre-determined delay. That might just work with the type of fast connection I expect. I just wonder if there are better solutions to reach this goal, with better performance (lower latency) and less data (compressed). BTW, I first try to implement this on OS X, but might want to do it on Windows, too, if it proves successful.

    Read the article

  • how to fix protocol violation in c#

    - by Jeremy Styers
    I have a c# "client" and a Java "server". The java server has a wsdl it serves to the client. So far it works for c# to make a request for the server to perform a soap action. My server gets the soap request executes the method and tries to return the result back to the client. When I send the response to c# however, I get "The server committed a protocol violation. Section=ResponseStatusLine". I have spent all day trying to fix this and have come up with nothing that works. If I explain what i did, this post would be very long, so I'll keep it brief. i Googled for hours and everything tells me my "response line" is correct. I tried shutting down Skype, rearranging the response line, adding things, taking things away, etc, etc. All to no avail. This is for a class assignment so no, I can not use apis to help. I must do everything manually on the server side. That means parsing by hand, creating the soap response and the http response by hand. Just thought you'd like to know that before you say to use something that does it for me. I even tried making sure my server was sending the correct header by creating a java client that "mimicked" the c# one so I could see what the server returned. However, it's returning exactly what i told it to send. I tried telling my java client to do the same thing but to an actuall running c# service, to see what a real service returns, and it returned basically the same thing. To be safe, I copied it's response and tried sending it to the c# client and it still threw the error. Can anyone help? I've tried all i can think of, including adding the useUnsafeHeaderParsing to my app config. Nothing is working though. I send it exactly what a real service sends it and it yells at me. I send it what i want and it yells. I'm sending this: "200 OK HTTP/1.0\r\n" + "Content-Length: 201\r\n" + "Cache-Control: private\r\n" + "Content-Type: text/xml; charset=utf-8\r\n\r\n";

    Read the article

  • How should I handle the case in which a username is already in use?

    - by idealmachine
    I'm a JavaScript programmer and new to PHP and MySQL (want to get into server-side coding). Because I'm trying to learn PHP by building a simple online game (more specifically, correspondence chess), I'm starting by implementing a simple user accounts system. Of course, user registration comes first. What are the best practices for: How I should handle the (likely) possibility that when a user tries to register, the username he has chosen is already in use, particularly when it comes to function return values?($result === true is rather ugly, and I'm not sure whether checking the MySQL error code is the best way to do it either) How to cleanly handle varying page titles?($gPageTitle = '...'; require_once 'bgsheader.php'; is also rather ugly) Anything else I'm doing wrong? In some ways, PHP is rather different from JavaScript... Here is a (rather large) excerpt of the code I have written so far. Note that this is a work in progress and is missing security checks that I will add as my next step. function addUser( $username, $password ) { global $gDB, $gPasswordSalt; $stmt = $gDB->prepare( 'INSERT INTO user(user_name, user_password, user_registration) VALUES(?, ?, NOW())' ); $stmt || trigger_error( 'Failed to prepare statement: ' . htmlspecialchars( $gDB->error ) ); $hashedPassword = hash_hmac( 'sha256', $password, $gPasswordSalt, true ); $stmt->bind_param( 'ss', $username, $hashedPassword ); if( $stmt->execute() ) { return true; } elseif( $stmt->errno == 1062) { return 'exists'; } else { trigger_error( 'Failed to execute statement: ' . htmlspecialchars( $stmt->error ) ); } } $username = $_REQUEST['username']; $password = $_REQUEST['password']; $result = addUser( $username, $password ); if( $result === true ) { $gPageTitle = 'Registration successful'; require_once 'bgsheader.php'; echo '<p>You have successfully registered as ' . htmlspecialchars( $username ) . ' on this site.</p>'; } elseif( $result == 'exists' ) { $gPageTitle = 'Username already taken'; require_once 'bgsheader.php'; echo '<p>Someone is already using the username you have chosen. Please try using another one instead.'; } else { trigger_error('This should never happen'); } require_once 'bgsfooter.php';

    Read the article

  • .Net Remote Log Querying

    - by jlafay
    I have a Win Service that I'm working on that consists of the service, WF Service (using WorkflowServiceHost), a Workflow (WorkflowApplication) that queries/processes data from a SQL Server DB, and a Comm Marshall class that handles data flow between the service and the WF. The WF does a lot of heavy data processing and the original app (early VB6) logged all the processing and displayed the results on the screen of the host machine. Critical events will be committed to eventlog because I strongly believe that should be common practice because admins naturally will look there and because it already has support for remote viewing. The workflow will also need to write logging events as it processes and iterates according to our business logic. Such as: records queried, records returned, processed records, etc. The data is very critical and we need to log actions as they occur. The logs are currently kept as text files on disk and I think that is ok. Ideally I would like to record log events in XML so it's easier to query and because it is less costly than a DB, especially since our DB servers do a lot of heavy processing anyways. Since we are replacing essentially a VB6 application with a robust windows service (taking advantage of WF 4.0), it has been requested that a remote client also be created. It receives callbacks from the service after subscribing to it and being added to a collection of subscribers. Basic statistics and summaries are updated client side after receiving basic monitoring data of what is going on with the service. We would like to also provide a way to provide details when we need to examine what is going on further because this is a long running data processing service and issues need to be addressed immediately. What is the best way to implement some type of query from the client that is sent to the service and returned to the client? Would it be efficient to implement another method to expose on the service and then have that pass that off to some querying class/object to examine the XML files by whichever specification and then return it to the client? That's the main concern. I don't want the service to processing to bottleneck much while this occurs. It seems that WF already auto-magically threads well for the most part but I want to make sure this is the right way to go about it. Any suggestions/recommendations on how to architect and implement a small log querying framework for a remote service would be awesome.

    Read the article

  • Marshalling non-Blittable Structs from C# to C++

    - by Greggo
    I'm in the process of rewriting an overengineered and unmaintainable chunk of my company's library code that interfaces between C# and C++. I've started looking into P/Invoke, but it seems like there's not much in the way of accessible help. We're passing a struct that contains various parameters and settings down to unmanaged codes, so we're defining identical structs. We don't need to change any of those parameters on the C++ side, but we do need to access them after the P/Invoked function has returned. My questions are: What is the best way to pass strings? Some are short (device id's which can be set by us), and some are file paths (which may contain Asian characters) Should I pass an IntPtr to the C# struct or should I just let the Marshaller take care of it by putting the struct type in the function signature? Should I be worried about any non-pointer datatypes like bools or enums (in other, related structs)? We have the treat warnings as errors flag set in C++ so we can't use the Microsoft extension for enums to force a datatype. Is P/Invoke actually the way to go? There was some Microsoft documentation about Implicit P/Invoke that said it was more type-safe and performant. For reference, here is one of the pairs of structs I've written so far: C++ /** Struct used for marshalling Scan parameters from managed to unmanaged code. */ struct ScanParameters { LPSTR deviceID; LPSTR spdClock; LPSTR spdStartTrigger; double spinRpm; double startRadius; double endRadius; double trackSpacing; UINT64 numTracks; UINT32 nominalSampleCount; double gainLimit; double sampleRate; double scanHeight; LPWSTR qmoPath; //includes filename LPWSTR qzpPath; //includes filename }; C# /// <summary> /// Struct used for marshalling scan parameters between managed and unmanaged code. /// </summary> [StructLayout(LayoutKind.Sequential)] public struct ScanParameters { [MarshalAs(UnmanagedType.LPStr)] public string deviceID; [MarshalAs(UnmanagedType.LPStr)] public string spdClock; [MarshalAs(UnmanagedType.LPStr)] public string spdStartTrigger; public Double spinRpm; public Double startRadius; public Double endRadius; public Double trackSpacing; public UInt64 numTracks; public UInt32 nominalSampleCount; public Double gainLimit; public Double sampleRate; public Double scanHeight; [MarshalAs(UnmanagedType.LPWStr)] public string qmoPath; [MarshalAs(UnmanagedType.LPWStr)] public string qzpPath; }

    Read the article

  • Java - is this an idiom or pattern, behavior classes with no state

    - by Berlin Brown
    I am trying to incorporate more functional programming idioms into my java development. One pattern that I like the most and avoids side effects is building classes that have behavior but they don't necessarily have any state. The behavior is locked into the methods but they only act on the parameters passed in. The code below is code I am trying to avoid: public class BadObject { private Map<String, String> data = new HashMap<String, String>(); public BadObject() { data.put("data", "data"); } /** * Act on the data class. But this is bad because we can't * rely on the integrity of the object's state. */ public void execute() { data.get("data").toString(); } } The code below is nothing special but I am acting on the parameters and state is contained within that class. We still may run into issues with this class but that is an issue with the method and the state of the data, we can address issues in the routine as opposed to not trusting the entire object. Is this some form of idiom? Is this similar to any pattern that you use? public class SemiStatefulOOP { /** * Private class implies that I can access the members of the <code>Data</code> class * within the <code>SemiStatefulOOP</code> class and I can also access * the getData method from some other class. * * @see Test1 * */ class Data { protected int counter = 0; public int getData() { return counter; } public String toString() { return Integer.toString(counter); } } /** * Act on the data class. */ public void execute(final Data data) { data.counter++; } /** * Act on the data class. */ public void updateStateWithCallToService(final Data data) { data.counter++; } /** * Similar to CLOS (Common Lisp Object System) make instance. */ public Data makeInstance() { return new Data(); } } // End of Class // Issues with the code above: I wanted to declare the Data class private, but then I can't really reference it outside of the class: I can't override the SemiStateful class and access the private members. Usage: final SemiStatefulOOP someObject = new SemiStatefulOOP(); final SemiStatefulOOP.Data data = someObject.makeInstance(); someObject.execute(data); someObject.updateStateWithCallToService(data);

    Read the article

  • how to change color of text following function in javascript

    - by OVERTONE
    Ok before i make spaghetti of this code i thought id ask around here. ive made a quiz for an online site. The answers are stored in an array, and ive a function that checks the answers array to what youve clicked. then it counts them and gives you your score. but i want to change the clor of the right answer wen the user clicks the score button. so the correct answers are highlighted. something like this https://www.shutterpoint.com/Home-Quiz.cfm (just hit submit at the bottom, no need to do the quiz). the little answer icon at the side looks flashy but id rather just have the text change color. heres how my questions are formatted <p>Depth of field is controlled by :?</p> <p id = "question2"><input type="radio" name="question2" id="Answer1" value = "a" onClick ="recordAnswer(2,this.value)"/> The focal length of the lens. <br/> <input type="radio" name="question2" id="Answer2" value = "b" onClick = "recordAnswer(2,this.value)"/> The size of the aperture opening. <br/> <input type="radio" name="question2" id="Answer3" value = "c" onClick = "recordAnswer(2,this.value)"/> The distance between the camera and lens. <br/> <input type="radio" name="question2" id="Answer4" value = "d" onClick = "recordAnswer(2,this.value)"/> All of these. <br/></p> and these are the two functions that are called throughout. record answer is called every time the user clicks a button function recordAnswer(question,answer) { answers[question-1] = answer; } this is the final button which calculates the score function scoreQuiz() { var totalCorrect = 0; for(var count = 0; count<correctAnswers.length;count++) { if(answers[count]== correctAnswers[count]) totalCorrect++; } <!-- alert("You scored " + totalCorrect + " out of 12 correct!"); --> } another function is best i think. ive already made attemots at it and know i have to set the color using document.getElementById('question2').style.color = '#0000ff'; question2 being the p id i think if i take in the value part of (input type....) ill be able to compare it to the answers array. but im not quite sure how to do this. any helpers? maybe something like this document.getElementById("Answer1").style.color = '#0000ff'; using the id part of the (input type line) i think i got it actually. ill post my answer in a sec

    Read the article

  • How do I create/use a Fluent NHibernate convention to automap UInt32 properties to an SQL Server 200

    - by dommer
    I'm trying to use a convention to map UInt32 properties to a SQL Server 2008 database. I don't seem to be able to create a solution based on existing web sources, due to updates in the way Fluent NHibernate works - i.e. examples are out of date. I'm trying to have NHibernate generate the schema (via ExposeConfiguration). I'm happy to have NHibernate map it to anything sensible (e.g. bigint). Here's my code as it currently stands (which, when I try to expose the schema, fails due to SQL Server not supporting UInt32). Apologies for the code being a little long, but I'm not 100% sure what is relevant to the problem, so I'm erring on the side of caution. Most of it is based on this post. The error reported is: System.ArgumentException : Dialect does not support DbType.UInt32 I think I'll need a relatively comprehensive example, as I don't seem to be able to pull the pieces together into a working solution, at present. FluentConfiguration configuration = Fluently.Configure() .Database(MsSqlConfiguration.MsSql2008 .ConnectionString(connectionString)) .Mappings(mapping => mapping.AutoMappings.Add( AutoMap.AssemblyOf<Product>() .Conventions.Add<UInt32UserTypeConvention>())); configuration.ExposeConfiguration(x => new SchemaExport(x).Create(false, true)); namespace NHibernateTest { public class UInt32UserTypeConvention : UserTypeConvention<UInt32UserType> { // Empty. } } namespace NHibernateTest { public class UInt32UserType : IUserType { // Public properties. public bool IsMutable { get { return false; } } public Type ReturnedType { get { return typeof(UInt32); } } public SqlType[] SqlTypes { get { return new SqlType[] { SqlTypeFactory.Int32 }; } } // Public methods. public object Assemble(object cached, object owner) { return cached; } public object DeepCopy(object value) { return value; } public object Disassemble(object value) { return value; } public new bool Equals(object x, object y) { return (x != null && x.Equals(y)); } public int GetHashCode(object x) { return x.GetHashCode(); } public object NullSafeGet(IDataReader rs, string[] names, object owner) { int? i = (int?)NHibernateUtil.Int32.NullSafeGet(rs, names[0]); return (UInt32?)i; } public void NullSafeSet(IDbCommand cmd, object value, int index) { UInt32? u = (UInt32?)value; int? i = (Int32?)u; NHibernateUtil.Int32.NullSafeSet(cmd, i, index); } public object Replace(object original, object target, object owner) { return original; } } }

    Read the article

  • HTTP Post requests using HttpClient take 2 seconds, why?

    - by pableu
    Update: You might better hold off this for a bit, I just noticed I could be my fault after all. Working on this all afternoon, and then I find a flaw ten minutes after posting here, ts. Hi, I'am currently coding an android app that submits stuff in the background using HTTP Post and AsyncTask. I use the org.apache.http.client Package for this. I based my code on this example. Basically, my code looks like this: public void postData() { // Create a new HttpClient and Post Header HttpClient httpclient = new DefaultHttpClient(); HttpPost httppost = new HttpPost("http://192.168.1.137:8880/form"); try { List<NameValuePair> nameValuePairs = new ArrayList<NameValuePair>(2); nameValuePairs.add(new BasicNameValuePair("id", "12345")); nameValuePairs.add(new BasicNameValuePair("stringdata", "AndDev is Cool!")); httppost.setEntity(new UrlEncodedFormEntity(nameValuePairs)); // Execute HTTP Post Request HttpResponse response = httpclient.execute(httppost); } catch (ClientProtocolException e) { Log.e(TAG,e.toString()); } catch (IOException e) { Log.e(TAG,e.toString()); } } The problem is that the httpclient.execute(..) line takes around 1.5 to 3 seconds, and I do not understand why. Just requesting a page with HTTP Get takes around 80 ms or so, so the problem doesn't seem to be the network latency itself. The problem doesn't seem to be on the server side either, I have also tried POSTing data to http://www.disney.com/ with similarly slow results. And Firebug shows 1 ms response time when POSTing data to my server locally. This happens on the Emulator and with my Nexus One (both with Android 2.2). If you want to look at the complete code, I've put it on GitHub. It's just a dummy program to do HTTP Post in the background using AsyncTask on the push of a button. It's my first Android app, and my first java code for a long time. And incidentially, also my first question on Stackoverflow ;-) Any ideas why httpclient.execute(httppost) takes so long?

    Read the article

  • how to animate 2 surfaces in Matlab?

    - by Kate
    Hi everyone, I've written this code which makes an animation of 2 ellipsoids. Parameter k1 of these ellipsoids must depend on time (so they'd move asynchronously), but I need to animate them in one figure. Can I use loop for it or is it better to use timer & some kind of callback functions? The second problem - I need to move inner ellipsoid so they would have one common side. How can I do this? a=5; b=a; c=10; u = (0:0.05*pi:2*pi)'; v = [0:0.05*pi:2*pi]; X = a*sin(u)*cos(v); Y = a*sin(u)*sin(v); Z = c*cos(u)*ones(size(v)); Z(Z0)=0; % cut upper V1=4/3*pi*a*b*c; d=1/2; e=2^d; a2=a/e; b2=a/e; c2=c; V2=4/3*pi*a2*b2*c2; X2 = a2*sin(u)*cos(v);%-2.5; Y2 = b2*sin(u)*sin(v); Z2 = c2*cos(u)*ones(size(v));%+0.25; Z2(Z20)=0; % cut h=1/3; for j = 1:20 k1=(sin(pi*j/20)+0.5)^h; a=a*k1; c=c*k1; X = a*sin(u)*cos(v); Y = a*sin(u)*sin(v); Z = c*cos(u)*ones(size(v)); Z(Z0)=0; a2=a2*k1; b2=a2*k1; c2=c2*k1; X2 = a2*sin(u)*cos(v)+5;%-2.5; Y2 = b2*sin(u)*sin(v); Z2 = c2*cos(u)*ones(size(v));%+0.25; Z2(Z20)=0; hS1=surf(X,Y,Z); alpha(.11) hold on hS2=surf(X2,Y2,Z2); hold off axis([-20 20 -20 20 -20 20]); F(j) = getframe; end movie(F,4)

    Read the article

  • How to reduce redundant code when adding new c++0x rvalue reference operator overloads

    - by Inverse
    I am adding new operator overloads to take advantage of c++0x rvalue references, and I feel like I'm producing a lot of redundant code. I have a class, tree, that holds a tree of algebraic operations on double values. Here is an example use case: tree x = 1.23; tree y = 8.19; tree z = (x + y)/67.31 - 3.15*y; ... std::cout << z; // prints "(1.23 + 8.19)/67.31 - 3.15*8.19" For each binary operation (like plus), each side can be either an lvalue tree, rvalue tree, or double. This results in 8 overloads for each binary operation: // core rvalue overloads for plus: tree operator +(const tree& a, const tree& b); tree operator +(const tree& a, tree&& b); tree operator +(tree&& a, const tree& b); tree operator +(tree&& a, tree&& b); // cast and forward cases: tree operator +(const tree& a, double b) { return a + tree(b); } tree operator +(double a, const tree& b) { return tree(a) + b; } tree operator +(tree&& a, double b) { return std::move(a) + tree(b); } tree operator +(double a, tree&& b) { return tree(a) + std::move(b); } // 8 more overloads for minus // 8 more overloads for multiply // 8 more overloads for divide // etc which also has to be repeated in a way for each binary operation (minus, multiply, divide, etc). As you can see, there are really only 4 functions I actually need to write; the other 4 can cast and forward to the core cases. Do you have any suggestions for reducing the size of this code? PS: The class is actually more complex than just a tree of doubles. Reducing copies does dramatically improve performance of my project. So, the rvalue overloads are worthwhile for me, even with the extra code. I have a suspicion that there might be a way to template away the "cast and forward" cases above, but I can't seem to think of anything.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • css coding on Myspace - Problem

    - by Frederik Wessberg
    Hey Folks. I've read what I could, and I'm certainly no master, but I'm fixing up a colleagues profile on myspace.com, and im working with 2 divs in each side of the screen, and I want them to align so that they are next to each other. I've tried float: left; and float: right;, and I've tried margin: right; on div 1 and such. Could you help? Here's the site: http://www.myspace.com/jonasjohansen This is info for div1: <div class="textBox" align="left" style="width: 290px; word-wrap:break-word"> <span class="orangetext15"> BANDS </span> <b>MOVE</b><br /> Fredrik ....balbalbalbla </div> <style> .textBox { position: relative; left:-320px; top:0px; width: 290px; height: 350px; overflow-y: visible; overflow-x: visible; top: YYYpx; z-index: 3; background-color: transparent; border:none; } </style> This is info for div2: <style>.i {display:none;}{!-eliminate bio header!-}table table td.text table td.text {display:none;}{!-recover in shows and friends-!}table table td.text div table td.text,table table td.text table.friendSpace td.text {display:inline;}{! move up our custom section. You may change px value !}div.myDivR {position:relative; top:0px; margin-bottom:-300px; }{! you can apply style to the custom div !}div.myDivR {background-color:white; border:2px solid; border-color:darkgreen; float: right;}</style></td></tr></table></td></tr></table><span class="off">Re-Open Bio Table give it our own Class </span><table class="myBio" style="width:435px;"><tr><i class="i"></i><td class="myBioHead" valign="center" align="left" width="auto" bgcolor="ffcc99" height="17"> &nbsp;&nbsp;<span class="orangetext15"> ABOUT JONAS JOHANSEN</span> </td></tr><tr><td><table class="myBioI"><tr><td><span class="off"></span> blalbalbalbalbla <span class="off">END Bio Content </span>

    Read the article

  • Where are the function literals in c++?

    - by academicRobot
    First of all, maybe literals is not the right term for this concept, but its the closest I could think of (not literals in the sense of functions as first class citizens). The idea is that when you make a conventional function call, it compiles to something like this: callq <immediate address> But if you make a function call using a function pointer, it compiles to something like this: mov <memory location>,%rax callq *%rax Which is all well and good. However, what if I'm writing a template library that requires a callback of some sort with a specified argument list and the user of the library is expected to know what function they want to call at compile time? Then I would like to write my template to accept a function literal as a template parameter. So, similar to template <int int_literal> struct my_template {...};` I'd like to write template <func_literal_t func_literal> struct my_template {...}; and have calls to func_literal within my_template compile to callq <immediate address>. Is there a facility in C++ for this, or a work around to achieve the same effect? If not, why not (e.g. some cataclysmic side effects)? How about C++0x or another language? Solutions that are not portable are fine. Solutions that include the use of member function pointers would be ideal. I'm not particularly interested in being told "You are a <socially unacceptable term for a person of low IQ>, just use function pointers/functors." This is a curiosity based question, and it seems that it might be useful in some (albeit limited) applications. It seems like this should be possible since function names are just placeholders for a (relative) memory address, so why not allow more liberal use (e.g. aliasing) of this placeholder. p.s. I use function pointers and functions objects all the the time and they are great. But this post got me thinking about the don't pay for what you don't use principle in relation to function calls, and it seems like forcing the use of function pointers or similar facility when the function is known at compile time is a violation of this principle, though a small one.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 406 407 408 409 410 411 412 413 414 415 416 417  | Next Page >