Search Results

Search found 18899 results on 756 pages for 'python c extension'.

Page 422/756 | < Previous Page | 418 419 420 421 422 423 424 425 426 427 428 429  | Next Page >

  • Simple numpy question

    - by dassouki
    I can't get this snippet to work: #base code A = array([ [ 1, 2, 10 ], [ 1, 3, 20 ], [ 1, 4, 30 ], [ 2, 1, 15 ], [ 2, 3, 25 ], [ 2, 4, 35 ], [ 3, 1, 17 ], [ 3, 2, 27 ], [ 3, 4, 37 ], [ 4, 1, 13 ], [ 4, 2, 23 ], [ 4, 3, 33 ] ]) # Number of zones zones = unique1d(A[:,0]) for origin in zones: for destination in zones: if origin != destination: A_ik = A[(A[:,0] == origin & A[:,1] == destination), 2]

    Read the article

  • add a decorate function to a class

    - by wiso
    I have a decorated function (simplified version): class Memoize: def __init__(self, function): self.function = function self.memoized = {} def __call__(self, *args, **kwds): hash = args try: return self.memoized[hash] except KeyError: self.memoized[hash] = self.function(*args) return self.memoized[hash] @Memoize def _DrawPlot(self, options): do something... now I want to add this method to a pre-esisting class. ROOT.TChain.DrawPlot = _DrawPlot when I call this method: chain = TChain() chain.DrawPlot(opts) I got: self.memoized[hash] = self.function(*args) TypeError: _DrawPlot() takes exactly 2 arguments (1 given) why doesn't it propagate self?

    Read the article

  • How to catch YouTube embed code and turn into URL

    - by Jonathan Vanasco
    I need to strip YouTube embed codes down to their URL only. This is the exact opposite of all but one question on StackOverflow. Most people want to turn the URL into an embed code. This question addresses the usage patttern I want, but is tied to a specific embed code's regex ( Strip YouTube Embed Code Down to URL Only ) I'm not familiar with how YouTube has offered embeds over the years - or how the sizes differ. According to their current site, there are 2 possible embed templates and a variety of options. If that's it, I can handle a regex myself -- but I was hoping someone had more knowledge they could share, so I could write a proper regex pattern that matches them all and not run into endless edge-cases. The full use case scenario : user enters content in web based wysiwig editor backend cleans out youtube & other embed codes; reformats approved embeds into an internal format as the text is all converted to markdown. on display, appropriate current template/code display for youtube or other 3rd party site is generated At a previous company, our tech-team devised a plan where YouTube videos were embedded by listing the URL only. That worked great , but it was in a CMS where everyone was trained. I'm trying to create a similar storage, but for user-generated-content.

    Read the article

  • class inheretence of a attribute which is itself a class

    - by alex
    i have a class which inherets a attribute from a super-class. this attribute is a class itself. class classA(superClass): def func(self,x): if self.attributeB is None: do somthing and in the other class i have class superClass: self.attributB = classB() i get the error AttributeError: class classA has no attribute 'attributeB' when i access the attribute like i showed but if on command line i can see it works, x = classA() x.attributeB is None True so the test works. whats going on in the above code?

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Good looking programs that are built using wxPython for their UI

    - by ChrisC
    I need inspiration and motivation so I'm trying to find examples of different programs that have interesting and attractive UI's created free using wxPython. My searches have been slow to find results. I'm hoping you guys know of some of the best ones out there. btw, I've seen these: http://www.wxpython.org/screenshots.php and the list under "Applications Developed with wxPython" on the wxPython Wikipedia page. Update: only need Windows examples

    Read the article

  • can't use appcfg.py update gae

    - by user353998
    hello, recently i want to upload GAppProxy to GAE. but when i use the appcfg.py to update the files,there comes an error,it was: urllib2.URLError: urlopen error [Errno 8] _ssl.c:480: EOF occurred in violation of protocol i don't know why PS:i live in china,and may be because of the GFW. and when i use the type :appengine.google.com and then input the password,i can't redict to the index page,there is an error too,which says:ssl error

    Read the article

  • Validation on ManyToManyField before Save in Models.py

    - by Heyl1
    I have the following models: class Application(models.Model): users = models.ManyToManyField(User, through='Permission') folder = models.ForeignKey(Folder) class Folder(models.Model): company = models.ManyToManyField(Compnay) class UserProfile(models.Model): user = models.OneToOneField(User, related_name='profile') company = models.ManyToManyField(Company) What I would like to do is to check whether one of the users of the Application has the same company as the Application (via Folder). If this is the case the Application instance should not be saved. The problem is that the ManyToManyFields aren't updated until after the 'post-save' signal. The only option seems to be the new m2m_changed signal. But I'm not sure how I then roll back the save that has already happened. Another option would be to rewrite the save function (in models.py, because I'm talking about the admin here), but I'm not sure how I could access the manytomanyfield content. Finally I've read something about rewriting the save function in the admin of the model in admin.py, however I still wouldn't know how you would access the manytomanyfield content. I have been searching for this everywhere but nothing I come across seems to work for me. If anything is unclear, please tell me. Thanks for your help! Heleen

    Read the article

  • Can anyone tell me why these lines are not working?

    - by user343934
    I am trying to generate tree with fasta file input and Alignment with MuscleCommandline import sys,os, subprocess from Bio import AlignIO from Bio.Align.Applications import MuscleCommandline cline = MuscleCommandline(input="c:\Python26\opuntia.fasta") child= subprocess.Popen(str(cline), stdout = subprocess.PIPE, stderr=subprocess.PIPE, shell=(sys.platform!="win32")) align=AlignIO.read(child.stdout,"fasta") outfile=open('c:\Python26\opuntia.phy','w') AlignIO.write([align],outfile,'phylip') outfile.close() I always encounter with these problems Traceback (most recent call last): File "", line 244, in run_nodebug File "C:\Python26\muscleIO.py", line 11, in align=AlignIO.read(child.stdout,"fasta") File "C:\Python26\Lib\site-packages\Bio\AlignIO_init_.py", line 423, in read raise ValueError("No records found in handle") ValueError: No records found in handle

    Read the article

  • Testing InlineFormset clean methods

    - by Rory
    I have a Django project, with 2 models, a Structure and Bracket, the Bracket has a ForeignKey to a Structure (i.e. one-to-many, one Structure has many Brackets). I created a TabularInline for the admin site, so that there would be a table of Brackets on the Structure. I added a custom formset with some a custom clean method to do some extra validation, you can't have a Bracket that conflicts with another Bracket on the same Structure etc. The admin looks like this: class BracketInline(admin.TabularInline): model = Bracket formset = BracketInlineFormset class StructureAdmin(admin.ModelAdmin): inlines = [ BracketInline ] admin.site.register(Structure, StructureAdmin) That all works, and the validation works. However now I want to write some unittest to test my complex formset validation logic. My first attempt to validate known-good values is: data = {'form-TOTAL_FORMS': '1', 'form-INITIAL_FORMS': '0', 'form-MAX_NUM_FORMS': '', 'form-0-field1':'good-value', … } formset = BracketInlineFormset(data) self.assertTrue(formset.is_valid()) However that doesn't work and raises the exception: ====================================================================== ERROR: testValid (appname.tests.StructureTestCase) ---------------------------------------------------------------------- Traceback (most recent call last): File "/paht/to/project/tests.py", line 494, in testValid formset = BracketInlineFormset(data) File "/path/to/django/forms/models.py", line 672, in __init__ self.instance = self.fk.rel.to() AttributeError: 'BracketInlineFormset' object has no attribute 'fk' ---------------------------------------------------------------------- The Django documentation (for formset validation) implies one can do this. How come this isn't working? How do I test the custom clean()/validation for my inline formset?

    Read the article

  • How to give points for each indices of list

    - by Eric Jung
    def voting_borda(rank_ballots): '''(list of list of str) -> tuple of (str, list of int) The parameter is a list of 4-element lists that represent rank ballots for a single riding. The Borda Count is determined by assigning points according to ranking. A party gets 3 points for each first-choice ranking, 2 points for each second-choice ranking and 1 point for each third-choice ranking. (No points are awarded for being ranked fourth.) For example, the rank ballot shown above would contribute 3 points to the Liberal count, 2 points to the Green count and 1 point to the CPC count. The party that receives the most points wins the seat. Return a tuple where the first element is the name of the winning party according to Borda Count and the second element is a four-element list that contains the total number of points for each party. The order of the list elements corresponds to the order of the parties in PARTY_INDICES.''' #>>> voting_borda([['GREEN','NDP', 'LIBERAL', 'CPC'], ['GREEN','CPC','LIBERAL','NDP'], ['LIBERAL','NDP', 'CPC', 'GREEN']]) #('GREEN',[4, 6, 5, 3]) list_of_party_order = [] for sublist in rank_ballots: for party in sublist[0]: if party == 'GREEN': GREEN_COUNT += 3 elif party == 'NDP': NDP_COUNT += 3 elif party == 'LIBERAL': LIBERAL_COUNT += 3 elif party == 'CPC': CPC_COUNT += 3 for party in sublist[1]: if party == 'GREEN': GREEN_COUNT += 2 elif party == 'NDP': NDP_COUNT += 2 elif party == 'LIBERAL': LIBERAL_COUNT += 2 elif party == 'CPC': CPC_COUNT += 2 for party in sublist[2]: if party == 'GREEN': GREEN_COUNT += 1 elif party == 'NDP': NDP_COUNT += 1 elif party == 'LIBERAL': LIBERAL_COUNT += 1 elif party == 'CPC': CPC_COUNT += 1 I don't know how I would give points for each indices of the list MORE SIMPLY. Can someone please help me? Without being too complicated. Thank you!

    Read the article

  • Getting the previous line in Jython

    - by kdev
    I want to print the line immediately before the searched string. How can I do that? Lets say my two lines are AADRG SDFJGKDFSDF and I am searching for SDF. I have found SDFJGKDFSDF, but how can I obtain the previous line AADRG? Does file.readline()-1 work?

    Read the article

  • Not work variables in django templates

    - by ??????? ???????
    My context dictionary not sending to my templates. I have function from django.shortcuts import render_to_response def home(request): return render_to_response('home.html',{'test':'test'}) and i have simple template such as: <html> <body> my test == {{test}} </body> </html> When i open my site in browser, i have "my test == ". settings.py is default. I dont use something custom. What the problem? Server is apache with wsgi module.

    Read the article

  • Can you change/redirect a django form's function by passing in your own function?

    - by Derek
    I'm dealing with django-paypal and want to change the button src images. So I went the the conf.py file in the source and edited the src destination. However, I really want to leave the source alone, and I noticed that the class PayPalPaymentsForm(forms.Form): has def get_image(self): return { (True, self.SUBSCRIBE): SUBSCRIPTION_SANDBOX_IMAGE, (True, self.BUY): SANDBOX_IMAGE, (True, self.DONATE): DONATION_SANDBOX_IMAGE, (False, self.SUBSCRIBE): SUBSCRIPTION_IMAGE, (False, self.BUY): IMAGE, (False, self.DONATE): DONATION_IMAGE, }[TEST, self.button_type] which handles all the image src destinations. Since changing this def in the source is worse than changing conf, I was wondering if there was a way to pass in customized defs you make like passing in initial arguments in forms? This way no source code is changed, and I can customize the get_image def as much as I need. passing in def something like this? def get_image(self): .... .... paypal = { 'amount': 10, 'item_name': 'test1', 'item_number': 'test1_slug', # PayPal wants a unique invoice ID 'invoice': str(uuid.uuid4()), } form = PayPalPaymentsForm(initial=paypal, get_image) Thanks!

    Read the article

  • JQuery cookie access has stopped working for GAE app

    - by Greg
    I have a google app engine app that has been running for some time, and some javascript code that checks for a login cookie has suddenly stopped working. As far as I can tell, NO code has changed. The relevant code uses the jquery cookies plugin (jquery.cookies.2.2.0.min.js)... // control the default screen depending // if someone is logged in if( $.cookies.get('dev_appserver_login') != null || $.cookies.get('ACSID') != null ) { alert("valid cookie!") $("#inventory-container").show(); } else { alert("INvalid cookie!") $("#welcome-container").show(); } The reason for the two checks is that in the GAE SDK, the cookies are named differently. The production system uses 'ACSID'. This if statement works in the SDK and now fails 100% of the time in production. I have verified that the cookie is, in fact, present when I inspect the page. Thoughts?

    Read the article

  • How to update Geo-Location in fireeagle

    - by Ganesh
    Hi Every One, I am developing an application on fireeagle, there i need to update the users exact location, with out asking any information from the user (i.e) lat, long e.t.c., If it is not possible using yahoo fireeagle, please let me know if there exists any other api's other than yahoo fireeagle. If they can get the exact location of web user in 'Lat' and 'Long', either from 'Pc' or from 'Mobile' browser. Thanks in advance.

    Read the article

  • How to print an Objectified Element?

    - by BeeBand
    I have xml of the format: <channel> <games> <game slot='1'> <id>Bric A Bloc</id> <title-text>BricABloc Hoorah</title-text> <link>Fruit Splat</link> </game> </games> </channel> I've parsed this xml using lxml.objectify, via: tree = objectify.parse(file) There will potentially be a number of <game>s underneath <games>. I understand that I can generate a list of <game> objects via: [ tree.games[0].game[0:4] ] My question is, what class are those objects and is there a function to print any object of whatever class these objects belong to?

    Read the article

  • Append to list of lists

    - by Joel
    Hello, I am trying to build a list of lists using the following code: list=3*[[]] Now I am trying to append a string to the list in position 0: list[0].append("hello") However, instead of receiving the list [ ["hello"] , [], [] ] I am receiving the list: [ ["hello"] ,["hello"] , ["hello"] ] Am I missing something? Thanks, Joel

    Read the article

  • BeautifulSoup: just get inside of a tag, no matter how many enclosing tags there are

    - by AP257
    I'm trying to scrape all the inner html from the <p> elements in a web page using BeautifulSoup. There are internal tags, but I don't care, I just want to get the internal text. For example, for: <p>Red</p> <p><i>Blue</i></p> <p>Yellow</p> <p>Light <b>green</b></p> How can I extract: Red Blue Yellow Light green Neither .string nor .contents[0] does what I need. Nor does .extract(), because I don't want to have to specify the internal tags in advance - I want to deal with any that may occur. Is there a 'just get the visible HTML' type of method in BeautifulSoup? ----UPDATE------ On advice, trying: p_tags = page.findAll('p',text=True) for i, p_tag in enumerate(p_tags): print str(p_tag) But that doesn't help - it just prints out: Red <i>Blue</i> Yellow Light <b>green</b>

    Read the article

  • When to use \A in regex?

    - by S.Mark
    End of line anchor $ match even there is extra trailing \n in matched string, so we use \Z instead of $ For example ^\w+$ will match the string abcd\n but ^\w+\Z is not How about \A and when to use?

    Read the article

< Previous Page | 418 419 420 421 422 423 424 425 426 427 428 429  | Next Page >