Search Results

Search found 15099 results on 604 pages for 'stop loading'.

Page 438/604 | < Previous Page | 434 435 436 437 438 439 440 441 442 443 444 445  | Next Page >

• positioning a div bottom of the page and keep content above

  - by Andy

  I have the following CSS which positions a div at the bottom of the page but how can i stop content flowing underneath it. #footer { position:fixed; bottom:0; background:url(../images/bg-footer.jpg) top; z-index:200; height:34px; width:100%; line-height:34px; padding:0; font-size:11px; color:#fff; } I cant add padding to the body or anything because i have a fullscreen background image in place as per this tutorial: http://css-tricks.com/how-to-resizeable-background-image/ Any help would be appreciated.

  Read the article

• II7 integrated mode MVC deploy 404 not found on "non-Index" actions

  - by majkinetor

  Hello. Once deployed parts of my web-application stop working. Index-es on each controller do work, other then that yields 404. I understand that nothing particular should be done in integrated mode. I don't know how to proceed with troubleshooting. Some info: App is using default app pool set to integrated mode. WebApp is done in net framework 3.5. I use default routing model. Along web.config in root there is web.config in /View folder referencing HttpNotFoundHandler. OS is Windows Server 2008. Any help is appreciated. Thx.

  Read the article

• How to make a service not receive messages at certain times

  - by miker169

  I'm currently learning wcf for an up and coming project. The service I am creating is using MSMQ to update the database, but the database can't accept messages at certain times. The service is going to be a windows service. The one thing I am coming up against at the moment is how I can get the service to stop reading messages from the queue at these times, for instance lets say I don't want to read messages from the queue on sundays. How would I go about implementing this. So that the client can send messages to the queue that update the database but the service doesn't read the messages until monday, so that the database gets all the updates on the monday? I have started looking at creating a customhost, but I'm not sure if I'm heading in the right direction with this. Thanks in advance.

  Read the article

• Long to timestamp for historic data (pre-1900s)

  - by Mike

  I have a database of start and stop times that have previously all had fairly recent data (1960s through present day) which i've been able to store as long integers. This is very simialr to unix timestamps, only with millisecond precision, so a function like java.util.Date.getTime() would be the value of the current time. This has worked well so far, but we recently got data from the 1860s, and the following code no longer works: to_timestamp('1-JAN-1970 00:00:00', 'dd-mon-yyyy hh24:mi:ss') + numtodsinterval(int_to_convert/(1000),'SECOND' ); This wraps the date and we get timestamps in the year 2038. Is there a way around this issue? All of the documentation i've looked at the documentation and timestamps should be able to handle years all the way back to the -4000 (BC), so i'm suspecting an issue with the numtodsinterval. Any ideas suggestions would be greatly appreciated.

  Read the article

• Serialization problem

  - by sandhya

  Hi Is it possible to break the serialization in following scenario? GetObjectValue(StreamingInfo info, ....) { info.AddValue("string1", subobject1); info.AddValue("string2", Subobject2); . . } Now my scenario is after serializing subobject1, if the size of the stream exceeds some size limit, can i stop serializing remaining subobjects? if yes, how? how can i check the size of the stream into which i am serializing in the middle of serialization process?

  Read the article

• Request/Response objects

  - by Dan

  I'm planning on using CXF's rest implementation. I'm thinking of simply annotating my entity classes with jaxb annotations, such as @XmlRootElement, in order to create response objects. The benefit being avoidance of code duplication. As for the (client) request object, which will be used by a separate web app, I'm thinking of 'copying' the entity classes, removing the orm annotations, and adding jaxb annotations. Based on the above: Are there any dangers of creating request/response objects from entity classes? My entity classes contain relational properties, if I were to annotate them with @XmlRootElement, how can I stop the relational properties from being added (or considered apart of) to the response object? Is there a better/easier way to create request objects rather than copying the entity classes, removing/adding annotations?

  Read the article

• When to use a service in Android

  - by Computerish

  Hi everyone, I have a class that fetches data in response to button presses in the main activity. Unfortunately, I keep running into problems because this class is not an Activity or a Service. For example, without a Context I cannot translate a resource id into a string: getString(R.string.example_string); // Doesn't work Should I make this class into a Service and have the main Activity stop the class when it is closed? Should I pass the Context from the Activity into this class like this? MyClass c = new MyClass(this); Or is there some better way to handle this problem? This issue also comes up when I try to send a Toast from this class.

  Read the article

• What is "with" used for in PHP?

  - by Jason

  I have come across this line in the eloquent ORM library: return with(new static)->newQuery(); I've never seen "with" used before, and cannot find it in the PHP documentation. I'm guessing "with" is a stop-word in most searches, so I am not even getting close. Never having encountered "with" in many years of programming PHP, I feel like I'm missing out. What does it do? I did come across one passing comment regarding the ORM, that mentioned "with" is no longer needed in PHP-5.4, but that was as much as was said.

  Read the article

• Actionscript 2.0 element.text always outputs "00"

  - by Mbarry

  Hi everybody, I'm fighting against a strange behaviour with my actionscript! After setting the four integer variables from the MovieTimer sprite (hour, minute, second, mili-sec) and concate them i got always double zero: 00 stop (); delete this.onEnterFrame; var str1; var str2; var mili; var second; var minute; var hour; var timer; mili = _root.MovieTimer.txt_mili.text; second = _root.MovieTimer.txt_sec.text; minute = _root.MovieTimer.txt_min.text; hour = _root.MovieTimer.txt_heures.text; timer = hour+' : '+minute+' : '+second+' : '+mili; _root.MovieSpellFinish.TextTime.text = timer; _root.MovieSpellFinish.TextTime.text outputs: 00 is there any solutions for this??

  Read the article

• Flash Builder 'building' html files...

  - by Frank

  I'm using Flash Builder 3 to edit my Flex app, but I noticed that every time I make a change on the .html files (index.template.html for example), even if it's not in the IDE but with another program, Flash Builder rebuilds the whole project. Is there anyway to stop this? Why would it need to rebuild the workspace everytime a html file changes? If it was too long it wouldn't bother me, but it takes a lot of time (more than 1 minute) every time. For your information the html file is 95 lines of 'code'. Thanks

  Read the article

• Next Identity Key LINQ + SQL Server

  - by user569347

  To represent our course tree structure in our Linq Dataclasses we have 2 columns that could potentially be the same as the PK. My problem is that if I want to Insert a new record and populate 2 other columns with the PK that was generated there is no way I can get the next identity and stop conflict with other administrators who might be doing the same insert at the same time. Case: A Leaf node has right_id and left_id = itself (prereq_id) **dbo.pre_req:** prereq_id left_id right_id op_id course_id is_head is_coreq is_enforced parent_course_id and I basically want to do this: pre_req rec = new pre_req { left_id = prereq_id, right_id = prereq_id, op_id = 3, course_id = query.course_id, is_head = true, is_coreq = false, parent_course_id = curCourse.course_id }; db.courses.InsertOnSubmit(rec); try { db.SubmitChanges(); } Any way to solve my dilemma? Thanks!

  Read the article

• twisted .loseConnection does not immediately lose connection?

  - by Claudiu

  I have a server with a few clients connected to it. When CTRL+C is hit (that is, reactor starts shutting down), I want to close all my connections, wait until they are cleanly closed, and then stop. I do this by going through the connected clients' transports and calling .loseConnection(). On the ones that are connected locally, they immediately disconnect. However, on one that is connected through the internet, the connection is not immediately lost. Communication stops - and closing the client program no longer even tells the server that the connection has died, although it does before calling .loseConnection() - but the connection is not deemed 'lost' until a few minutes later after I send a few heartbeat requests from the server. I understand that if a connection dies, there's no way for the server to know unless it tries to send some data. But if I specifically ask for a connection to be closed, why does it not just close/disconnect immediately? Am I calling the wrong function?

  Read the article

• Ajax request. Which callback is executed first complete or success?

  - by Gutzofter

  I could spike this to find out, but I'm going to use SO. In my unit tests (qunit) I use the asynchShould (alias for asynchTest) test. Part of the assertion is to wait for the completion/success of the request. Like this: asyncShould('talk to customer list server', 1, function() { stop(2000); var forCustomerList = newCustomerListRequest(); forCustomerList.page = 'helpers/helper.php'; forCustomerList.data += '&action=customerListServer&DB=11001'; var originalSuccess = forCustomerList.success; forCustomerList.success = function(msg) { if (msg.flash !== undefined && msg.data !== undefined && msg.status !== undefined) { ok(true, 'json structure correct') } else { ok(false, 'json structure not correct'); } originalSuccess(msg); start(); }; testController.getServerData(forCustomerList); })

  Read the article

• Password Protected Android App

  - by Caution Continues

  I wana make a security app and in case of stolen or lost my app must not be uninstalled without taking password. yes It is possible to make such an app that can take password before getting uninstall.. My friend Aditya Nikhade has made this app :) .But he is not giving me this secrete recipe:( Install this app Findroid from google Play. In this app first you need to unlock your app then only u can uninstall it. So please help me how to crack this technique.. I searched and got some incomplete answer in that we can declare a receiver of type PACKAGED_REMOVED but i want to know how can I stop if my app is being uninstalled. I am little close to solution of it. I am working/studying on Device Administrator. Please paste code snippet if anyone have. Thanks a Ton in advanced....!!!

  Read the article

• Using php to create a password system with chinese characters

  - by WillDonohoe

  Hi guys, I'm having an issue with validating chinese characters against other chinese characters, for example I'm creating a simple password script which gets data from a database, and gets the user input through get. The issue I'm having is for some reason, even though the characters look exactly the same when you echo them out, my if statement still thinks they are different. I have tried using the htmlentities() function to encode the characters, the password from the database encodes nicely, giving me a working '& #35441;' (I've put a space in it to stop it from converting to a chinese character!). The other user input value gives me a load of funny characters. The only thing which I believe must be breaking it, is it encodes in a different way and therefore the php thinks it's 2 completely different strings. Does anybody have any ideas? Thanks in advance, Will

  Read the article

• Embedded quicktime video pause on click how to prevent?

  - by Marek

  I embedded a quicktime video in firefox. It works, but i would like to prevent the users to stop the video by clicking on it with the left mouse button. Reading the apple documentation i didn't find any answear. I came up with a workaround, i just put an almost invisible div over the whole video. The workaround works in firefox for os X, but oddly does not for the same version of firefox in windows. I would appreciate a way, workaround or not, to achive this at least in the windows/firefox environment. Thanks!

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• How to run a progress-bar through an insert query?

  - by Gold

  I have this insert query: try { Cmd.CommandText = @"INSERT INTO BarcodTbl SELECT * FROM [Text;DATABASE=" + PathI + @"\].[Tmp.txt];"; Cmd.ExecuteNonQuery(); Cmd.Dispose(); } catch (Exception ex) { MessageBox.Show(ex.Message); } I have two questions: How can I run a progress-bar from the beginning to the end of the insert? If there is an error, I got the error exception and the action will stop - the query stops and the BarcodTbl is empty. How I can see the error and allow the query to continue filling the table?

  Read the article

• Artificial Intelligence - What to put in, or leave out, and what can be inferred?

  - by D Scott

  I was having a discussion with a coworker (while we were programming) about AI. We were talking about emotions/feelings and if you should choose to leave any out. I asked him, "Would you leave out racism or hate?" and if you did leave those out, what, if any, other emotions might lead to the AI learning the left out emotions or feelings. Should you PROGRAM in measures to stop the AI from learning those feelings? If you teach Love, does it need to know hurt? Or would it learn hurt? If it then knew Hurt would it connect it with Dislike, Hurt and Dislike could that then lead to some other non-programmed emotion? Such as hate? All while tele-commuting from home.

  Read the article

• Identify machine (relatively) uniquely using unc path

  - by Gareth

  Using C#, and given that the user enters in a unc path. Is there a way to verify that 2 months down the line, when I'm writing a file to the unc path, that it is the same machine as when he entered it? i.e. I'm writing some sensitive information to the path, and want to stop someone from putting another machine on the network with the same name / share etc and grabbing the output. Or if the software is running on a laptop and the user plugs it into another network, and there just happens to be a machine with the same name / share... Any ideas, other than using the IP address (and verifying that its the same?). I don't necessarily have any rights on the remote machine other than write access to the unc share. Yes, I'm probably being paranoid, but would like to know if anything is possible...

  Read the article

• Location inheritInChildApplications kill debugger?

  - by chobo2

  Hi I am wondering is this normal when you add this into your web.config <location path="." inheritInChildApplications="false"> </location> The debugger should stop working. Like when I add this to my site and try to run in debug mode it won't activate any of my debug points nor will it lock up Visual studios 2008. I can have it running and still make edits to my C# code. I take the line away and I get the debug mode back and it locks up VS2008.

  Read the article

• Impressing Potential Employers

  - by superfly123

  Where I am, I can't afford to get certification. I'm definitely not the best programmer, but I do know my junk. I've been writing software in C++ for over 8 years now and have a very good knowledge of the Win32 API. But when applying for jobs, I get rejected every time I send a resume. I've given my resume to recruitment firms and asked them what they think's wrong with it and they said the only thing they could think of is the fact that I don't have certifications to prove that I know my stuff. But in my resume, I explain my previous work and projects, and also note that upon request they can actually see what I've done. Is there anything that you would suggest that might help others to stop ignoring my resumes? Thank you

  Read the article

• emacs debugger: how can I step-out, step-over ?

  - by Cheeso

  I don't know why I'm having so much trouble groking the documentation for the elisp debugger. I see it has a commands to "step-into" (d). But for the life of me, I cannot see a step-out or step-over. Can anyone help? If I have this in the Backtrace buffer: Debugger entered--returning value: 5047 line-beginning-position() * c-parse-state() * byte-code("...") * c-guess-basic-syntax() c-show-syntactic-information(nil) call-interactively(c-show-syntactic-information) ...where do I put the cursor, and what key do I type, to step out of the parse-state() fn ? by that I mean, run until that fn returns, and then stop in the debugger again.

  Read the article

• Facing problem in configuring Reporting Server

  - by idrees99

  Hi all, I am using Sql server 2005 express edition and i want to Install and configure Reporting server on my local machine.Now i have installed the reporting server but the issue is that i am unable to configure it properly.when ever i go to start the reporting services it gives me the following message: THE SQL SERVER REPORTING SERVICE(SQLEXPRESS)service on Local computer started and then stopped. Some services stop automatically if they have no work to do, for example, the performance Logs and Alerts service. I am using WindowsXp Professional. plz help me out as i have just started using sql server and i dont have any idea.

  Read the article

• DAQ Triggers in Matlab

  - by RidePlanet

  I'm writing a program that detects the speed of a object by hall effect sensors that are run into MATLAB through a DAQ (MCC USB-1408FS) The problem that has arisen is that I'm using a non-stop scan technique to detect the state of one of 3 sensors. Unfortunately this means that unless the object is rotating past each sensor at the exact rate the program runs, I will see an instantaneous speed (done by comparing the time between two sensors) of zero. I need the sensors to signal the program to count when they are hit, instead of constantly scanning for the signal. How can this be done?

  Read the article

< Previous Page | 434 435 436 437 438 439 440 441 442 443 444 445  | Next Page >