Search Results

Search found 15099 results on 604 pages for 'stop loading'.

Page 438/604 | < Previous Page | 434 435 436 437 438 439 440 441 442 443 444 445  | Next Page >

  • Long to timestamp for historic data (pre-1900s)

    - by Mike
    I have a database of start and stop times that have previously all had fairly recent data (1960s through present day) which i've been able to store as long integers. This is very simialr to unix timestamps, only with millisecond precision, so a function like java.util.Date.getTime() would be the value of the current time. This has worked well so far, but we recently got data from the 1860s, and the following code no longer works: to_timestamp('1-JAN-1970 00:00:00', 'dd-mon-yyyy hh24:mi:ss') + numtodsinterval(int_to_convert/(1000),'SECOND' ); This wraps the date and we get timestamps in the year 2038. Is there a way around this issue? All of the documentation i've looked at the documentation and timestamps should be able to handle years all the way back to the -4000 (BC), so i'm suspecting an issue with the numtodsinterval. Any ideas suggestions would be greatly appreciated.

    Read the article

  • Run C# code after running all javascript codes

    - by Devi
    I am having a form in which a button is there on click of that button i am calling a javascript function in which i am displaying like 3.. 2.. 1 kind of effect then i am returning true. But after showing 3 only return true is getting executed and the form is getting submitted. How to stop form submitting before running the script. Edit: function jsFun() { timerCount(3); //Calling the Timer Function. } var t; function timerCount(cDown) { if (cDown == 0) { clearTimeout(t); return true; } $('#<%= mainContainer.ClientID %>').html(cDown); cDown = cDown - 1; t = setTimeout('timerCount(' + cDown + ')', 1000); } <asp:Button ID="btnStarts" runat="server" Text="Start" OnClientClick="return jsFun();" OnClick="btn_click" />

    Read the article

  • positioning a div bottom of the page and keep content above

    - by Andy
    I have the following CSS which positions a div at the bottom of the page but how can i stop content flowing underneath it. #footer { position:fixed; bottom:0; background:url(../images/bg-footer.jpg) top; z-index:200; height:34px; width:100%; line-height:34px; padding:0; font-size:11px; color:#fff; } I cant add padding to the body or anything because i have a fullscreen background image in place as per this tutorial: http://css-tricks.com/how-to-resizeable-background-image/ Any help would be appreciated.

    Read the article

  • Flash Builder 'building' html files...

    - by Frank
    I'm using Flash Builder 3 to edit my Flex app, but I noticed that every time I make a change on the .html files (index.template.html for example), even if it's not in the IDE but with another program, Flash Builder rebuilds the whole project. Is there anyway to stop this? Why would it need to rebuild the workspace everytime a html file changes? If it was too long it wouldn't bother me, but it takes a lot of time (more than 1 minute) every time. For your information the html file is 95 lines of 'code'. Thanks

    Read the article

  • Browsed Time Problem.

    - by aamir Fayyaz
    I want to display the browsed time of a user, But when i refresh it, it will be again start from 0:0:0. How can it handle? <?php $total_mints=($live_match['match_name']) * (60); ?> <script language="javascript"> display_c(<?=$total_mints?>,'ct'); </script> <script type="text/javascript"> function display_c(start,div){ window.start = parseFloat(start); var end = 0 // change this to stop the counter at a higher value var refresh=1000; // Refresh rate in milli seconds if(window.start >= end ){ mytime=setTimeout("display_ct('"+div+"')",refresh) } else {alert("Time Over ");} </script>

    Read the article

  • Facing problem in configuring Reporting Server

    - by idrees99
    Hi all, I am using Sql server 2005 express edition and i want to Install and configure Reporting server on my local machine.Now i have installed the reporting server but the issue is that i am unable to configure it properly.when ever i go to start the reporting services it gives me the following message: THE SQL SERVER REPORTING SERVICE(SQLEXPRESS)service on Local computer started and then stopped. Some services stop automatically if they have no work to do, for example, the performance Logs and Alerts service. I am using WindowsXp Professional. plz help me out as i have just started using sql server and i dont have any idea.

    Read the article

  • Ajax request. Which callback is executed first complete or success?

    - by Gutzofter
    I could spike this to find out, but I'm going to use SO. In my unit tests (qunit) I use the asynchShould (alias for asynchTest) test. Part of the assertion is to wait for the completion/success of the request. Like this: asyncShould('talk to customer list server', 1, function() { stop(2000); var forCustomerList = newCustomerListRequest(); forCustomerList.page = 'helpers/helper.php'; forCustomerList.data += '&action=customerListServer&DB=11001'; var originalSuccess = forCustomerList.success; forCustomerList.success = function(msg) { if (msg.flash !== undefined && msg.data !== undefined && msg.status !== undefined) { ok(true, 'json structure correct') } else { ok(false, 'json structure not correct'); } originalSuccess(msg); start(); }; testController.getServerData(forCustomerList); })

    Read the article

  • Using php to create a password system with chinese characters

    - by WillDonohoe
    Hi guys, I'm having an issue with validating chinese characters against other chinese characters, for example I'm creating a simple password script which gets data from a database, and gets the user input through get. The issue I'm having is for some reason, even though the characters look exactly the same when you echo them out, my if statement still thinks they are different. I have tried using the htmlentities() function to encode the characters, the password from the database encodes nicely, giving me a working '& #35441;' (I've put a space in it to stop it from converting to a chinese character!). The other user input value gives me a load of funny characters. The only thing which I believe must be breaking it, is it encodes in a different way and therefore the php thinks it's 2 completely different strings. Does anybody have any ideas? Thanks in advance, Will

    Read the article

  • Request/Response objects

    - by Dan
    I'm planning on using CXF's rest implementation. I'm thinking of simply annotating my entity classes with jaxb annotations, such as @XmlRootElement, in order to create response objects. The benefit being avoidance of code duplication. As for the (client) request object, which will be used by a separate web app, I'm thinking of 'copying' the entity classes, removing the orm annotations, and adding jaxb annotations. Based on the above: Are there any dangers of creating request/response objects from entity classes? My entity classes contain relational properties, if I were to annotate them with @XmlRootElement, how can I stop the relational properties from being added (or considered apart of) to the response object? Is there a better/easier way to create request objects rather than copying the entity classes, removing/adding annotations?

    Read the article

  • [Java]Queue in while loop, cannot modify the value?

    - by javaLearner.java
    This is my code: Iterator it = queue.iterator(); while(it.hasNext()){ random = randNumber(1,2); if(random == 1){ queue.poll(); } else { queue.add("new"); queue.poll(); } } It gives me: Exception in thread "test" java.util.ConcurrentModificationException at java.util.LinkedList$ListItr.checkForComodification(LinkedList.java:761) at java.util.LinkedList$ListItr.next(LinkedList.java:696) Edit @Jon Skeet: What I want to do is: I have a queue list in, let say the size is 10, lets say: a,b,c,d ... j Generate a number between 1 and 2. if 1, pull (remove the top element) else if 2 add new element I will stop the loop until I added 3 new elements

    Read the article

  • PHP: Redirect to the same page, changing $_GET.

    - by Jonathan
    Hi, I have this PHP piece of code that gets $_GET['id'] (a number) and do some stuff with this. When its finished I need to increase that number ($_GET['id']) and redirect to the same page but with the new number (also using $_GET['id']). I am doing something like this: $ID = $_GET['id']; // Some stuff here // and then: $newID = $ID++; header('Location: http://localhost/something/something.php?id='.$newID); exit; The problem here is that the browser stop me from doing it and I get this error from the browser (Firefox) : "The page isn't redirecting properly. Firefox has detected that the server is redirecting the request for this address in a way that will never complete." Some help here please!

    Read the article

  • When to use a service in Android

    - by Computerish
    Hi everyone, I have a class that fetches data in response to button presses in the main activity. Unfortunately, I keep running into problems because this class is not an Activity or a Service. For example, without a Context I cannot translate a resource id into a string: getString(R.string.example_string); // Doesn't work Should I make this class into a Service and have the main Activity stop the class when it is closed? Should I pass the Context from the Activity into this class like this? MyClass c = new MyClass(this); Or is there some better way to handle this problem? This issue also comes up when I try to send a Toast from this class.

    Read the article

  • How to make a service not receive messages at certain times

    - by miker169
    I'm currently learning wcf for an up and coming project. The service I am creating is using MSMQ to update the database, but the database can't accept messages at certain times. The service is going to be a windows service. The one thing I am coming up against at the moment is how I can get the service to stop reading messages from the queue at these times, for instance lets say I don't want to read messages from the queue on sundays. How would I go about implementing this. So that the client can send messages to the queue that update the database but the service doesn't read the messages until monday, so that the database gets all the updates on the monday? I have started looking at creating a customhost, but I'm not sure if I'm heading in the right direction with this. Thanks in advance.

    Read the article

  • WP7 How to use a Storyboard

    - by Subby
    I wish to stop using the DispatcherTimer to show animations as that is extremely unpredictable. Instead, I want to start using a Storyboard as that is apparently the best and efficient way to animate controls. I have tried searching for Tutorials but have not, unfortunately, stumbled on one yet. Can anyone please advice me where I can begin? For example, "moving an image across the screen" and then "moving many images at the same time whilst rotating them". Any help is highly appreciated.

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Next Identity Key LINQ + SQL Server

    - by user569347
    To represent our course tree structure in our Linq Dataclasses we have 2 columns that could potentially be the same as the PK. My problem is that if I want to Insert a new record and populate 2 other columns with the PK that was generated there is no way I can get the next identity and stop conflict with other administrators who might be doing the same insert at the same time. Case: A Leaf node has right_id and left_id = itself (prereq_id) **dbo.pre_req:** prereq_id left_id right_id op_id course_id is_head is_coreq is_enforced parent_course_id and I basically want to do this: pre_req rec = new pre_req { left_id = prereq_id, right_id = prereq_id, op_id = 3, course_id = query.course_id, is_head = true, is_coreq = false, parent_course_id = curCourse.course_id }; db.courses.InsertOnSubmit(rec); try { db.SubmitChanges(); } Any way to solve my dilemma? Thanks!

    Read the article

  • IE7 preventDefault() not working on skip links

    - by josh
    I currently have skip links that jump to the div ids and was using e.preventDefault() to stop the url from changing when jumping to the element but in IE7 and IE8 it doesn't work at all using e.preventDefault() and if I take it out the url changes to the div the anchor tag contains reference to. Is their any fix or way around this? Here is the code $('body').delegate('a.skiplink-accessible-text', 'click', function (e) { //e.preventDefault(); if (!$.browser.msie) { e.preventDefault(); } var jumpTo = $(this).attr('href'); $('body').find(jumpTo).attr('tabindex', - 1).focus(); }); EDIT: heres a little jsbin example for testing purposes http://jsbin.com/welcome/20846/edit

    Read the article

  • Can EventMachine recognize all threads are completed?

    - by philipjkim
    I'm an EM newbie and writing two codes to compare synchronous and asynchronous IO. I'm using Ruby 1.8.7. The example for sync IO is: def pause_then_print(str) sleep 2 puts str end 5.times { |i| pause_then_print(i) } puts "Done" This works as expected, taking 10+ seconds until termination. On the other hand, the example for async IO is: require 'rubygems' require 'eventmachine' def pause_then_print(str) Thread.new do EM.run do sleep 2 puts str end end end EventMachine.run do EM.add_timer(2.5) do puts "Done" EM.stop_event_loop end EM.defer(proc do 5.times { |i| pause_then_print(i) } end) end 5 numbers are shown in 2.x seconds. Now I explicitly wrote code that EM event loop to be stopped after 2.5 seconds. But what I want is that the program terminates right after printing out 5 numbers. For doing that, I think EventMachine should recognize all 5 threads are done, and then stop the event loop. How can I do that? Also, please correct the async IO example if it can be more natural and expressive. Thanks in advance.

    Read the article

  • Where does Eclipse save the list of files to open on startup?

    - by Grundlefleck
    Question: where does Eclipse store the list of files it opens on startup? Background: Having installed a plugin into Eclipse which promptly crashed, my Eclipse workspace is in a bit of a state. When started, the building workspace task pauses indefinitely at 20%. Before I uninstall the plugin I want to give it another chance. I have a feeling that the reason Eclipse is pausing is because of a file which was opened when it crashed, which it tries to reopen on startup. If I can stop this file from opening on startup there's a chance I may be able to coax the plugin to behave. The problem is I have no idea where that list of files is persisted between runs of Eclipse. ...a second before I posted this question, I realised I could just delete the file causing the problem (duh). However, the search has frustrated me enough to want to find the answer.

    Read the article

  • Changing the context of a self-executing function

    - by TaylorMac
    This code is copied directly from: http://www.bennadel.com/blog/2264-Changing-The-Execution-Context-Of-Your-Self-Executing-Function-Blocks-In-JavaScript.htm // Set the singleton value to the return value of the self- // executing function block. var singleton = (function(){ // Declare a private variable. var message = "Stop playing with your context!"; this.getMessage = function(){ return( message ); }; // Return this object reference. return( this ); }).call( {} ); // alert the singleton message. alert( "Message:", singleton.getMessage()); ?My thought is that I can use this to better contain the variables and functions in my programs. However, when I try to run the code in a JSfiddle: http://jsfiddle.net/xSKHh/ It does not return the message. What am I missing?

    Read the article

  • VC++ - Asynchronous Thread

    - by JVNR
    I am working on VC++ project, in that my application process a file from input path and generates 3 output "*.DAT" files in the destination path. I will FTP these DAT file to the destination server. After FTP, I need to delete only two output .DAT files the folder. I am able to delete those files, because there one Asynchronous thread running behind the process. Since the thread is running, while deleting it says, "Cannot delete, the file is used by another person". I need to stop that thread and delete the files. Multiple files can also be taken from the input path to process. Please help me in resolving this issue. Its very high priority issue for me. Please help me ASAP.

    Read the article

  • How to run a progress-bar through an insert query?

    - by Gold
    I have this insert query: try { Cmd.CommandText = @"INSERT INTO BarcodTbl SELECT * FROM [Text;DATABASE=" + PathI + @"\].[Tmp.txt];"; Cmd.ExecuteNonQuery(); Cmd.Dispose(); } catch (Exception ex) { MessageBox.Show(ex.Message); } I have two questions: How can I run a progress-bar from the beginning to the end of the insert? If there is an error, I got the error exception and the action will stop - the query stops and the BarcodTbl is empty. How I can see the error and allow the query to continue filling the table?

    Read the article

  • Actionscript 2.0 element.text always outputs "00"

    - by Mbarry
    Hi everybody, I'm fighting against a strange behaviour with my actionscript! After setting the four integer variables from the MovieTimer sprite (hour, minute, second, mili-sec) and concate them i got always double zero: 00 stop (); delete this.onEnterFrame; var str1; var str2; var mili; var second; var minute; var hour; var timer; mili = _root.MovieTimer.txt_mili.text; second = _root.MovieTimer.txt_sec.text; minute = _root.MovieTimer.txt_min.text; hour = _root.MovieTimer.txt_heures.text; timer = hour+' : '+minute+' : '+second+' : '+mili; _root.MovieSpellFinish.TextTime.text = timer; _root.MovieSpellFinish.TextTime.text outputs: 00 is there any solutions for this??

    Read the article

  • Serialization problem

    - by sandhya
    Hi Is it possible to break the serialization in following scenario? GetObjectValue(StreamingInfo info, ....) { info.AddValue("string1", subobject1); info.AddValue("string2", Subobject2); . . } Now my scenario is after serializing subobject1, if the size of the stream exceeds some size limit, can i stop serializing remaining subobjects? if yes, how? how can i check the size of the stream into which i am serializing in the middle of serialization process?

    Read the article

  • emacs debugger: how can I step-out, step-over ?

    - by Cheeso
    I don't know why I'm having so much trouble groking the documentation for the elisp debugger. I see it has a commands to "step-into" (d). But for the life of me, I cannot see a step-out or step-over. Can anyone help? If I have this in the Backtrace buffer: Debugger entered--returning value: 5047 line-beginning-position() * c-parse-state() * byte-code("...") * c-guess-basic-syntax() c-show-syntactic-information(nil) call-interactively(c-show-syntactic-information) ...where do I put the cursor, and what key do I type, to step out of the parse-state() fn ? by that I mean, run until that fn returns, and then stop in the debugger again.

    Read the article

< Previous Page | 434 435 436 437 438 439 440 441 442 443 444 445  | Next Page >