Search Results

Search found 15099 results on 604 pages for 'stop loading'.

Page 439/604 | < Previous Page | 435 436 437 438 439 440 441 442 443 444 445 446  | Next Page >

  • Impressing Potential Employers

    - by superfly123
    Where I am, I can't afford to get certification. I'm definitely not the best programmer, but I do know my junk. I've been writing software in C++ for over 8 years now and have a very good knowledge of the Win32 API. But when applying for jobs, I get rejected every time I send a resume. I've given my resume to recruitment firms and asked them what they think's wrong with it and they said the only thing they could think of is the fact that I don't have certifications to prove that I know my stuff. But in my resume, I explain my previous work and projects, and also note that upon request they can actually see what I've done. Is there anything that you would suggest that might help others to stop ignoring my resumes? Thank you

    Read the article

  • Where does Eclipse save the list of files to open on startup?

    - by Grundlefleck
    Question: where does Eclipse store the list of files it opens on startup? Background: Having installed a plugin into Eclipse which promptly crashed, my Eclipse workspace is in a bit of a state. When started, the building workspace task pauses indefinitely at 20%. Before I uninstall the plugin I want to give it another chance. I have a feeling that the reason Eclipse is pausing is because of a file which was opened when it crashed, which it tries to reopen on startup. If I can stop this file from opening on startup there's a chance I may be able to coax the plugin to behave. The problem is I have no idea where that list of files is persisted between runs of Eclipse. ...a second before I posted this question, I realised I could just delete the file causing the problem (duh). However, the search has frustrated me enough to want to find the answer.

    Read the article

  • NSString inheritance

    - by Stef
    Hi, I'm doing an useless thing for my first step in Obj-C @interface String : NSString { int m_isnull; } - (id) init; - (int) isNull; @end @implementation String - (id) init { self = [super init]; m_isnull=1; return self; } - (int) isNull { return m_isnull; } @end test : String *a; a=@"ok"; Works fine, but just 2 little questions 1) When I'm compiling I have this warning warning: incompatible Objective-C types assigning 'struct NSString *', expected 'struct String *' I don't know how to avoid it !? 2) a=@"ok" is a fastest way to initialize a string, but when I'm debugging, I don't stop by at my init constructor why ?

    Read the article

  • Changing the context of a self-executing function

    - by TaylorMac
    This code is copied directly from: http://www.bennadel.com/blog/2264-Changing-The-Execution-Context-Of-Your-Self-Executing-Function-Blocks-In-JavaScript.htm // Set the singleton value to the return value of the self- // executing function block. var singleton = (function(){ // Declare a private variable. var message = "Stop playing with your context!"; this.getMessage = function(){ return( message ); }; // Return this object reference. return( this ); }).call( {} ); // alert the singleton message. alert( "Message:", singleton.getMessage()); ?My thought is that I can use this to better contain the variables and functions in my programs. However, when I try to run the code in a JSfiddle: http://jsfiddle.net/xSKHh/ It does not return the message. What am I missing?

    Read the article

  • emacs debugger: how can I step-out, step-over ?

    - by Cheeso
    I don't know why I'm having so much trouble groking the documentation for the elisp debugger. I see it has a commands to "step-into" (d). But for the life of me, I cannot see a step-out or step-over. Can anyone help? If I have this in the Backtrace buffer: Debugger entered--returning value: 5047 line-beginning-position() * c-parse-state() * byte-code("...") * c-guess-basic-syntax() c-show-syntactic-information(nil) call-interactively(c-show-syntactic-information) ...where do I put the cursor, and what key do I type, to step out of the parse-state() fn ? by that I mean, run until that fn returns, and then stop in the debugger again.

    Read the article

  • problem in playing next song in the avaudioplayer

    - by Rajashekar
    Hello friends my delegate method looks like this. after the first song is played it goes into this method and plays the second song , however when the second song is done playing it stops. it does not go into the delegate method.i need to play all the songs continuously. i am not sure, why. can someone help me. (void)audioPlayerDidFinishPlaying:(AVAudioPlayer *)p successfully:(BOOL)flag { if (flag == NO) NSLog(@"Playback finished unsuccessfully"); else { //[player stop]; index++; NSLog(@"%d",index); path=[[NSBundle mainBundle] pathForResource:[songlist objectAtIndex:index] ofType:@"mp3"]; [player initWithContentsOfURL:[NSURL fileURLWithPath:path] error:NULL]; [songlabel2 setTitle:[songlist objectAtIndex:index]]; [endtime setText:[NSString stringWithFormat:@"%.2f",[player duration]/100]]; [player play]; } }

    Read the article

  • Sending some byte at time

    - by user1417815
    I'm trying to figure out way to send some amount of text from the string ech time until it reach the end of the string, example: const char* the_string = "hello world, i'm happy to meet you all. Let be friends or maybe more, but nothing less" Output: hello world Output: , i'm happy to meet you all. Output: Let be friends or maybe more Output: , but nothing less stop: no more bytes to send. the problem i have searched google, but didn't understand the examples, i spent 4 days trying find a good way, also that sendt 5 bytes at time, but in case there is less, then send them until you are at the end of the string. please help me out guys, i will accept a C or C++ way, as long it works and well explained.

    Read the article

  • SQL: Interrupting a query

    - by NoozNooz42
    I've worked on a project using a proprietary non-SQL DB where queries could be interrupted and in the codebase there were quite some spots where that functionnality was used and made perfect sense (for example to stop a long running query that gets cancelled by the user, or when a more recent query takes place and renders the previous query obsolete, etc.) and I realized I never really saw that kind of "interrupted queries" previously and thought it could make a good SO question (several questions, but they're all related to exactly the same thing): can SQL queries be interrupted? is this part of the SQL standard? if it's not part of the SQL standard, which SQL DBs allow queries to be interrupted (any example most welcome)? is it common to interrupt a DB query (SQL or not) which you'll know you won't care about the result anymore? (in the codebase I've worked on, it sure helps lighten the server's load)

    Read the article

  • twisted .loseConnection does not immediately lose connection?

    - by Claudiu
    I have a server with a few clients connected to it. When CTRL+C is hit (that is, reactor starts shutting down), I want to close all my connections, wait until they are cleanly closed, and then stop. I do this by going through the connected clients' transports and calling .loseConnection(). On the ones that are connected locally, they immediately disconnect. However, on one that is connected through the internet, the connection is not immediately lost. Communication stops - and closing the client program no longer even tells the server that the connection has died, although it does before calling .loseConnection() - but the connection is not deemed 'lost' until a few minutes later after I send a few heartbeat requests from the server. I understand that if a connection dies, there's no way for the server to know unless it tries to send some data. But if I specifically ask for a connection to be closed, why does it not just close/disconnect immediately? Am I calling the wrong function?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Embedded quicktime video pause on click how to prevent?

    - by Marek
    I embedded a quicktime video in firefox. It works, but i would like to prevent the users to stop the video by clicking on it with the left mouse button. Reading the apple documentation i didn't find any answear. I came up with a workaround, i just put an almost invisible div over the whole video. The workaround works in firefox for os X, but oddly does not for the same version of firefox in windows. I would appreciate a way, workaround or not, to achive this at least in the windows/firefox environment. Thanks!

    Read the article

  • DAQ Triggers in Matlab

    - by RidePlanet
    I'm writing a program that detects the speed of a object by hall effect sensors that are run into MATLAB through a DAQ (MCC USB-1408FS) The problem that has arisen is that I'm using a non-stop scan technique to detect the state of one of 3 sensors. Unfortunately this means that unless the object is rotating past each sensor at the exact rate the program runs, I will see an instantaneous speed (done by comparing the time between two sensors) of zero. I need the sensors to signal the program to count when they are hit, instead of constantly scanning for the signal. How can this be done?

    Read the article

  • How to have a javascript callback executed after an update panel postback?

    - by TNunes
    I'm using a jQuery tip plugin to show help tips when the user hovers certain elements of the page. I need to register the plugin events after the page is loaded using css selectors. The problem is I'm using an ASP.NET Update Panel and after the first postback, the tips stop working because the update panel replaces the page content but doesn't rebind the javascript events. I need a way to execute a javascript callback after the Update Panel refreshes its content, so I can rebind the javascript events to have the tips working again. Is there any way to do this?

    Read the article

  • how to deal with async calls in Ajax 4.0(using jquery?)

    - by dexter
    in my code i have done something like this. $.get('/Home/Module/Submit', { moduleName: ModName, moduleParameters: moduleParameters }, function(result) { $("#" + target).html(result); }); when i put alert in the function(result) {..} it shows html perfectly(both in alert and at the 'target'-on the .aspx page) BUT when i remove the alert.. on the page the 'html' don't appear or appear randomly (this method is called multiple times) i think that the 'result' comes to function asynchronously thats why it is not bind with the respective 'div' however in the last iteration it gets bind every time. can we make process stop until data gets bind? or is there any functionality (like alert) which can make data bind.. without disturbing UI (unlike alert)?

    Read the article

  • [ASP.NET MVC] Problem with View - it does not refresh after db update

    - by crocodillez
    Hi, I am working with small ASP.NET MVC project - online store. I have addToCart method which adds selected product to cart - it updates cart table in my db and showing cart view with its content. But I have problems. while db is updating correctly the view does not. I see that quantity of the product in my db is incremented correctly but quantity in view is not changed. I have to stop debugging my app in visual studia and restart it - then my view is showing correct data. What can be wrong?

    Read the article

  • Java Pack No Resize

    - by ikurtz
    i am learning Java at the moment and have the following question: i am adding my controls to JFrame and then pack() before displaying. this runs the application and all is very nice. i was wondering is there a way to stop the user from resizing the application window? also is there a way to for the image in JLabel to expand as the user changes the application window? at the moment i have it as: constraints.fill = GridBagConstraints.BOTH; constraints.anchor = GridBagConstraints.CENTER; and it only centers the image, i would like to be able to expand/shrink the image. thanks.

    Read the article

  • Alert Box Running First?

    - by corymathews
    I have some jQuery/JS below. The first thing to run is the alert box at the end. $(document).ready(function() { $("#id1 img , .msg").stop().animate( { width: '300px', height: '300px'}, { duration: 'slow', easing: 'easeInSine' }).pause(3000); $(".msg").animate( { width: '50px', height: '50px' }, { duration: 498, easing: 'easeOutSine' }); $("#id1 img").animate( { width: '50px', height: '50px' }, { duration: 500, easing: 'easeOutSine' }); $("#id1 img , .msg").animate( { width: '300px',height: '300px'}, { duration: 'slow', easing: 'easeInSine' }).pause(3000); alert('eh?'); }); I do have a easing plugin. If I run this the alert will show, and then the first animate will happen in the background but not be shown. It will just appear at the final size. Shouldn't the alert run at the end of all the animation? Can anyone explain why this is happening?

    Read the article

  • eliminating noise/spikes

    - by tgv
    I have a measurement data with similar positive and negative values which should be like: ReqData=[0 0 -2 -2 -2 -2 -2 -2 0 0 0 -2 -2 -2 -2 0 0 2 2 2 2 2 2 0 0 2 2 2 2 2 0 0 2 2 2 2 2 0 0 2 2 2 0 0]' However, there are some measurement noises in the data - so the real data is like this: RealData=[0 0 -2 -2 -2 -2 -2 -2 0 0 0 -2 -2 -2 -2 0 0 2 2 2 2 -4 -1 0 0 2 2 2 2 -7 0 0 2 2 2 2 -1 0 0 2 2 2 0 0]' How do I remove the end noise from the RealData and convert it into ReqData using Matlab? How do I find the start and stop indexes of each set of positive or negative data and split them using Matlab? For instance, ansPositive = [3,8, 12, 15]' and ansNegative = [18, 23, 26, 30, 33, 37, 40, 42]'.

    Read the article

  • Using Session to limit form submission by time

    - by user1733850
    I have spent over 2 hours scouring the net trying to figure this out. I am trying to stop multiple form submission any faster than 60 seconds. Here is what I am using. session_start(); if (!isset($_SESSION['last_submit'])) $_SESSION['last_submit'] = time(); if (time()-$_SESSION['last_submit'] < 60) die('Post limit exceeded. Please wait at least 60 seconds'); else $_SESION['last_submit'] = time(); I found this bit here on the site but haven't been able to figure anything else out as far as getting it to work. I have this bit of code on my page at the beginning that does the DB query with the previous pages POST results. Do I need to set $last_submit to a certain value? Any help is appreciated.

    Read the article

  • Visual Studio C++ adds "junk" to my programs

    - by sub
    I have looked into the binaries produced by MSVC 2010 from my source code, and saw everything being filled with "junk". I don't know how to explain, but my executables are being added too much unnecessary information, like: Lots of Microsoft default error messages, I don't want them XML schema settings (Why!?) Other things not important for the execution of the main program How can I stop MSVC doing this? Do I have to switch to GCC? In all other programs (written in C++ too, from Word processors to games), this junk simply doesn't exist.

    Read the article

  • Problem with sockets in C#

    - by depo
    Socket socket = new Socket(ipe.AddressFamily, SocketType.Stream, ProtocolType.Tcp); ... socket.SetSocketOption(SocketOptionLevel.Socket, SocketOptionName.ReceiveTimeout, 1000); ... socket.Send(bytesSent, bytesSent.Length, 0); ... bytes = socket.Receive(bytesReceived, bytesReceived.Length, 0); After socket has sent the data, server does not respond so that program waits for response. How to stop receiving data after 1000 miliseconds? ?

    Read the article

  • jquery animate() problem

    - by meo
    $('#somediv').stop(false, true).animate({marginLeft: '-=' + e.width() + 'px'}, options.speed, function(){ options.onNewSlide() }) e.with() returns 640 opctions.speed contains 800 options.onNewSlide() contains a a custom callback function It works fine in firefox. But i debugged it with jquery.lint because it was throwing some random error in IE. lint tells me: When I called animate(...) with your args, an error was thrown! TypeError: c.speed is not a function { message="c.speed is not a function", more...} You passed: [Object { marginLeft="-=640px"}, 800, function()] and it indicates me the line i have posted. I have checked the jquery doc, but my syntax seams ok. Do you know what i am doing wrong?

    Read the article

  • Core Animation cross-dissolve between one string (or image) and another when changing bound value?

    - by danwood
    I have an NSTextView and an NSImageView that is bound to a NSString and an NSImage in my code. I would like to have the displayed string and image cross-dissolve when I change the string and image in code. Any way to do this? Do I need to stop using bindings? (And if I do, is there any trick to getting the string and the image to cross-dissolve when I change the value, or do I have to do something weird like fade it out and fade a new one back in?)

    Read the article

  • JQuery: addClass() not changing background on selector

    - by centr0
    im having a little trouble getting the background image to swap out on click() $('.highlight-boxes li a[class!=selected-box]').click(function() { $('.highlight-content').hide(); $('.highlight-boxes li a').removeClass(); $(this).addClass('box-selected'); // problem here var selected = $(this).attr('href').substr(1); $('#' + selected).stop(true,true).fadeIn(); return false; }); console.log() in firebug returns the correct element being clicked but $(this).addClass('box-selected') does not change the background of the currently clicked element. any ideas? TIA

    Read the article

  • pointer and malloc [closed]

    - by gcc
    How many methods/ways are there taking input by using with pointer and dynamic memory? Input: 3 1 2 n k l 2 1 2 p 4 55 62 * # x (x is stop value, first input always integer) Example code: p=malloc(sizeof(int)); scanf("%d",&num_arrays); while(1) { scanf("%c",&(*(p+i))); if(*(p+i)=='x') break; ++i; } "3" is stored in num_arrays. The other input values are stored in pointer[array].

    Read the article

< Previous Page | 435 436 437 438 439 440 441 442 443 444 445 446  | Next Page >